ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet63c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) ... 476 e-131
2gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) ... 476 e-131
3gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) ... 468 e-129
4gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, c... 468 e-129
5ref|XM_463914.1| Oryza sativa (japonica cultivar-group), mRNA 283 2e-73
6ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group... 283 2e-73
7gb|BT016412.1| Zea mays clone Contig245 mRNA sequence 283 2e-73
8gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA... 283 2e-73
9emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin 283 2e-73
10dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 283 2e-73
12dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic D... 283 2e-73
13dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic D... 283 2e-73
14dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clon... 283 2e-73
15gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds 283 2e-73
16gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, com... 283 2e-73
17gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, com... 283 2e-73
18gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence 276 5e-71
19gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence 260 3e-66
20gb|BT016413.1| Zea mays clone Contig246 mRNA sequence 252 7e-64
21gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, parti... 226 4e-56
22gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mR... 170 2e-39
23gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylp... 165 1e-37
24dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 2e-36
25gb|AY105212.1| Zea mays PCO124469 mRNA sequence 151 2e-33
26gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, comp... 149 7e-33
27dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
28dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
29dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
30gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, com... 145 1e-31
31emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin 141 2e-30
32dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
33dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds 135 1e-28
34gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence 129 7e-27
35emb|Y08273.1|DLCYP18 D.lanata CYP18 gene 119 7e-24
36gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, compl... 119 7e-24
37gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 c... 117 3e-23
38gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, p... 113 4e-22
39gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complet... 111 2e-21
40gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complet... 111 2e-21
41gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence 111 2e-21
42gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence 111 2e-21
43gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA 111 2e-21
44ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA... 111 2e-21
45gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 ... 111 2e-21
46gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, p... 111 2e-21
47gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, ... 111 2e-21
48gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial... 109 6e-21
49ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (... 103 4e-19
50dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, co... 103 4e-19
51gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene... 100 6e-18
52gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophi... 100 6e-18
53emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA... 96 1e-16
54ref|XM_323171.1| Neurospora crassa OR74A hypothetical protein ( ... 94 4e-16
55ref|XM_950770.1| Neurospora crassa OR74A hypothetical protein ( ... 94 4e-16
56emb|AJ292563.1|NCR292563 Neurospora crassa mRNA for cyclophilin41 94 4e-16
57emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin 92 1e-15
58dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
59dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
60emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin 92 1e-15
61dbj|AK068112.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 1e-15
62gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclo... 92 1e-15
63gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 90 6e-15
64ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA 90 6e-15
65gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds 88 2e-14
66emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin... 88 2e-14
67emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclospor... 88 2e-14
68dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin,... 88 2e-14
69dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, part... 88 2e-14
70ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript v... 86 9e-14
71ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript v... 86 9e-14
72gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, r... 86 9e-14
73gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA 86 9e-14
74gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66... 86 9e-14
75gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 ... 86 9e-14
76ref|XM_467917.1| Oryza sativa (japonica cultivar-group), mRNA 82 1e-12
77gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cy... 82 1e-12
78dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 82 1e-12
79dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic D... 82 1e-12
80dbj|AK070404.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
81dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds 82 1e-12
82ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( ... 80 6e-12
83ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( ... 80 6e-12
84ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl... 80 6e-12
85ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl... 80 6e-12
86gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence 80 6e-12
87emb|BX045917.1|CNS097LD Single read from an extremity of a full-... 80 6e-12
88emb|BX045916.1|CNS097LC Single read from an extremity of a full-... 80 6e-12
89emb|BX032973.1|CNS08XLT Single read from an extremity of a full-... 80 6e-12
90emb|BX032972.1|CNS08XLS Single read from an extremity of a full-... 80 6e-12
91emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-... 80 6e-12
92emb|BX027425.1|CNS08TBP Single read from an extremity of a full-... 80 6e-12
93emb|BX025264.1|CNS08RNO Single read from an extremity of a full-... 80 6e-12
94emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-... 80 6e-12
95emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-... 80 6e-12
96emb|BX010692.1|CNS08GEW Single read from an extremity of a full-... 80 6e-12
97emb|BX010691.1|CNS08GEV Single read from an extremity of a full-... 80 6e-12
98gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA)... 80 6e-12
99gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mR... 80 6e-12
100gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (C... 80 6e-12
101gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exo... 80 6e-12
102ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257 ... 80 6e-12
103gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding pr... 80 6e-12
104gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds 78 2e-11
105emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylproly... 78 2e-11
106ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (... 76 9e-11
107emb|BX072404.1|CNS09S14 Single read from an extremity of a full-... 76 9e-11
108emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-... 76 9e-11
109emb|BX057302.1|CNS09GDM Single read from an extremity of a full-... 76 9e-11
110emb|BX050608.1|CNS09B7O Single read from an extremity of a full-... 76 9e-11
111emb|BX046149.1|CNS097RT Single read from an extremity of a full-... 76 9e-11
112emb|BX036923.1|CNS090NJ Single read from an extremity of a full-... 76 9e-11
113emb|BX024694.1|CNS08R7U Single read from an extremity of a full-... 76 9e-11
114emb|BX016404.1|CNS08KTK Single read from an extremity of a full-... 76 9e-11
115emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-... 76 9e-11
116emb|BX013233.1|CNS08IDH Single read from an extremity of a full-... 76 9e-11
117emb|BX011227.1|CNS08GTR Single read from an extremity of a full-... 76 9e-11
118emb|BX008702.1|CNS08EVM Single read from an extremity of a full-... 76 9e-11
119emb|BX006580.1|CNS08D8O Single read from an extremity of a full-... 76 9e-11
120emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete ... 76 9e-11
121gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 76 9e-11
122ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778 ... 76 9e-11
123ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA 76 9e-11
124ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-proly... 74 4e-10
125emb|CR956427.7| Pig DNA sequence from clone CH242-51O7 on chromo... 74 4e-10
126gb|DQ440048.1| Aedes aegypti clone AE-296 cyclophylin isoform mR... 72 1e-09
127gb|AY368274.1| Nicotiana tabacum cyclophilin-like (CYP1) mRNA, c... 72 1e-09
128ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 72 1e-09
129emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA 72 1e-09
130emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA 72 1e-09
131emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA 72 1e-09
132emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA 72 1e-09
133gb|AY346337.1| Branchiostoma belcheri tsingtaunese cyclophilin A... 72 1e-09
134gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds 72 1e-09
135emb|BX053495.1|CNS09DFV Single read from an extremity of a full-... 72 1e-09
136emb|BX053494.1|CNS09DFU Single read from an extremity of a full-... 72 1e-09
137emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-... 72 1e-09
138emb|BX043476.1|CNS095PK Single read from an extremity of a full-... 72 1e-09
139emb|BX043545.1|CNS095RH Single read from an extremity of a full-... 72 1e-09
140emb|BX043544.1|CNS095RG Single read from an extremity of a full-... 72 1e-09
141emb|BX025263.1|CNS08RNN Single read from an extremity of a full-... 72 1e-09
142emb|CR938346.1| Single read from an extremity of a full-length c... 72 1e-09
143emb|CR938040.1| Single read from an extremity of a full-length c... 72 1e-09
144ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl iso... 72 1e-09
145gb|AY134669.1| Drosophila melanogaster peptidylprolyl cis-trans ... 70 5e-09
146emb|AJ238310.1|LRU238310 Lumbricus rubellus mRNA for cyclophilin A 70 5e-09
147dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, pa... 70 5e-09
148ref|NM_170367.1| Drosophila melanogaster Moca-cyp CG1866-RA, tra... 70 5e-09
149ref|NM_143361.3| Drosophila melanogaster Moca-cyp CG1866-RB, tra... 70 5e-09
150gb|AY051595.1| Drosophila melanogaster GH23813 full length cDNA 70 5e-09
151gb|AC009345.7|AC009345 Drosophila melanogaster, chromosome 3R, r... 70 5e-09
152gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, r... 70 5e-09
153gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial... 70 5e-09
154gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 10... 70 5e-09
155gb|BT001578.1| Drosophila melanogaster RE23622 full insert cDNA 70 5e-09
156gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete... 68 2e-08
157emb|Z48002.1|TNCYCABPR T.niveum gene for cyclophilin A-binding p... 68 2e-08
158emb|Z32674.1|TNCPTAG T.niveum (ATCC34921) cptA gene for cyclophilin 68 2e-08
159gb|CP000081.1| Leishmania major chromosome 35, complete sequence 66 9e-08
160ref|XM_838488.1| Leishmania major strain Friedlin peptidyl-proly... 66 9e-08
161emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for pu... 66 9e-08
162dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-... 66 9e-08
163gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end 66 9e-08
164ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative... 64 3e-07
165gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome... 64 3e-07
166gb|AF291180.1| Capsicum annuum cyclophilin CACYP1 mRNA, complete... 64 3e-07
167emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA 64 3e-07
168emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA 64 3e-07
169emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA 64 3e-07
170emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA 64 3e-07
171emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA 64 3e-07
172emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA 64 3e-07
173emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA 64 3e-07
174emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA 64 3e-07
175emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA 64 3e-07
176emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA 64 3e-07
177emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA 64 3e-07
178emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA 64 3e-07
179emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA 64 3e-07
180emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA 64 3e-07
181emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA 64 3e-07
182gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome... 64 3e-07
183ref|NM_079049.2| Drosophila melanogaster cyclophilin-33 CG4886-R... 64 3e-07
184gb|AY061421.1| Drosophila melanogaster LD35248 full length cDNA 64 3e-07
185dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
186ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (p... 64 3e-07
187gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1... 64 3e-07
188gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRN... 64 3e-07
189dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-07
190gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gen... 64 3e-07
191gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 64 3e-07
192emb|CR956622.12| Pig DNA sequence from clone PigE-219N9 on chrom... 64 3e-07
193gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRN... 64 3e-07
194ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis... 62 1e-06
195emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA 62 1e-06
196ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predi... 62 1e-06
197emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (... 62 1e-06
198dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, p... 62 1e-06
199emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp ... 62 1e-06
200emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 62 1e-06
201gb|DQ079281.1| Drosophila arizonae strain 15081-1271.13 moj29 (m... 62 1e-06
202gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, compl... 60 5e-06
203gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds 60 5e-06
204gb|AY106356.1| Zea mays PCO149745 mRNA sequence 60 5e-06
205gb|AF041412.1|AF041412 Periplaneta americana peptidyl-prolyl cis... 60 5e-06
206dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, co... 60 5e-06
207gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complet... 58 2e-05
208ref|XM_571478.1| Cryptococcus neoformans var. neoformans JEC21 p... 58 2e-05
209emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allerge... 58 2e-05
210ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predi... 58 2e-05
211ref|NM_067427.3| Caenorhabditis elegans CYclophyliN family membe... 58 2e-05
212gb|AY229877.1| Populus tremuloides cyclophilin mRNA, complete cds 58 2e-05
213emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 58 2e-05
214gb|AY391451.1| Danio rerio peptidylprolyl isomerase A (PPIA-1) m... 56 8e-05
215ref|XM_513346.1| PREDICTED: Pan troglodytes similar to peptidylp... 56 8e-05
216ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 8e-05
217ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM037... 56 8e-05
218ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 c... 56 8e-05
219ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 c... 56 8e-05
220emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA 56 8e-05
221emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA 56 8e-05
222emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-... 56 8e-05
223emb|CR860299.1| Pongo pygmaeus mRNA; cDNA DKFZp459B225 (from clo... 56 8e-05
224emb|AJ609278.1| Cicer arietinum partial mRNA for cyclophilin-typ... 56 8e-05
225dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122 56 8e-05
226gb|AF411956.1| Takifugu rubripes lck gene locus, partial sequence 56 8e-05
227gb|BC107736.1| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
228ref|XM_507866.1| PREDICTED: Pan troglodytes similar to Peptidyl-... 54 3e-04
229gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 54 3e-04
230gb|AC091701.3| Trypanosoma brucei chromosome 8 clone RPCI93-26N1... 54 3e-04
231gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 54 3e-04
232gb|BC008451.1| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
233gb|BC004898.2| Homo sapiens peptidylprolyl isomerase E (cyclophi... 54 3e-04
234gb|DQ160195.1| Homo sapiens cyclophilin-33B mRNA, complete cds, ... 54 3e-04
235ref|XM_820486.1| Trypanosoma brucei TREU927 clone RPCI93-26N11 c... 54 3e-04
236gb|AY231875.1| Drosophila yakuba clone yak-em_CG2852 mRNA sequence 54 3e-04
237ref|XM_774688.1| Giardia lamblia ATCC 50803 cyclophilin (GLP_170... 54 3e-04
238emb|CR703044.2|CNS0G5F4 Tetraodon nigroviridis full-length cDNA 54 3e-04
239emb|CR700424.2|CNS0G3EC Tetraodon nigroviridis full-length cDNA 54 3e-04
240emb|CR698177.2|CNS0G1NX Tetraodon nigroviridis full-length cDNA 54 3e-04
241emb|CR692157.2|CNS0FX0P Tetraodon nigroviridis full-length cDNA 54 3e-04
242emb|CR693402.1|CNS0FXZA Tetraodon nigroviridis full-length cDNA 54 3e-04
243emb|CR691999.2|CNS0FWWB Tetraodon nigroviridis full-length cDNA 54 3e-04
244emb|CR684939.2|CNS0FRG7 Tetraodon nigroviridis full-length cDNA 54 3e-04
245emb|CR684835.2|CNS0FRDB Tetraodon nigroviridis full-length cDNA 54 3e-04
246emb|AL049824.4|HSJ117L23 Human DNA sequence from clone RP1-117L2... 54 3e-04
247emb|CR625617.1| full-length cDNA clone CS0DC021YB24 of Neuroblas... 54 3e-04
248emb|CR617834.1| full-length cDNA clone XCL0BA001ZG09 of Placenta... 54 3e-04
249dbj|AK094660.1| Homo sapiens cDNA FLJ37341 fis, clone BRAMY20207... 54 3e-04
250emb|CR595696.1| full-length cDNA clone CS0DL005YD19 of B cells (... 54 3e-04
251emb|CR592103.1| full-length cDNA clone CS0DA010YP14 of Neuroblas... 54 3e-04
252dbj|AB169314.1| Macaca fascicularis testis cDNA, clone: QtsA-188... 54 3e-04
253dbj|AK130628.1| Homo sapiens cDNA FLJ27118 fis, clone SPL06417, ... 54 3e-04
254gb|AF104013.1|AF104013 Homo sapiens peptidyl-prolyl cis-trans is... 54 3e-04
255gb|AF104012.1|AF104012 Homo sapiens peptidyl-prolyl cis-trans is... 54 3e-04
256emb|AL833576.1|HSM804889 Homo sapiens mRNA; cDNA DKFZp686F0856 (... 54 3e-04
257gb|AF042386.1|AF042386 Homo sapiens cyclophilin-33B (CYP-33) mRN... 54 3e-04
258gb|AF042385.1|AF042385 Homo sapiens cyclophilin-33A (CYP-33) mRN... 54 3e-04
259ref|NM_203456.1| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
260ref|NM_203457.1| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
261ref|NM_006112.2| Homo sapiens peptidylprolyl isomerase E (cyclop... 54 3e-04
262gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 52 0.001
263ref|XM_501918.1| Yarrowia lipolytica CLIB122, YALI0C16775g predi... 52 0.001
264ref|NM_205461.1| Gallus gallus peptidylprolyl isomerase B (cyclo... 52 0.001
265gb|AE011730.1| Xanthomonas axonopodis pv. citri str. 306, secti... 52 0.001
266ref|NM_074348.4| Caenorhabditis elegans CYclophyliN family membe... 52 0.001
267emb|AL032663.1|CEY75B12B Caenorhabditis elegans YAC Y75B12B, com... 52 0.001
268gb|U27559.1|CEU27559 Caenorhabditis elegans cyclophilin (cyp-7) ... 52 0.001
269gb|M63553.1|CHKSCYCLO Chicken S-cyclophilin mRNA, complete cds 52 0.001
270ref|NM_172243.1| Rattus norvegicus peptidylprolyl isomerase F (c... 50 0.005
271gb|AY652862.1| Populus balsamifera subsp. trichocarpa peptidyl-p... 50 0.005
272ref|XM_816485.1| Trypanosoma cruzi strain CL Brener cyclophilin ... 50 0.005
273gb|AY231990.1| Drosophila yakuba clone yak-ad_CG7768 mRNA sequence 50 0.005
274emb|CR691294.2|CNS0FWCQ Tetraodon nigroviridis full-length cDNA 50 0.005
275emb|CR662428.2|CNS0FA3M Tetraodon nigroviridis full-length cDNA 50 0.005
276ref|XM_501673.1| Yarrowia lipolytica CLIB122, YALI0C10230g predi... 50 0.005
277gb|AF542973.1| Triticum aestivum cyclophilin mRNA, partial cds 50 0.005
278gb|AY290733.1| Triticum aestivum cyclophilin mRNA, partial sequence 50 0.005
279emb|BX071482.1|CNS09RBI Single read from an extremity of a full-... 50 0.005
280emb|X74403.1|PVCYCGNA P.vulgaris gene for cyclophilin 50 0.005
281emb|X53223.1|SPPPCTI Schizosaccharomyces pombe gene for cyclophi... 50 0.005
282emb|AL121795.1|SPBC28F2 S.pombe chromosome II cosmid c28F2 50 0.005
283gb|BC086977.1| Rattus norvegicus peptidylprolyl isomerase F (cyc... 50 0.005
284ref|NM_001021559.1| Schizosaccharomyces pombe 972h- peptidyl-pro... 50 0.005
285gb|AF191832.1|AF191832 Trypanosoma cruzi cyclophilin A (CYP A) m... 50 0.005
286gb|U34354.1|CEU34354 Caenorhabditis elegans cyclophilin isoform ... 50 0.005
287gb|DQ270193.1| Triticum urartu ER-localized cyclophilin (CYP23-b... 50 0.005
288gb|DQ270190.1| Aegilops tauschii ER-localized cyclophilin (CYP23... 50 0.005
289gb|DQ265737.1| Triticum aestivum cyclophilin (CYP23-f) gene, par... 50 0.005
290gb|DQ265735.1| Triticum aestivum cyclophilin (CYP23-d) gene, par... 50 0.005
291gb|DQ265733.1| Triticum aestivum cyclophilin (CYP23-b) gene, par... 50 0.005
292gb|U68544.1|RNU68544 Rattus norvegicus cyclophilin D mRNA, nucle... 50 0.005
293dbj|D83992.1|YSP972HA Fission yeast DNA for ISP4, peptidyl-proly... 50 0.005
294gb|DQ237914.1| Oryctolagus cuniculus cyclophilin B mRNA, partial... 48 0.020
295gb|AY432659.1| Aedes aegypti ASAP ID: 34009 cyclophilin-type pep... 48 0.020
296gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 48 0.020
297ref|XM_870824.1| PREDICTED: Bos taurus similar to peptidylprolyl... 48 0.020
298gb|DQ440025.1| Aedes aegypti clone AE-239 cyclophylin mRNA, comp... 48 0.020
299ref|XM_533873.2| PREDICTED: Canis familiaris similar to peptidyl... 48 0.020
300ref|XM_850619.1| PREDICTED: Canis familiaris peptidylprolyl isom... 48 0.020
301ref|XM_850591.1| PREDICTED: Canis familiaris peptidylprolyl isom... 48 0.020
302ref|XM_537928.2| PREDICTED: Canis familiaris peptidylprolyl isom... 48 0.020
303ref|XM_785050.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.020
304dbj|AB231813.1| Malassezia restricta CYP mRNA for cyclophilin, p... 48 0.020
305dbj|AB231808.1| Malassezia dermatis CYP mRNA for cyclophilin, pa... 48 0.020
306ref|NM_205373.1| Gallus gallus sema domain, immunoglobulin domai... 48 0.020
307ref|NM_140251.2| Drosophila melanogaster CG10907-RA (CG10907), mRNA 48 0.020
308gb|AC105263.2| Drosophila melanogaster 3L BAC RP98-48G3 (Roswell... 48 0.020
309gb|AF243140.1| Canis familiaris cyclophilin A mRNA, partial cds 48 0.020
310gb|AY070988.1| Drosophila melanogaster RE08109 full length cDNA 48 0.020
311gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.020
312gb|AF139893.1|AF139893 Oryctolagus cuniculus cyclophilin 18 mRNA... 48 0.020
313ref|NM_210368.1| Eremothecium gossypii AER156Cp (AER156C), mRNA 48 0.020
314gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42... 48 0.020
315gb|U28240.1|GGU28240 Gallus gallus collapsin-2 mRNA, complete cds 48 0.020
316gb|L13365.1|ALCCYCLOPH Allium cepa cyclophilin mRNA, complete cds 48 0.020
317ref|NM_000942.4| Homo sapiens peptidylprolyl isomerase B (cyclop... 46 0.080
318ref|XM_510471.1| PREDICTED: Pan troglodytes similar to casein ki... 46 0.080
319gb|DQ215080.1| Taeniopygia guttata clone 0058P0004D09 CLE7 prote... 46 0.080
320ref|NM_005729.3| Homo sapiens peptidylprolyl isomerase F (cyclop... 46 0.080
321gb|BT016150.1| Drosophila melanogaster AT16671 full insert cDNA 46 0.080
322gb|AY440343.1| Armigeres subalbatus ASAP ID: 39123 cyclophilin-t... 46 0.080
323gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 46 0.080
324ref|XM_422376.1| PREDICTED: Gallus gallus similar to RNA process... 46 0.080
325gb|BC008848.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.080
326gb|BC005020.1| Homo sapiens peptidylprolyl isomerase F (cyclophi... 46 0.080
327ref|XM_657095.1| Aspergillus nidulans FGSC A4 hypothetical prote... 46 0.080
328ref|XM_854702.1| PREDICTED: Canis familiaris similar to protein ... 46 0.080
329ref|XM_844699.1| PREDICTED: Canis familiaris similar to protein ... 46 0.080
330ref|XM_853487.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.080
331ref|XM_853443.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.080
332ref|XM_844247.1| PREDICTED: Canis familiaris similar to peptidyl... 46 0.080
333emb|Z92822.2|CEZK520 Caenorhabditis elegans Cosmid ZK520, comple... 46 0.080
334emb|CR723470.2|CNS0GL6C Tetraodon nigroviridis full-length cDNA 46 0.080
335emb|CR673836.2|CNS0FIWI Tetraodon nigroviridis full-length cDNA 46 0.080
336ref|XM_787026.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.080
337emb|X17692.1|NCCYCGEN Neurospora crassa cyclophilin gene 46 0.080
338emb|CR456829.1| Homo sapiens full open reading frame cDNA clone ... 46 0.080
339emb|AJ414049.1|SMA414049 Stenotrophomonas maltophilia putative m... 46 0.080
340gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.080
341gb|AC010573.4| Drosophila melanogaster 3L BAC RP98-2M13 (Roswell... 46 0.080
342emb|CR626335.1| full-length cDNA clone CS0DK009YE15 of HeLa cell... 46 0.080
343gb|AC069457.5| Drosophila melanogaster 3L BAC RP98-16J19 (Roswel... 46 0.080
344emb|CR624839.1| full-length cDNA clone CS0DI063YG16 of Placenta ... 46 0.080
345emb|CR623400.1| full-length cDNA clone CS0DI053YB10 of Placenta ... 46 0.080
346emb|CR620127.1| full-length cDNA clone CS0DA002YB11 of Neuroblas... 46 0.080
347emb|CR619563.1| full-length cDNA clone CS0DE011YK24 of Placenta ... 46 0.080
348emb|CR618101.1| full-length cDNA clone CS0DI022YO05 of Placenta ... 46 0.080
349emb|CR617864.1| full-length cDNA clone CS0DG006YH20 of B cells (... 46 0.080
350emb|CR616922.1| full-length cDNA clone CS0DI023YJ19 of Placenta ... 46 0.080
351emb|CR614302.1| full-length cDNA clone CS0DI011YG18 of Placenta ... 46 0.080
352emb|CR613389.1| full-length cDNA clone CS0DM003YJ20 of Fetal liv... 46 0.080
353emb|CR610799.1| full-length cDNA clone CS0DA012YA22 of Neuroblas... 46 0.080
354emb|CR608435.1| full-length cDNA clone CS0DH003YJ03 of T cells (... 46 0.080
355emb|CR608381.1| full-length cDNA clone CS0DM003YH20 of Fetal liv... 46 0.080
356emb|CR607225.1| full-length cDNA clone CS0DC025YM23 of Neuroblas... 46 0.080
357emb|CR601435.1| full-length cDNA clone CS0DM003YM17 of Fetal liv... 46 0.080
358emb|CR600630.1| full-length cDNA clone CS0DI087YG15 of Placenta ... 46 0.080
359emb|CR600263.1| full-length cDNA clone CS0DI018YA03 of Placenta ... 46 0.080
360emb|CR599100.1| full-length cDNA clone CS0DI071YA02 of Placenta ... 46 0.080
361emb|CR596917.1| full-length cDNA clone CS0DC012YC16 of Neuroblas... 46 0.080
362emb|CR596778.1| full-length cDNA clone CS0DE010YE18 of Placenta ... 46 0.080
363emb|CR595940.1| full-length cDNA clone CS0DC005YH23 of Neuroblas... 46 0.080
364emb|CR595750.1| full-length cDNA clone CS0DK007YN21 of HeLa cell... 46 0.080
365emb|CR594186.1| full-length cDNA clone CS0DI040YM02 of Placenta ... 46 0.080
366emb|CR591528.1| full-length cDNA clone CS0DE004YP03 of Placenta ... 46 0.080
367gb|AE012191.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.080
368gb|AC110054.4| Homo sapiens chromosome 15, clone CTD-2116N17, co... 46 0.080
369ref|NM_168584.1| Drosophila melanogaster CG7768-RA, transcript v... 46 0.080
370ref|NM_140440.2| Drosophila melanogaster CG7768-RB, transcript v... 46 0.080
371gb|AC100840.2| Homo sapiens chromosome 15, clone RP11-537K8, com... 46 0.080
372gb|AY060923.1| Drosophila melanogaster GM06533 full length cDNA 46 0.080
373gb|CP000249.1| Frankia sp. CcI3, complete genome 46 0.080
374gb|AF180337.1|AF180337 Filobasidiella neoformans var. neoformans... 46 0.080
375gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.080
376gb|AC092247.1|AC092247 Drosophila melanogaster, chromosome 2L, r... 46 0.080
377dbj|AK042165.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 46 0.080
378gb|BC001125.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.080
379gb|AF333997.1|AF333997 Filobasidiella neoformans var. neoformans... 46 0.080
380gb|AF333996.1|AF333996 Filobasidiella neoformans var. neoformans... 46 0.080
381gb|AY900631.1| Drosophila buzzatii clone BAC 5H14, complete sequ... 46 0.080
382gb|AY892416.1| Synthetic construct Homo sapiens clone FLH116767.... 46 0.080
383gb|AY889937.1| Synthetic construct Homo sapiens clone FLH116771.... 46 0.080
384gb|AY962310.1| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.080
385dbj|AB125939.1| Malassezia pachydermatis CYP mRNA for cyclophili... 46 0.080
386gb|BC032138.2| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.080
387gb|BC020800.1| Homo sapiens peptidylprolyl isomerase B (cyclophi... 46 0.080
388gb|U95646.1|U95646 Homo sapiens drug resistance-associated prote... 46 0.080
389gb|AE003647.3| Drosophila melanogaster chromosome 2L, section 56... 46 0.080
390gb|AE003535.3| Drosophila melanogaster chromosome 3L, section 50... 46 0.080
391gb|BC013204.1| Homo sapiens peptidylprolyl isomerase F (cyclophi... 46 0.080
392gb|DQ079282.1| Drosophila mojavensis strain 15081-1352.01 moj29 ... 46 0.080
393gb|BC110299.1| Homo sapiens cDNA clone MGC:117207 IMAGE:5215228,... 46 0.080
394gb|M80254.1|HUMCYP H.sapiens cyclophilin isoform (hCyP3) mRNA, c... 46 0.080
395gb|M60857.1|HUMCYPBA Human cyclophilin B (hCyPB) mRNA, complete cds 46 0.080
396gb|M63573.1|HUMSCYLP Human secreted cyclophilin-like protein (SC... 46 0.080
397gb|M60457.1|HUMCYCLO Human cyclophilin mRNA, 3' end 46 0.080
398gb|AC154048.1| Drosophila melanogaster clone BACR29A04, complete... 44 0.31
399gb|AC154047.2| Drosophila melanogaster clone BACR26B05, complete... 44 0.31
400gb|AC012647.18| Trypanosoma brucei chromosome 2 clone RPCI93-27H... 44 0.31
401gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence 44 0.31
402ref|XM_946410.1| Trypanosoma brucei TREU927 cyclophilin type pep... 44 0.31
403ref|XM_946412.1| Trypanosoma brucei TREU927 cyclophilin-type pep... 44 0.31
404ref|XM_754995.1| Ustilago maydis 521 hypothetical protein (UM039... 44 0.31
405emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.31
406ref|XM_387615.1| Gibberella zeae PH-1 chromosome 4 conserved hyp... 44 0.31
407emb|AL021346.1|CEH37A05 Caenorhabditis elegans Fosmid H37A05, co... 44 0.31
408emb|Z68280.1|HSL25A3 Human DNA sequence from clone LA04NC01-25A3... 44 0.31
409emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chr... 44 0.31
410ref|XM_961813.1| PREDICTED: Tribolium castaneum similar to pepti... 44 0.31
411emb|BX014874.1|CNS08JN2 Single read from an extremity of a full-... 44 0.31
412emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 44 0.31
413emb|BX640429.1| Bordetella parapertussis strain 12822, complete ... 44 0.31
414emb|BX640416.1| Bordetella pertussis strain Tohama I, complete g... 44 0.31
415emb|BX284754.1|NCB23G1 Neurospora crassa DNA linkage group II BA... 44 0.31
416dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.31
417gb|AC091203.3| Drosophila melanogaster 3L BAC RP98-48N8 (Roswell... 44 0.31
418gb|AC010022.8| Drosophila melanogaster 3L BAC RP98-1E12 (Roswell... 44 0.31
419gb|AE005833.1| Caulobacter crescentus CB15 section 159 of 359 of... 44 0.31
420dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 44 0.31
421ref|NM_165086.1| Drosophila melanogaster wing blister CG15288-RB... 44 0.31
422ref|NM_078571.2| Drosophila melanogaster Resistance to Juvenile ... 44 0.31
423ref|NM_057442.3| Drosophila melanogaster wing blister CG15288-RA... 44 0.31
424gb|AF180336.1|AF180336 Filobasidiella neoformans var. neoformans... 44 0.31
425gb|DQ086168.1| Ictalurus punctatus peptidylprolyl isomerase A mR... 44 0.31
426gb|AC008357.8| Drosophila melanogaster, chromosome 3R, region 86... 44 0.31
427gb|S82440.1| cyclophilin [Hemicentrotus pulcherrimus, early plut... 44 0.31
428gb|AC092248.1|AC092248 Drosophila melanogaster, chromosome 2L, r... 44 0.31
429gb|AC092227.1|AC092227 Drosophila melanogaster, chromosome 2L, r... 44 0.31
430ref|NM_074350.4| Caenorhabditis elegans CYclophyliN family membe... 44 0.31
431gb|BT024194.1| Drosophila melanogaster RE71296 full insert cDNA 44 0.31
432gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 0.31
433gb|AF135118.1|AF135118 Drosophila melanogaster laminin alpha1,2 ... 44 0.31
434gb|AE003686.4| Drosophila melanogaster chromosome 3R, section 24... 44 0.31
435gb|AE003643.3| Drosophila melanogaster chromosome 2L, section 52... 44 0.31
436gb|AE003552.4| Drosophila melanogaster chromosome 3L, section 33... 44 0.31
437gb|AE003486.2| Drosophila melanogaster chromosome X, section 38 ... 44 0.31
438gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.31
439gb|U31077.1|CEU31077 Caenorhabditis elegans cyclophilin isoform ... 44 0.31
440gb|AF034859.1|AF034859 Drosophila melanogaster juvenile hormone ... 44 0.31
441gb|U04633.1|TGU04633 Toxoplasma gondii Rh 18 kDa cyclophilin mRN... 44 0.31
442gb|AY739096.1| Takifugu rubripes frRHCE, frSMP1, frNPD014, and f... 42 1.2
443gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 42 1.2
444gb|DQ214204.1| Taeniopygia guttata clone 0061P0010D07 DNA direct... 42 1.2
445gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 42 1.2
446ref|NM_007817.1| Mus musculus cytochrome P450, family 2, subfami... 42 1.2
447gb|AC012162.11| Drosophila melanogaster clone BACR01N10, complet... 42 1.2
448gb|AC011070.8| Drosophila melanogaster clone BACR02B12, complete... 42 1.2
449gb|AC007893.8| Drosophila melanogaster clone BACR02E15, complete... 42 1.2
450gb|AC099038.2| Drosophila melanogaster clone BACR28A23, complete... 42 1.2
451gb|AC009842.9| Drosophila melanogaster clone BACR04C12, complete... 42 1.2
452gb|AC008231.4| Drosophila melanogaster clone BACR12O13, complete... 42 1.2
453ref|XM_591672.2| PREDICTED: Bos taurus similar to sarcalumenin (... 42 1.2
454gb|BC004041.1| Mus musculus peptidylprolyl isomerase F (cyclophi... 42 1.2
455gb|BC024742.1| Mus musculus cytochrome P450, family 2, subfamily... 42 1.2
456gb|AY594335.1| Bos taurus cyclophilin F mRNA, complete cds 42 1.2
457gb|AY429575.1| Populus alba x Populus tremula putative cyclophil... 42 1.2
458gb|AY429574.1| Populus alba x Populus tremula clone INRA 7171-B4... 42 1.2
459ref|XM_884636.2| PREDICTED: Mus musculus similar to neural cell ... 42 1.2
460ref|XM_973563.1| PREDICTED: Mus musculus similar to neural cell ... 42 1.2
461ref|XM_916291.2| PREDICTED: Mus musculus similar to neural cell ... 42 1.2
462ref|XM_746967.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis... 42 1.2
463gb|BT011029.1| Drosophila melanogaster RE45537 full insert cDNA 42 1.2
464ref|XM_801644.1| Trypanosoma cruzi strain CL Brener cyclophilin ... 42 1.2
465gb|AY382628.1| Drosophila melanogaster strain Raleigh Inbred 9 x... 42 1.2
466gb|AY382626.1| Drosophila melanogaster strain Raleigh Inbred 6 x... 42 1.2
467gb|AY382625.1| Drosophila melanogaster strain Raleigh Inbred 33 ... 42 1.2
468gb|AY382624.1| Drosophila melanogaster strain Raleigh Inbred 30 ... 42 1.2
469gb|AY382622.1| Drosophila melanogaster strain Raleigh Inbred 24 ... 42 1.2
470gb|AY382619.1| Drosophila melanogaster strain Raleigh Inbred 1 x... 42 1.2
471gb|AC126553.4| Mus musculus BAC clone RP23-448L16 from chromosom... 42 1.2
472ref|XM_800603.1| Trypanosoma cruzi strain CL Brener cyclophilin ... 42 1.2
473emb|CR712172.2|CNS0GCGO Tetraodon nigroviridis full-length cDNA 42 1.2
474emb|CR728412.2|CNS0GOZM Tetraodon nigroviridis full-length cDNA 42 1.2
475emb|CR720104.2|CNS0GIKU Tetraodon nigroviridis full-length cDNA 42 1.2
476emb|CR723088.2|CNS0GKVQ Tetraodon nigroviridis full-length cDNA 42 1.2
477emb|CR722965.2|CNS0GKSB Tetraodon nigroviridis full-length cDNA 42 1.2
478emb|CR722213.2|CNS0GK7F Tetraodon nigroviridis full-length cDNA 42 1.2
479emb|CR722017.2|CNS0GK1Z Tetraodon nigroviridis full-length cDNA 42 1.2
480emb|CR721829.2|CNS0GJWR Tetraodon nigroviridis full-length cDNA 42 1.2
481emb|CR721305.2|CNS0GJI7 Tetraodon nigroviridis full-length cDNA 42 1.2
482emb|CR721197.2|CNS0GJF7 Tetraodon nigroviridis full-length cDNA 42 1.2
483emb|CR720984.2|CNS0GJ9A Tetraodon nigroviridis full-length cDNA 42 1.2
484emb|CR720750.2|CNS0GJ2S Tetraodon nigroviridis full-length cDNA 42 1.2
485emb|CR720636.2|CNS0GIZM Tetraodon nigroviridis full-length cDNA 42 1.2
486emb|CR720589.2|CNS0GIYB Tetraodon nigroviridis full-length cDNA 42 1.2
487emb|CR720565.2|CNS0GIXN Tetraodon nigroviridis full-length cDNA 42 1.2
488emb|CR720350.2|CNS0GIRO Tetraodon nigroviridis full-length cDNA 42 1.2
489emb|CR720342.2|CNS0GIRG Tetraodon nigroviridis full-length cDNA 42 1.2
490emb|CR719449.2|CNS0GI2N Tetraodon nigroviridis full-length cDNA 42 1.2
491emb|CR719321.2|CNS0GHZ3 Tetraodon nigroviridis full-length cDNA 42 1.2
492emb|CR719535.1|CNS0GI51 Tetraodon nigroviridis full-length cDNA 42 1.2
493emb|CR718968.2|CNS0GHPA Tetraodon nigroviridis full-length cDNA 42 1.2
494emb|CR718909.2|CNS0GHNN Tetraodon nigroviridis full-length cDNA 42 1.2
495emb|CR718763.2|CNS0GHJL Tetraodon nigroviridis full-length cDNA 42 1.2
496emb|CR718727.2|CNS0GHIL Tetraodon nigroviridis full-length cDNA 42 1.2
497emb|CR718620.2|CNS0GHFM Tetraodon nigroviridis full-length cDNA 42 1.2
498emb|CR716810.2|CNS0GG1F Tetraodon nigroviridis full-length cDNA 42 1.2
499emb|CR715419.2|CNS0GEYV Tetraodon nigroviridis full-length cDNA 42 1.2
500emb|CR711322.2|CNS0GBT2 Tetraodon nigroviridis full-length cDNA 42 1.2

>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds
          Length = 869

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Plus

                                                                       
Query: 82  cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 141
           ||||||||||||||| |||||||||||||||| |||||||||||||||||| || |||||
Sbjct: 52  cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 111

                                                                       
Query: 142 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 201
           ||| ||||| || |||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 112 cgcgccggcggggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 171

                                                                       
Query: 202 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 172 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 231

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 232 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 291

                                                           
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 292 caccaggggcaacggcaccggaggcgagtccatctacggcgagaagtt 339



to top

>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds
          Length = 859

 Score =  476 bits (240), Expect = e-131
 Identities = 276/288 (95%)
 Strand = Plus / Plus

                                                                       
Query: 82  cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 141
           ||||||||||||||| |||||||||||||||| |||||||||||||||||| || |||||
Sbjct: 44  cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 103

                                                                       
Query: 142 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 201
           ||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 104 cgcgccggccgggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 163

                                                                       
Query: 202 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 261
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 gaacttccgcgcgctgtgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 223

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           ||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 224 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 283

                                                           
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           |||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 cacccggggcaacggcaccggcggcgagtccatctacggcgagaagtt 331



to top

>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds
          Length = 845

 Score =  468 bits (236), Expect = e-129
 Identities = 263/272 (96%)
 Strand = Plus / Plus

                                                                       
Query: 98  gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 157
           |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 68  gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 127

                                                                       
Query: 158 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 217
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 128 atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 187

                                                                       
Query: 218 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 277
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 188 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 247

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 248 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 307

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||||||||||||||||||||||||||||||
Sbjct: 308 accggcggcgagtccatctacggcgagaagtt 339



to top

>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds
          Length = 781

 Score =  468 bits (236), Expect = e-129
 Identities = 263/272 (96%)
 Strand = Plus / Plus

                                                                       
Query: 98  gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 157
           |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 32  gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 91

                                                                       
Query: 158 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 217
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 92  atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 151

                                                                       
Query: 218 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 277
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 152 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 211

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 212 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 271

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||||||||||||||||||||||||||||||
Sbjct: 272 accggcggcgagtccatctacggcgagaagtt 303



to top

>ref|XM_463914.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 885

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 348 ctacggcgagaagtt 362



to top

>ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0088N06.23
           mRNA
          Length = 887

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 349 ctacggcgagaagtt 363



to top

>gb|BT016412.1| Zea mays clone Contig245 mRNA sequence
          Length = 858

 Score =  283 bits (143), Expect = 2e-73
 Identities = 224/251 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178
           |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 82  ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 141

                                                                       
Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 142 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 201

                                                                       
Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298
           ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 202 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 261

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 262 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 321

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 322 ggcgagaagtt 332



to top

>gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA mRNA, complete
           cds
          Length = 588

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 25  ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 84

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 85  cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 144

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 145 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 204

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 205 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 264

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 265 ctacggcgagaagtt 279



to top

>emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin
          Length = 2598

 Score =  283 bits (143), Expect = 2e-73
 Identities = 224/251 (89%)
 Strand = Plus / Plus

                                                                        
Query: 119  ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178
            |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 1080 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 1139

                                                                        
Query: 179  gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
             ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 1140 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 1199

                                                                        
Query: 239  ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298
            ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 1200 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 1259

                                                                        
Query: 299  ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
            ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 1260 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 1319

                       
Query: 359  ggcgagaagtt 369
            |||||||||||
Sbjct: 1320 ggcgagaagtt 1330



to top

>dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G07, full
           insert sequence
          Length = 887

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 349 ctacggcgagaagtt 363



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                           
Query: 115     ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
               |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 1116174 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1116233

                                                                           
Query: 175     caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
               |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1116234 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1116293

                                                                           
Query: 235     cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
               ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 1116294 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1116353

                                                                           
Query: 295     cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
                || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 1116354 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1116413

                              
Query: 355     ctacggcgagaagtt 369
               |||||||||||||||
Sbjct: 1116414 ctacggcgagaagtt 1116428



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                             
Query: 194      acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
                |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 32066599 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 32066643



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 222     ccggcgagaagggcgtcggc 241
               ||||||||||||||||||||
Sbjct: 7760546 ccggcgagaagggcgtcggc 7760565



to top

>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1020_C02
          Length = 124578

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                         
Query: 115   ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
             |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 68698 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 68757

                                                                         
Query: 175   caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
             |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 68758 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 68817

                                                                         
Query: 235   cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
             ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 68818 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 68877

                                                                         
Query: 295   cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
              || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 68878 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 68937

                            
Query: 355   ctacggcgagaagtt 369
             |||||||||||||||
Sbjct: 68938 ctacggcgagaagtt 68952



to top

>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0088N06
          Length = 123454

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                          
Query: 115    ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
              |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 104882 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 104941

                                                                          
Query: 175    caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
              |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 104942 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 105001

                                                                          
Query: 235    cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
              ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 105002 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 105061

                                                                          
Query: 295    cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
               || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 105062 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 105121

                             
Query: 355    ctacggcgagaagtt 369
              |||||||||||||||
Sbjct: 105122 ctacggcgagaagtt 105136



to top

>dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N03, full
           insert sequence
          Length = 885

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 348 ctacggcgagaagtt 362



to top

>gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds
          Length = 792

 Score =  283 bits (143), Expect = 2e-73
 Identities = 224/251 (89%)
 Strand = Plus / Plus

                                                                       
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178
           |||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||   
Sbjct: 43  ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 102

                                                                       
Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 103 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 162

                                                                       
Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298
           ||||||  ||| |||||||| ||||||||||||  | | |||||||||||||||||||| 
Sbjct: 163 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 222

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 223 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 282

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 283 ggcgagaagtt 293



to top

>gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, complete cds
          Length = 824

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 53  ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 112

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 113 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 172

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 173 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 232

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 233 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 292

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 293 ctacggcgagaagtt 307



to top

>gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, complete cds
          Length = 2323

 Score =  283 bits (143), Expect = 2e-73
 Identities = 227/255 (89%)
 Strand = Plus / Plus

                                                                        
Query: 115  ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
            |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 1164 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1223

                                                                        
Query: 175  caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
            |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 1224 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1283

                                                                        
Query: 235  cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
            ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 1284 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1343

                                                                        
Query: 295  cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
             || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 1344 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1403

                           
Query: 355  ctacggcgagaagtt 369
            |||||||||||||||
Sbjct: 1404 ctacggcgagaagtt 1418



to top

>gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence
          Length = 905

 Score =  276 bits (139), Expect = 5e-71
 Identities = 226/255 (88%)
 Strand = Plus / Plus

                                                                       
Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174
           |||||||||||||||||| || ||||| || ||||| || || |||||||||||||||||
Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168

                                                                       
Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234
           |  | | |  |||||| |||||| ||||||||||||||||||||||||||||||||| ||
Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaagg 228

                                                                       
Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294
           ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| |||||
Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288

                                                                       
Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354
            || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| ||
Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348

                          
Query: 355 ctacggcgagaagtt 369
           |||||||||||||||
Sbjct: 349 ctacggcgagaagtt 363



to top

>gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence
          Length = 978

 Score =  260 bits (131), Expect = 3e-66
 Identities = 221/251 (88%)
 Strand = Plus / Plus

                                                                       
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178
           |||||||||||||| || ||||| ||||| |||||||| ||||||||||||||||||   
Sbjct: 183 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagctgtacgcc 242

                                                                       
Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 243 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 302

                                                                       
Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298
           ||||||  ||| |||||||| ||||||||||||    | |||||||||||||||||| | 
Sbjct: 303 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 362

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 363 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 422

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 423 ggcgagaagtt 433



to top

>gb|BT016413.1| Zea mays clone Contig246 mRNA sequence
          Length = 868

 Score =  252 bits (127), Expect = 7e-64
 Identities = 220/251 (87%)
 Strand = Plus / Plus

                                                                       
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178
           |||||||||||||| || ||||| ||||| |||||||| ||||||||||||| ||||   
Sbjct: 67  ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagccgtacgcc 126

                                                                       
Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
            ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 127 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 186

                                                                       
Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298
           ||||||  ||| |||||||| ||||||||||||    | |||||||||||||||||| | 
Sbjct: 187 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 246

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Sbjct: 247 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 306

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 307 ggcgagaagtt 317



to top

>gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, partial cds
          Length = 430

 Score =  226 bits (114), Expect = 4e-56
 Identities = 132/138 (95%)
 Strand = Plus / Plus

                                                                       
Query: 232 gggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcat 291
           |||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||| ||
Sbjct: 12  gggcgtgggcaagagcggcaagccgctgcactacaaggggagcgcgttccaccgcgtgat 71

                                                                       
Query: 292 ccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtc 351
           ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 72  ccccgacttcatgtgccagggcggcgacttcaccaggggcaacgggacgggcggcgagtc 131

                             
Query: 352 catctacggcgagaagtt 369
           ||||||||||||||||||
Sbjct: 132 catctacggcgagaagtt 149



to top

>gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mRNA, complete cds
          Length = 985

 Score =  170 bits (86), Expect = 2e-39
 Identities = 185/218 (84%)
 Strand = Plus / Plus

                                                                       
Query: 152 ggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgc 211
           |||||||||| |||||||||||||   ||||  ||||| | ||| | |||||||||||||
Sbjct: 74  ggccgcatcgagatggagctgtacgccgacgacgtgcccaagaccgcggagaacttccgc 133

                                                                       
Query: 212 gcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggc 271
           || || |||||||||||||||||||| |||      |||||||| ||||||| |||||||
Sbjct: 134 gccctgtgcaccggcgagaagggcgttggccgctctggcaagcccctgcacttcaagggc 193

                                                                       
Query: 272 agctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggc 331
             | | |||||||| || |||||| ||||||||||||||||||| ||||||||| | |||
Sbjct: 194 tccaccttccaccgtgtgatccccaacttcatgtgccagggcggtgacttcacccgcggc 253

                                                 
Query: 332 aacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||||||| || |||||||||||||||||||||||
Sbjct: 254 aacggcaccggtggtgagtccatctacggcgagaagtt 291



to top

>gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylprolyl isomerase
           mRNA, complete cds
          Length = 700

 Score =  165 bits (83), Expect = 1e-37
 Identities = 218/263 (82%)
 Strand = Plus / Plus

                                                                       
Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166
           |||||| ||||||| ||||||||||| || || || ||||| || ||||| |||  | | 
Sbjct: 45  aacccgcaggtgtttttcgacatgaccgttggtggtgcccccgctggccgtatcacgttc 104

                                                                       
Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226
           ||||||| |   |||  |||||||| |||||  |||||||||||||| || ||||| |||
Sbjct: 105 gagctgttcgccgacaaggtgccgaagacggctgagaacttccgcgctctttgcacaggc 164

                                                                       
Query: 227 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 286
           ||||||||||| |||      |||||||| ||||||| |||||||||||| |||||||| 
Sbjct: 165 gagaagggcgtgggccgttcgggcaagcccctgcacttcaagggcagctctttccaccgt 224

                                                                       
Query: 287 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 346
           || |||||| |||| |||||||||||||||||||||||  | || |||||||| ||||| 
Sbjct: 225 gtgatccccaactttatgtgccagggcggcgacttcacgcgtggtaacggcacgggcggt 284

                                  
Query: 347 gagtccatctacggcgagaagtt 369
           |||||||||||||||||||||||
Sbjct: 285 gagtccatctacggcgagaagtt 307



to top

>dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G01, full
           insert sequence
          Length = 749

 Score =  161 bits (81), Expect = 2e-36
 Identities = 153/177 (86%)
 Strand = Plus / Plus

                                                                       
Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaa 252
           |||||| ||||||||||||||||||||||| |||||||||||| | |||||||  |||||
Sbjct: 204 gacggtcgagaacttccgcgcgctctgcacgggcgagaagggcatgggcaagaagggcaa 263

                                                                       
Query: 253 gccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccaggg 312
           |||||| ||||||||||||||| | ||||||||| | |||||| |||| |||  ||||||
Sbjct: 264 gccgctccactacaagggcagcactttccaccgcattatccccaactttatgatccaggg 323

                                                                    
Query: 313 cggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||| ||||| ||    ||||||||||  ||||||||||| |||||||||||||||||
Sbjct: 324 cggtgactttacggacggcaacggcatgggcggcgagtcgatctacggcgagaagtt 380



to top

>gb|AY105212.1| Zea mays PCO124469 mRNA sequence
          Length = 886

 Score =  151 bits (76), Expect = 2e-33
 Identities = 103/112 (91%)
 Strand = Plus / Plus

                                                                       
Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310
           |||||||||||||||||||||    | ||||||||||||||||| | |||||||||||||
Sbjct: 415 aagccgctgcactacaagggctcggccttccaccgcgtcatcccgggcttcatgtgccag 474

                                                               
Query: 311 ggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           ||||||||||||||| ||||||||||||| ||||||||||||||||||||||
Sbjct: 475 ggcggcgacttcacccggggcaacggcacgggcggcgagtccatctacggcg 526



to top

>gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, complete cds
          Length = 1080

 Score =  149 bits (75), Expect = 7e-33
 Identities = 216/263 (82%)
 Strand = Plus / Plus

                                                                       
Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166
           ||||| ||||| ||||| || |||  ||| ||||| ||||| |||||||| |||||||||
Sbjct: 88  aacccaaaggttttctttgatatgcaggtcggcggtgccccagccggccggatcgtgatg 147

                                                                       
Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226
           ||||| ||   ||| | |||||||| |||||  ||||||||||||||| | || ||||||
Sbjct: 148 gagctctatgcggatgtggtgccgaagacggctgagaacttccgcgcgttgtgtaccggc 207

                                                                       
Query: 227 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 286
           ||||| |||  ||||      |||||||| ||||||| ||||||    ||||||||||||
Sbjct: 208 gagaaaggcaccggccgctcaggcaagcctctgcacttcaagggttcgtcgttccaccgc 267

                                                                       
Query: 287 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 346
           || ||||| |  ||||||||||||||||| |||||||| ||||||||||| ||||| || 
Sbjct: 268 gtgatcccagggttcatgtgccagggcggtgacttcacaaggggcaacggtaccggtgga 327

                                  
Query: 347 gagtccatctacggcgagaagtt 369
           ||||| |||||||||||||||||
Sbjct: 328 gagtctatctacggcgagaagtt 350



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                            
Query: 215      ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274
                ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 22509020 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 22509079

                                                                            
Query: 275      tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334
                 | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 22509080 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 22509139

                                             
Query: 335      ggcaccggcggcgagtccatctacggcga 363
                |||||||||||||||||||||||||||||
Sbjct: 22509140 ggcaccggcggcgagtccatctacggcga 22509168



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     cgatcccgatcccgatcccg 91
              ||||||||||||||||||||
Sbjct: 392141 cgatcccgatcccgatcccg 392160



to top

>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1331F11
          Length = 132205

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                         
Query: 215   ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274
             ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 24221 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 24280

                                                                         
Query: 275   tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334
              | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 24281 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 24340

                                          
Query: 335   ggcaccggcggcgagtccatctacggcga 363
             |||||||||||||||||||||||||||||
Sbjct: 24341 ggcaccggcggcgagtccatctacggcga 24369



to top

>dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119A20, full
           insert sequence
          Length = 757

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274
           ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 186 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 245

                                                                       
Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334
            | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 246 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 305

                                        
Query: 335 ggcaccggcggcgagtccatctacggcga 363
           |||||||||||||||||||||||||||||
Sbjct: 306 ggcaccggcggcgagtccatctacggcga 334



to top

>gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, complete cds
          Length = 590

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274
           ||||||||||||||||||||| |||||     ||||||||||||||| ||||||||    
Sbjct: 167 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 226

                                                                       
Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334
            | ||||||||  |||| ||| ||||||||||||||||||||||||||||| | ||||||
Sbjct: 227 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 286

                                        
Query: 335 ggcaccggcggcgagtccatctacggcga 363
           |||||||||||||||||||||||||||||
Sbjct: 287 ggcaccggcggcgagtccatctacggcga 315



to top

>emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin
          Length = 765

 Score =  141 bits (71), Expect = 2e-30
 Identities = 140/163 (85%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           |||||||||||||| |||||||| |||||||| ||||||||||| | |||||||||||| 
Sbjct: 146 gagaacttccgcgctctctgcactggcgagaaaggcgtcggcaaaaccggcaagccgctc 205

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||||||| |||    |||| |||||||| |||||||  |||||||||||||| ||||||
Sbjct: 206 cactacaaaggctcggcgtttcaccgcgtgatccccgggttcatgtgccagggaggcgac 265

                                                      
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           ||||||   || ||||||||||| ||||| || ||||||||||
Sbjct: 266 ttcaccgccggaaacggcaccggaggcgaatctatctacggcg 308



to top

>dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D12, full
           insert sequence
          Length = 682

 Score =  141 bits (71), Expect = 2e-30
 Identities = 146/171 (85%)
 Strand = Plus / Plus

                                                                       
Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgct 258
           |||||||||||||||||| ||||| |||||||||||| | |||      |||||||||||
Sbjct: 154 ggagaacttccgcgcgctttgcacgggcgagaagggcattggccgctcgggcaagccgct 213

                                                                       
Query: 259 gcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318
            |||| |||||||   ||||||||||| || |||||| ||||||||||||||||||| ||
Sbjct: 214 ccacttcaagggctcgtcgttccaccgtgtgatccccaacttcatgtgccagggcggtga 273

                                                              
Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||  | ||||||||||| ||||||||||| || ||||||||||||||
Sbjct: 274 cttcacgcgcggcaacggcacgggcggcgagtcgatttacggcgagaagtt 324



to top

>dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds
          Length = 823

 Score =  135 bits (68), Expect = 1e-28
 Identities = 142/164 (86%), Gaps = 2/164 (1%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           |||||||||||||| ||||||||||| |||||||| ||||| | ||||||||||||||| 
Sbjct: 138 gagaacttccgcgctctctgcaccggtgagaagggagtcggtaggagcggcaagccgctc 197

                                                                       
Query: 260 cactacaagggc-agctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318
           ||||||||||||  | || |||||||| || |||||  ||||||||||||| || |||||
Sbjct: 198 cactacaagggctcgatc-ttccaccgtgtgatcccgaacttcatgtgccaaggaggcga 256

                                                       
Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||   || |||||||| ||||||||||| ||||||||||
Sbjct: 257 cttcaccgccggaaacggcacaggcggcgagtcgatctacggcg 300



to top

>gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence
          Length = 636

 Score =  129 bits (65), Expect = 7e-27
 Identities = 84/92 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||||||     | ||||||||||||||||||||||||||| | |||||||||
Sbjct: 33  ttccaccgcgtcatnnnnnagttcatgtgccagggcggcgacttcacccgcggcaacggc 92

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||||||||||||||||||||||||||||||
Sbjct: 93  accggcggcgagtccatctacggcgagaagtt 124



to top

>emb|Y08273.1|DLCYP18 D.lanata CYP18 gene
          Length = 1363

 Score =  119 bits (60), Expect = 7e-24
 Identities = 135/160 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcac 262
           ||||||||||| ||||||||||| ||||| ||||| ||||||  |||||||||||| |||
Sbjct: 611 aacttccgcgctctctgcaccggtgagaaaggcgtaggcaagtccggcaagccgctccac 670

                                                                       
Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           ||||| |||    |||||||||| || |||||||  |||||||| ||||||||||| |||
Sbjct: 671 tacaaaggctcggcgttccaccgagtgatccccgggttcatgtgtcagggcggcgatttc 730

                                                   
Query: 323 accaggggcaacggcaccggcggcgagtccatctacggcg 362
           |||   || ||||||||||| ||||| || ||||||||||
Sbjct: 731 accgctggaaacggcaccggaggcgaatcgatctacggcg 770



to top

>gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, complete cds
          Length = 873

 Score =  119 bits (60), Expect = 7e-24
 Identities = 129/152 (84%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||||||||| |||||||||||||||||||| ||   |||||||||||| || 
Sbjct: 168 gagaacttccgcgcgctttgcaccggcgagaagggcgtagggcggagcggcaagcccctc 227

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           ||||||||||||   || ||||||||||| |||||    |||||||| ||||| ||||||
Sbjct: 228 cactacaagggctcgtccttccaccgcgtgatcccgagtttcatgtgtcagggtggcgac 287

                                           
Query: 320 ttcaccaggggcaacggcaccggcggcgagtc 351
           ||||||   || ||||| ||||||||||||||
Sbjct: 288 ttcaccgccggaaacggaaccggcggcgagtc 319



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 152 ggccgcatcgtgatggagct 171
           ||||||||||||||||||||
Sbjct: 120 ggccgcatcgtgatggagct 139



to top

>gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 cyclophilin A mRNA,
           complete cds
          Length = 498

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           ||||||||||||   |||||||| ||||||||| |||||||||||||||| || ||||||
Sbjct: 142 tacaagggcagcattttccaccgagtcatccccaacttcatgtgccagggaggagacttc 201

                                                          
Query: 323 accaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||| ||  ||||||||| |||||| ||||||||||||||||||||||
Sbjct: 202 acccggcacaacggcacgggcggcaagtccatctacggcgagaagtt 248



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcgg 240
           ||||||||||| || |||||||||||||||||| ||||
Sbjct: 103 aacttccgcgccctgtgcaccggcgagaagggcttcgg 140



to top

>gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, partial cds
          Length = 519

 Score =  113 bits (57), Expect = 4e-22
 Identities = 60/61 (98%)
 Strand = Plus / Plus

                                                                       
Query: 309 agggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagt 368
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agggcggcgacttcacccggggcaacggcaccggcggcgagtccatctacggcgagaagt 60

            
Query: 369 t 369
           |
Sbjct: 61  t 61



to top

>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence
          Length = 176969

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                          
Query: 278    ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
              |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 159821 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 159762

                                      
Query: 338    accggcggcgagtccatctacggc 361
              || |||||| ||||||||||||||
Sbjct: 159761 actggcggcaagtccatctacggc 159738



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 200    gagaacttccgcgcgctctgcaccggcgagaaggg 234
              ||||||||||||||  | |||||||||||||||||
Sbjct: 159878 gagaacttccgcgccttgtgcaccggcgagaaggg 159844



to top

>gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complete sequence
          Length = 192540

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                         
Query: 278   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
             |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 62385 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 62326

                                     
Query: 338   accggcggcgagtccatctacggc 361
             || |||||| ||||||||||||||
Sbjct: 62325 actggcggcaagtccatctacggc 62302



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 200   gagaacttccgcgcgctctgcaccggcgagaaggg 234
             ||||||||||||||  | |||||||||||||||||
Sbjct: 62442 gagaacttccgcgccttgtgcaccggcgagaaggg 62408



to top

>gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence
          Length = 456

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 160 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 219

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 220 actggcggcaagtccatctacggc 243



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||||||  | |||||||||||||||||
Sbjct: 103 gagaacttccgcgccttgtgcaccggcgagaaggg 137



to top

>gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence
          Length = 399

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 64  ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 123

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 124 actggcggcaagtccatctacggc 147



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||||||  | |||||||||||||||||
Sbjct: 7   gagaacttccgcgccttgtgcaccggcgagaaggg 41



to top

>gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA
          Length = 796

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 294 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 353

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 354 actggcggcaagtccatctacggc 377



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||||||  | |||||||||||||||||
Sbjct: 237 gagaacttccgcgccttgtgcaccggcgagaaggg 271



to top

>ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA (Cyp1), mRNA
          Length = 1269

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 422 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 481

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 482 actggcggcaagtccatctacggc 505



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||||||  | |||||||||||||||||
Sbjct: 365 gagaacttccgcgccttgtgcaccggcgagaaggg 399



to top

>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete
              sequence
          Length = 323840

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Minus

                                                                          
Query: 278    ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
              |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 309493 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 309434

                                      
Query: 338    accggcggcgagtccatctacggc 361
              || |||||| ||||||||||||||
Sbjct: 309433 actggcggcaagtccatctacggc 309410



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 200    gagaacttccgcgcgctctgcaccggcgagaaggg 234
              ||||||||||||||  | |||||||||||||||||
Sbjct: 309550 gagaacttccgcgccttgtgcaccggcgagaaggg 309516



to top

>gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, partial cds
          Length = 494

 Score =  111 bits (56), Expect = 2e-21
 Identities = 59/60 (98%)
 Strand = Plus / Plus

                                                                       
Query: 310 gggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1   gggcggcgacttcaccaggggcaacggcaccggaggcgagtccatctacggcgagaagtt 60



to top

>gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, complete cds
          Length = 707

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| ||||||||||||||||||||||||||||||    |||||||
Sbjct: 192 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 251

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 252 actggcggcaagtccatctacggc 275



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||||||  | |||||||||||||||||
Sbjct: 135 gagaacttccgcgccttgtgcaccggcgagaaggg 169



to top

>gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial cds
          Length = 417

 Score =  109 bits (55), Expect = 6e-21
 Identities = 82/91 (90%)
 Strand = Plus / Plus

                                                                       
Query: 279 tccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggca 338
           |||||||||| ||||| ||||||||||||||||| |||||||||||  | || ||||| |
Sbjct: 1   tccaccgcgtgatcccggacttcatgtgccagggtggcgacttcactcgtggaaacggta 60

                                          
Query: 339 ccggcggcgagtccatctacggcgagaagtt 369
           |||||||||||||||||||||| ||||||||
Sbjct: 61  ccggcggcgagtccatctacggggagaagtt 91



to top

>ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (MG10447.4) partial
           mRNA
          Length = 648

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||||
Sbjct: 307 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 366

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||| ||| ||||| ||||||||||||||||
Sbjct: 367 accggtggcaagtccgtctacggcgagaagtt 398



to top

>dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, complete cds
          Length = 775

 Score =  103 bits (52), Expect = 4e-19
 Identities = 82/92 (89%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||||
Sbjct: 210 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 269

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||| ||| ||||| ||||||||||||||||
Sbjct: 270 accggtggcaagtccgtctacggcgagaagtt 301



to top

>gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene, complete cds
          Length = 1968

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 107/126 (84%)
 Strand = Plus / Plus

                                                                        
Query: 200  gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
            ||||||||||| || |||||||||||||||||||| ||||||   ||||||||||| || 
Sbjct: 1198 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 1257

                                                                        
Query: 260  cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
            || ||||||||   | | ||||||||||| |||||  ||||||||||||||||||| || 
Sbjct: 1258 cattacaagggatccaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 1317

                  
Query: 320  ttcacc 325
            ||||||
Sbjct: 1318 ttcacc 1323



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 149  gccggccgcatcgtgatggagctgtac 175
            |||||||||||||| ||||||||||||
Sbjct: 1147 gccggccgcatcgtcatggagctgtac 1173



to top

>gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophilin gene, partial
           cds
          Length = 393

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 83/94 (88%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           |||||||||||||||||||  ||||||||  ||||||||||||||| |||   |||||||
Sbjct: 110 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttacccaaggcaacg 169

                                             
Query: 336 gcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||||||| ||  ||||||||||||||||||
Sbjct: 170 gcaccggcggcaagagcatctacggcgagaagtt 203



to top

>emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA genes
          Length = 3538

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                        
Query: 278  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
            ||||||||||||||| | |||||||||  ||||||||||||||||||| | ||  |||||
Sbjct: 2587 ttccaccgcgtcatcacggacttcatgctccagggcggcgacttcacccgcggtgacggc 2646

                                            
Query: 338  accggcggcgagtccatctacggcgagaagtt 369
            ||||||||| ||  ||||||||||||||||||
Sbjct: 2647 accggcggcaagagcatctacggcgagaagtt 2678



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                             
Query: 193  gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
            ||||| |||||||||||||||||||  |||||||||||||||| |||||
Sbjct: 2523 gacggcggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 2571



to top

>ref|XM_323171.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563)
           peptidyl-prolyl cis-trans isomerase [Neurospora crassa
           OR74A]  ) (NCU03853.1) partial mRNA
          Length = 1128

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 134/163 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243

                                                      
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           ||||||   || |||||||| || |||||||||||||||||||
Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 286



to top

>ref|XM_950770.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563)
           peptidyl-prolyl cis-trans isomerase [Neurospora crassa
           OR74A]  ) (NCU03853.1) partial mRNA
          Length = 1128

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 134/163 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243

                                                      
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           ||||||   || |||||||| || |||||||||||||||||||
Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 286



to top

>emb|AJ292563.1|NCR292563 Neurospora crassa mRNA for cyclophilin41
          Length = 1632

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 134/163 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||||||  | ||||||||||||||||| || ||||||   ||||||||||| 
Sbjct: 359 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 418

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||||||||||   | |||||||||| ||||||    | ||||||  |||||| || |||
Sbjct: 419 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 478

                                                      
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           ||||||   || |||||||| || |||||||||||||||||||
Sbjct: 479 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 521



to top

>emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin
          Length = 2165

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           |||||||||| || ||||| || |||||||||||||| || ||||||||||  |||||||
Sbjct: 312 cgttccaccgtgtgatcccggatttcatgtgccagggtggtgacttcaccaacggcaacg 371

                                     
Query: 336 gcaccggcggcgagtccatctacggc 361
           |||| |||||| ||||||||||||||
Sbjct: 372 gcactggcggcaagtccatctacggc 397



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 163 gatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 222
           ||||||||| | ||||||||| || ||   |||||  ||||||||||||||||| |||||
Sbjct: 220 gatggagctcttcaaggacgccgttccccagacggccgagaacttccgcgcgctgtgcac 279

                              
Query: 223 cggcgagaagggcgtcggc 241
            |||||||||||| |||||
Sbjct: 280 gggcgagaagggcttcggc 298



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                         
Query: 184     ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
               ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 5950025 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 5949968



to top

>dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0024N18
          Length = 128739

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 55/58 (94%)
 Strand = Plus / Minus

                                                                       
Query: 184   ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
             ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 71677 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 71620



to top

>emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin
          Length = 758

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 106/126 (84%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||| || |||||||||||||||||||| ||||||   ||||||||||| || 
Sbjct: 129 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 188

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           || ||||||||     | ||||||||||| |||||  ||||||||||||||||||| || 
Sbjct: 189 cattacaagggatcgaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 248

                 
Query: 320 ttcacc 325
           ||||||
Sbjct: 249 ttcacc 254



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 149 gccggccgcatcgtgatggagctgtac 175
           |||||||||||||| ||||||||||||
Sbjct: 78  gccggccgcatcgtcatggagctgtac 104



to top

>dbj|AK068112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013134M21, full
           insert sequence
          Length = 1633

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                     
Query: 184 ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           ||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 299 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 356



to top

>gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclophilin gene,
           partial cds
          Length = 457

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 86/97 (88%), Gaps = 3/97 (3%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt-ca--ccaggggca 332
           |||||||||||||||||||  ||||||||  ||||||||||||||| ||  |||||| ||
Sbjct: 107 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttcaacccagggtca 166

                                                
Query: 333 acggcaccggcggcgagtccatctacggcgagaagtt 369
           |||||||||||||| ||  ||||||||||||||||||
Sbjct: 167 acggcaccggcggcaagagcatctacggcgagaagtt 203



to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                          
Query: 277    gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 336
              |||||||||||| |||   | |||||||||||||  ||||||||||||||  ||| ||||
Sbjct: 867232 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 867173

                                               
Query: 337    caccggcggcgagtccatctacggcgagaagtt 369
              ||| || ||||||||||||||||||||||||||
Sbjct: 867172 cacgggtggcgagtccatctacggcgagaagtt 867140



to top

>ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA
          Length = 1110

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 81/93 (87%)
 Strand = Plus / Plus

                                                                       
Query: 277 gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 336
           |||||||||||| |||   | |||||||||||||  ||||||||||||||  ||| ||||
Sbjct: 186 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 245

                                            
Query: 337 caccggcggcgagtccatctacggcgagaagtt 369
           ||| || ||||||||||||||||||||||||||
Sbjct: 246 cacgggtggcgagtccatctacggcgagaagtt 278



to top

>gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds
          Length = 705

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||||||||||| |||||||||||||||||| || ||||| |     ||||||
Sbjct: 196 ttccaccgcgtcatccccggcttcatgtgccagggcggtgatttcacgaaccataacggc 255

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| ||||||||||||||||||||||
Sbjct: 256 actggtggcaagtccatctacggcgagaagtt 287



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           |||||||||||||| ||||||||||||||||||||
Sbjct: 139 gagaacttccgcgctctctgcaccggcgagaaggg 173



to top

>emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin gene cluster, strain
             DSM 40236
          Length = 90600

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                         
Query: 278   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
             |||||||| |||||| |||||||||||   |||||||||||||||||| | ||  |||||
Sbjct: 55880 ttccaccgtgtcatcaccgacttcatgcttcagggcggcgacttcacccgcggtgacggc 55939

                                             
Query: 338   accggcggcgagtccatctacggcgagaagtt 369
             ||||||||| ||  ||||||||||||||||||
Sbjct: 55940 accggcggcaagagcatctacggcgagaagtt 55971



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 199   ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
             |||||||||||||||||||  |||||||||||||||| |||||
Sbjct: 55822 ggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 55864



to top

>emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclosporin A-binding protein,
           (pPA0005 gene)
          Length = 1026

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||| ||||| |  ||||||||||| ||||||||||||||  | || ||||| 
Sbjct: 279 ttccaccgcgtgatcccagggttcatgtgccaaggcggcgacttcacgcgtggtaacggt 338

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           |||||||| ||||| |||||||||||||||||
Sbjct: 339 accggcggggagtcgatctacggcgagaagtt 370



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166
           ||||| ||||| ||||| ||||||  ||| ||||||||||| |||||||| |||||||||
Sbjct: 108 aacccaaaggttttctttgacatgcaggtcggcggcgccccagccggccggatcgtgatg 167

                                                                       
Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226
           ||||| |||   || | |||||||| |||||  |||||||| || ||||| |||||||||
Sbjct: 168 gagctctacgccgatgtggtgccgaagacggccgagaactttcgtgcgctgtgcaccggc 227

               
Query: 227 gaga 230
           ||||
Sbjct: 228 gaga 231



to top

>dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin, partial cds
          Length = 423

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| || |||||||||||||||  ||||||||| |||||||||   |||||||||
Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgccggcaacggc 210

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || |||||| |||| ||||||||| |||||||
Sbjct: 211 acgggcggcaagtcgatctacggccagaagtt 242



to top

>dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| || |||||||||||||||  ||||||||| |||||||||   |||||||||
Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgctggcaacggc 210

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || |||||| |||| ||||||||| |||||||
Sbjct: 211 actggcggcaagtcgatctacggccagaagtt 242



to top

>ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript variant B (CG2852),
           mRNA
          Length = 759

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 166 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 225

                                                      
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 226 caccaagggcgacggcaccggcggtcgctccatctacggcgag 268



to top

>ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript variant A (CG2852),
           mRNA
          Length = 887

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350

                                                      
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393



to top

>gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, region 58E-59A, BAC clone
             BACR11M08, complete sequence
          Length = 169534

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                         
Query: 262   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 41299 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 41240

                                                        
Query: 322   caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 41239 caccaagggcgacggcaccggcggtcgctccatctacggcgag 41197



to top

>gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA
          Length = 898

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350

                                                      
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
           ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393



to top

>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete
             sequence
          Length = 302225

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                         
Query: 262   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 51781 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 51722

                                                        
Query: 322   caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 51721 caccaagggcgacggcaccggcggtcgctccatctacggcgag 51679



to top

>gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 DS00837 (D87)), complete
             sequence
          Length = 81677

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                         
Query: 262   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
             |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 12768 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 12827

                                                        
Query: 322   caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
             ||||| |||| |||||||||||||    |||||||||||||||
Sbjct: 12828 caccaagggcgacggcaccggcggtcgctccatctacggcgag 12870



to top

>ref|XM_467917.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1722

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
           |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386



to top

>gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cyclophilin-like
           protein mRNA, complete cds
          Length = 739

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||    | ||||||  |||||||||||||||||||   |||||||||
Sbjct: 265 ttccaccgcgtcatcaagcagttcatgatccagggcggcgacttcaccgccggcaacggc 324

                                    
Query: 338 accggcggcgagtccatctacggcg 362
           ||||||||| |||||||||||||||
Sbjct: 325 accggcggcaagtccatctacggcg 349



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||| ||||| |||||||||||| |||||
Sbjct: 201 gacggtggagaacttccgcgcgctgtgcacgggcgagaagggcttcggc 249



to top

>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                          
Query: 194   acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
             |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 86974 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 87018



to top

>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0486G03
          Length = 146713

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                         
Query: 194  acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
            |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 3255 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 3299



to top

>dbj|AK070404.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023054M07, full
           insert sequence
          Length = 1722

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 44/45 (97%)
 Strand = Plus / Plus

                                                        
Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238
           |||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386



to top

>dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds
          Length = 829

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||| ||||| || ||||||||||||||||| || |||||    ||||||||||| || 
Sbjct: 146 gagaatttccgtgctctctgcaccggcgagaaaggagtcggtcgtagcggcaagccactc 205

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||| ||||||   ||| |||||||| || |||||  |||||||||||||||| || |||
Sbjct: 206 cacttcaagggatcctccttccaccgtgtgatccctaacttcatgtgccagggaggtgac 265

                                                    
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacgg 360
           ||||||   || ||||||||||| || || || ||||||||
Sbjct: 266 ttcaccgccggaaacggcaccggaggagaatcgatctacgg 306



to top

>ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin
           (cytosolic form) [Neurospora crassa OR74A]  )
           (NCU00726.1) partial mRNA
          Length = 543

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| ||||||||||||||||||||||
Sbjct: 253 actggtggcaagtccatctacggcgagaagtt 284



to top

>ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin
           (cytosolic form) [Neurospora crassa OR74A]  )
           (NCU00726.1) partial mRNA
          Length = 543

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| ||||||||||||||||||||||
Sbjct: 253 actggtggcaagtccatctacggcgagaagtt 284



to top

>ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33), transcript variant 3 (LOC607232), mRNA
          Length = 1159

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | |||||||||||||||||||| ||||| |    |||||||
Sbjct: 533 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 592

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||| ||| |||||||||||||  |||||||
Sbjct: 593 accgggggcaagtccatctacgggaagaagtt 624



to top

>ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33), transcript variant 2 (LOC607232), mRNA
          Length = 1216

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | |||||||||||||||||||| ||||| |    |||||||
Sbjct: 590 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 649

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           ||||| ||| |||||||||||||  |||||||
Sbjct: 650 accgggggcaagtccatctacgggaagaagtt 681



to top

>gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence
          Length = 417

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||| |||||   |||||||||  ||||||||| |||||
Sbjct: 216 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 275

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||| |||||||||||||
Sbjct: 276 caccaagggcgacggcaccggcgg 299



to top

>emb|BX045917.1|CNS097LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 791

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 700 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 641

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 640 caccaagggagacggcaccggcgg 617



to top

>emb|BX045916.1|CNS097LC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 308 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 367

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 368 caccaagggagacggcaccggcgg 391



to top

>emb|BX032973.1|CNS08XLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 704 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 645

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 644 caccaagggagacggcaccggcgg 621



to top

>emb|BX032972.1|CNS08XLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 345 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 404

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 405 caccaagggagacggcaccggcgg 428



to top

>emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 634 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 575

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 574 caccaagggagacggcaccggcgg 551



to top

>emb|BX027425.1|CNS08TBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 284 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 343

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 344 caccaagggagacggcaccggcgg 367



to top

>emb|BX025264.1|CNS08RNO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 415 caccaagggagacggcaccggcgg 392



to top

>emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 709 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 650

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 649 caccaagggagacggcaccggcgg 626



to top

>emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 409 caccaagggagacggcaccggcgg 432



to top

>emb|BX010692.1|CNS08GEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 722 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 663

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 662 caccaagggagacggcaccggcgg 639



to top

>emb|BX010691.1|CNS08GEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 346 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 405

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 406 caccaagggagacggcaccggcgg 429



to top

>gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA) mRNA, complete cds
          Length = 1179

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||| ||| |||||||| |||||||||||||||| |||||||||||  |   |||||||
Sbjct: 277 ttccatcgcatcatccccaacttcatgtgccagggtggcgacttcactcgtcacaacggc 336

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || |||||| | || |||||||||||||||||
Sbjct: 337 acgggcggcaaatctatctacggcgagaagtt 368



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 222
           ||||| ||||||| ||| | |||||||||||||||||| |||||
Sbjct: 199 gacgccgtgccgaagaccgcggagaacttccgcgcgctgtgcac 242



to top

>gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mRNA, complete cds
          Length = 945

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||| ||| |||| ||||||||||| || ||||| || |||||||| |||||||||||
Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgccaaggcggcgactt 612

                                               
Query: 322 caccaggggcaacggcaccggcggcgagtccatcta 357
           |||||    ||| |||||||||||| ||||||||||
Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatcta 648



to top

>gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (Cyp1) mRNA, partial cds
          Length = 471

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||| ||||| || ||| ||||||||||||| || |||||||||||||    |||||||
Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggcgacttcaccaaccacaacggc 219

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||||||| ||||||||||||||
Sbjct: 220 accggcggcaagtccatctacggc 243



to top

>gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exons 1, 2 and partial
            cds
          Length = 1783

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                        
Query: 278  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
            ||||| ||||| || ||| |||||||||||||||| |||||||||||||    |||||||
Sbjct: 1472 ttccatcgcgttattcccaacttcatgtgccagggaggcgacttcaccaaccacaacggc 1531

                                    
Query: 338  accggcggcgagtccatctacggc 361
            || |||||| ||||||||||||||
Sbjct: 1532 actggcggcaagtccatctacggc 1555



to top

>ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257
           (ENSANGG00000008768), mRNA
          Length = 1064

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 409 caccaagggagacggcaccggcgg 432



to top

>gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding protein mRNA, complete cds
          Length = 928

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| | |||||||| ||||||  |||||| || ||||||||| | || ||||||
Sbjct: 459 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 518

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| ||||||||||||||||||||||
Sbjct: 519 actggtggcaagtccatctacggcgagaagtt 550



to top

>gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds
          Length = 681

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 60/67 (89%)
 Strand = Plus / Plus

                                                                       
Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166
           |||||||| ||||||||||||||| || | ||||| || ||||| |||||||||||||||
Sbjct: 54  aacccgaaagtgttcttcgacatgtcgatcggcggggctccggcgggccgcatcgtgatg 113

                  
Query: 167 gagctgt 173
           |||||||
Sbjct: 114 gagctgt 120



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||||||||||||||||   |||||||| |||||||||||||| || |||
Sbjct: 246 ttcatgtgccagggcggcgacttcaccgccggcaacgggaccggcggcgagtctatatac 305

             
Query: 359 gg 360
           ||
Sbjct: 306 gg 307



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagg 233
           ||||||||||||||||||||||||||||||||||
Sbjct: 147 gagaacttccgcgcgctctgcaccggcgagaagg 180



to top

>emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylprolyl isomerase (cyclophilin),
           ppiase gene (CyP)
          Length = 823

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 132/163 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||| || ||||||||||| |||||||||  ||||     ||||||||| || 
Sbjct: 137 gagaacttccgggccctctgcaccggtgagaagggcaacggccgctccggcaagcccctc 196

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           |||||||||      || |||||| | || |||||||  |||||||||||||| ||||||
Sbjct: 197 cactacaagaaatcgtccttccacagggtgatccccgggttcatgtgccaggggggcgac 256

                                                      
Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362
           |||||    || ||||||||||| |||||||||||||||||||
Sbjct: 257 ttcactgccggaaacggcaccggtggcgagtccatctacggcg 299



to top

>ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (MG08104.4) partial
           mRNA
          Length = 1131

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 328 gggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 252 gggcaacggtaccggcggcgagtccatctacggcgagaagtt 293



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           |||||||||||||| || || || |||||||||||  | || |||||||||||||| || 
Sbjct: 124 gagaacttccgcgccctgtgtacgggcgagaaggggattggaaagagcggcaagcccctt 183

                       
Query: 260 cactacaagggc 271
           ||||||||||||
Sbjct: 184 cactacaagggc 195



to top

>emb|BX072404.1|CNS09S14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 562 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 521



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 502 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 461



to top

>emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 269 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 310



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 329 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 370



to top

>emb|BX057302.1|CNS09GDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 258 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 299



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 318 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 359



to top

>emb|BX050608.1|CNS09B7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 504

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 243 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 284



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 303 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 344



to top

>emb|BX046149.1|CNS097RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 267 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 308



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 327 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 368



to top

>emb|BX036923.1|CNS090NJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 289 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 330



to top

>emb|BX024694.1|CNS08R7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 265

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 155 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 196



to top

>emb|BX016404.1|CNS08KTK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 287 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 328



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 347 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 388



to top

>emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 276 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 317



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 336 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 377



to top

>emb|BX013233.1|CNS08IDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 492

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 271 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 312



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 331 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 372



to top

>emb|BX011227.1|CNS08GTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 265 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 306



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 325 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 366



to top

>emb|BX008702.1|CNS08EVM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 323 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 364



to top

>emb|BX006580.1|CNS08D8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  | |||||||||||||| |||||||||
Sbjct: 323 caccgcgtgatcccgaatttcatgtgccaggggggcgacttc 364



to top

>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29
          Length = 303550

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                          
Query: 276    cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
              |||||||||| || |||||  | ||||||  ||||||||| ||||||||||  |||||||
Sbjct: 263153 cgttccaccgtgtgatcccgcagttcatgctccagggcggtgacttcaccaacggcaacg 263094

                                                
Query: 336    gcaccggcggcgagtccatctacggcgagaagtt 369
              ||||||| ||| ||  ||||||||||||||||||
Sbjct: 263093 gcaccgggggcaagagcatctacggcgagaagtt 263060



to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 276    cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325
              |||||||||||||||||||| ||||||||  |||||||||||||||||||
Sbjct: 250067 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 250018



to top

>ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778
           (ENSANGG00000018289), mRNA
          Length = 1289

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 584 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 625



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| |||||  |||||||||||||||| |||||||||
Sbjct: 644 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 685



to top

>ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA
          Length = 612

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325
           |||||||||||||||||||| ||||||||  |||||||||||||||||||
Sbjct: 218 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 267



to top

>ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-prolyl cis-trans
           isomerase E (PPIase E) (Rotamase E) (Cyclophilin E)
           (Cyclophilin 33) (LOC509352), mRNA
          Length = 2522

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||||   ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 399 caagggcagcagtttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 458

                                                        
Query: 325 caggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||    ||| |||||||| ||| |||||||||||||  |||||||
Sbjct: 459 caaccacaatggcaccgggggcaagtccatctacgggaagaagtt 503



to top

>emb|CR956427.7| Pig DNA sequence from clone CH242-51O7 on chromosome 6, complete sequence
          Length = 187800

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                          
Query: 265    caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
              ||||||||||   ||||||||| |||||||| | |||||||||||||||||||| |||||
Sbjct: 174628 caagggcagcagcttccaccgcatcatcccccagttcatgtgccagggcggcgatttcac 174687

                                               
Query: 325    caggggcaacggcaccggcggcgagtccatcta 357
              ||    ||||||||| || ||| ||||||||||
Sbjct: 174688 caaccacaacggcactgggggcaagtccatcta 174720



to top

>gb|DQ440048.1| Aedes aegypti clone AE-296 cyclophylin isoform mRNA, complete cds
          Length = 597

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 201 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 260

               
Query: 322 cacc 325
           ||||
Sbjct: 261 cacc 264



to top

>gb|AY368274.1| Nicotiana tabacum cyclophilin-like (CYP1) mRNA, complete sequence
          Length = 768

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           |||||||||||||| ||||||||||||||||| |||||||| | ||  ||||||||  ||
Sbjct: 130 gagaacttccgcgctctctgcaccggcgagaaaggcgtcggaaggatgggcaagcctttg 189

                   
Query: 260 cactacaa 267
           ||||||||
Sbjct: 190 cactacaa 197



to top

>ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00777.1)
           partial mRNA
          Length = 675

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||  ||||||| |||||||||   ||||| || ||||||||| | |||||||||
Sbjct: 325 ttccaccgaatcatccctgacttcatgcttcagggtggtgacttcacccgtggcaacggc 384

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| ||||||||||||| ||||||||
Sbjct: 385 actggtggcaagtccatctacggtgagaagtt 416



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           |||||||||||||| |||||||| |||||||||||
Sbjct: 268 gagaacttccgcgctctctgcactggcgagaaggg 302



to top

>emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA
          Length = 772

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA
          Length = 771

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA
          Length = 772

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA
          Length = 773

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| ||||||||||||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcaccggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>gb|AY346337.1| Branchiostoma belcheri tsingtaunese cyclophilin A mRNA, complete
           cds
          Length = 1358

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||| || | ||||||||||||||| || ||||||| ||||||  | |||
Sbjct: 232 ttccaccgcgtcattcctggcttcatgtgccagggaggtgacttcatcaggggagatggc 291

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||||||| ||  ||||||||||
Sbjct: 292 accggcggcaagagcatctacggc 315



to top

>gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds
          Length = 814

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||||||||||||| |||||||| |    |||||||
Sbjct: 605 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 664

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| |||||||||| ||| |||||||
Sbjct: 665 acagggggcaagtccatctatggcaagaagtt 696



to top

>emb|BX053495.1|CNS09DFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  ||| |||||||||
Sbjct: 415 caccaagggagacgacaccggcgg 392



to top

>emb|BX053494.1|CNS09DFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 339 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 398

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  ||| |||||||||
Sbjct: 399 caccaagggagacgacaccggcgg 422



to top

>emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||| ||||| |||||
Sbjct: 335 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccaaggcggtgactt 394

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 395 caccaagggagacggcaccggcgg 418



to top

>emb|BX043476.1|CNS095PK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  ||| |||||||||
Sbjct: 415 caccaagggagacgacaccggcgg 392



to top

>emb|BX043545.1|CNS095RH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  ||| |||||||||
Sbjct: 415 caccaagggagacgacaccggcgg 392



to top

>emb|BX043544.1|CNS095RG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||||||||| |||||
Sbjct: 358 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 417

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  ||| |||||||||
Sbjct: 418 caccaagggagacgacaccggcgg 441



to top

>emb|BX025263.1|CNS08RNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  ||||||||| || |||| ||||||||||  ||| ||||| |||||
Sbjct: 326 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccacggcggtgactt 385

                                   
Query: 322 caccaggggcaacggcaccggcgg 345
           ||||| |||  |||||||||||||
Sbjct: 386 caccaagggagacggcaccggcgg 409



to top

>emb|CR938346.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YC07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 845

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 371 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 430

               
Query: 322 cacc 325
           ||||
Sbjct: 431 cacc 434



to top

>emb|CR938040.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YM12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 862

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||||||||||||||  |||||||||  ||||||||| |||||
Sbjct: 388 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 447

               
Query: 322 cacc 325
           ||||
Sbjct: 448 cacc 451



to top

>ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl isomerase E
           (cyclophilin E) (predicted) (Ppie_predicted), mRNA
          Length = 944

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||||||||||||| |||||||| |    |||||||
Sbjct: 602 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 661

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||| |||||||||| ||| |||||||
Sbjct: 662 acagggggcaagtccatctatggcaagaagtt 693



to top

>gb|AY134669.1| Drosophila melanogaster peptidylprolyl cis-trans isomerase mRNA,
           complete cds
          Length = 3177

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||||||||||||||||||||||||||||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389



to top

>emb|AJ238310.1|LRU238310 Lumbricus rubellus mRNA for cyclophilin A
          Length = 1158

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           ||||||||||||||||| |||||||||| |||| |||||||||| ||  ||  |||||||
Sbjct: 277 ttcatgtgccagggcggtgacttcaccaagggcgacggcaccggtggaaagagcatctac 336

                      
Query: 359 ggcgagaagtt 369
           || ||||||||
Sbjct: 337 ggagagaagtt 347



to top

>dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 274 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 333
           |||||||||||| |||||||||||||| |||  |||||| || ||||||||    |||||
Sbjct: 147 ctcgttccaccgtgtcatccccgactttatgctccagggtggtgacttcactgccggcaa 206

                                      
Query: 334 cggcaccggcggcgagtccatctacgg 360
           ||| ||||| ||| |||||||||||||
Sbjct: 207 cggtaccggtggcaagtccatctacgg 233



to top

>ref|NM_170367.1| Drosophila melanogaster Moca-cyp CG1866-RA, transcript variant A
           (Moca-cyp), mRNA
          Length = 3162

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||||||||||||||||||||||||||||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389



to top

>ref|NM_143361.3| Drosophila melanogaster Moca-cyp CG1866-RB, transcript variant B
           (Moca-cyp), mRNA
          Length = 3705

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||||||||||||||||||||||||||||||
Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcg 374



to top

>gb|AY051595.1| Drosophila melanogaster GH23813 full length cDNA
          Length = 3726

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||||||||||||||||||||||||||||||
Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcg 374



to top

>gb|AC009345.7|AC009345 Drosophila melanogaster, chromosome 3R, region 98C-98C, BAC clone
              BACR28F20, complete sequence
          Length = 158895

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                 
Query: 328    gggcaacggcaccggcggcgagtccatctacggcg 362
              |||||||||||||||||||||||||||||||||||
Sbjct: 131821 gggcaacggcaccggcggcgagtccatctacggcg 131855



to top

>gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, region 98C-98D, BAC clone
             BACR14L13, complete sequence
          Length = 197348

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                
Query: 328   gggcaacggcaccggcggcgagtccatctacggcg 362
             |||||||||||||||||||||||||||||||||||
Sbjct: 35036 gggcaacggcaccggcggcgagtccatctacggcg 35070



to top

>gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial cds
          Length = 695

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaag 253
           |||| ||||||||||||||| || |||||||||||||| ||||||||    ||| |||| 
Sbjct: 60  acggcggagaacttccgcgctctttgcaccggcgagaaaggcgtcgggcgcagccgcaaa 119

                                                                       
Query: 254 ccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggc 313
           || || |||| ||| ||    |||||||||||||| ||||| |  ||||||||||| || 
Sbjct: 120 cctctccacttcaaaggatcatcgttccaccgcgtgatccctggattcatgtgccaagga 179

                                                          
Query: 314 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360
           ||||| |||||    || ||||||||||| ||||| || ||||||||
Sbjct: 180 ggcgatttcactgccggaaacggcaccggaggcgaatcgatctacgg 226



to top

>gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 103 of 118 of the
             complete sequence
          Length = 239049

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                                
Query: 328   gggcaacggcaccggcggcgagtccatctacggcg 362
             |||||||||||||||||||||||||||||||||||
Sbjct: 10715 gggcaacggcaccggcggcgagtccatctacggcg 10749



to top

>gb|BT001578.1| Drosophila melanogaster RE23622 full insert cDNA
          Length = 3180

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Plus

                                              
Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362
           |||||||||||||||||||||||||||||||||||
Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389



to top

>gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete cds
          Length = 884

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 132/162 (81%), Gaps = 2/162 (1%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           |||||||||||||| ||||| ||||||||||||||    || | ||| || ||||| || 
Sbjct: 124 gagaacttccgcgccctctgtaccggcgagaagggaaaagggaggagtgggaagcctctc 183

                                                                       
Query: 260 cactacaagggcagct-cgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318
           ||||| ||||| | || | |||||||  || |||||| ||||||||||||||||||| ||
Sbjct: 184 cactataaggg-atctaccttccaccttgtaatccccaacttcatgtgccagggcggaga 242

                                                     
Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacgg 360
           |||||||   || ||||  ||||| |||||||| ||||||||
Sbjct: 243 cttcaccgccggaaacgaaaccggaggcgagtcgatctacgg 284



to top

>emb|Z48002.1|TNCYCABPR T.niveum gene for cyclophilin A-binding protein
          Length = 1750

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||| ||||||||||||||||||||| |||||
Sbjct: 764 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 805



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325
           ||||||||  |||||||||| ||||||  |||||||||||||||||||
Sbjct: 821 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 868



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||| |||||| ||||||||||||||||||||||
Sbjct: 936 ggcactggcggcaagtccatctacggcgagaagtt 970



to top

>emb|Z32674.1|TNCPTAG T.niveum (ATCC34921) cptA gene for cyclophilin
          Length = 1488

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 40/42 (95%)
 Strand = Plus / Plus

                                                     
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||||| ||||||||||||||||||||| |||||
Sbjct: 878 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 919



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325
           ||||||||  |||||||||| ||||||  |||||||||||||||||||
Sbjct: 935 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 982



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 335  ggcaccggcggcgagtccatctacggcgagaagtt 369
            ||||| |||||| ||||||||||||||||||||||
Sbjct: 1050 ggcactggcggcaagtccatctacggcgagaagtt 1084



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                           
Query: 278     ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
               |||||||| |||||||| | ||| |||   |||||||| |||||||||| |  |||||||
Sbjct: 1868078 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 1868137

                                            
Query: 338     accggcggcgagtccatctacggcgagaa 366
               ||||||||||  || ||||||||||||||
Sbjct: 1868138 accggcggcgtctctatctacggcgagaa 1868166



to top

>ref|XM_838488.1| Leishmania major strain Friedlin peptidyl-prolyl cis-trans
           isomerase (cyclophilin-40) (LMJ_1407) partial mRNA
          Length = 1065

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| |||||||| | ||| |||   |||||||| |||||||||| |  |||||||
Sbjct: 187 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 246

                                        
Query: 338 accggcggcgagtccatctacggcgagaa 366
           ||||||||||  || ||||||||||||||
Sbjct: 247 accggcggcgtctctatctacggcgagaa 275



to top

>emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for putative cyclophilin (cpa1
           gene)
          Length = 595

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 314 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaa 366
           ||||||||||||| |||||||||||| |||||  ||||||||||||| |||||
Sbjct: 195 ggcgacttcaccaagggcaacggcactggcggaaagtccatctacggagagaa 247



to top

>dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-prolyl cis-trans
           isomerase, complete cds
          Length = 793

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 ggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgc 307
           |||||||| || |||| |||||||  ||| |||||||| |||||||| | ||| ||||||
Sbjct: 212 ggcaagccccttcacttcaagggctcctccttccaccgggtcatccctggctttatgtgc 271

                                                                
Query: 308 cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360
           |||||||| ||||| ||    || || ||||||||||| |||||||| |||||
Sbjct: 272 cagggcggtgactttactgctggaaatggcaccggcggtgagtccatttacgg 324



to top

>gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end
          Length = 661

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 129/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 149 gccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttc 208
           ||||||||||||||||||||||| |||   ||| | || ||   |||||  |||||||||
Sbjct: 40  gccggccgcatcgtgatggagctttacgccgacacagtccccgagacggccgagaacttc 99

                                                                       
Query: 209 cgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaag 268
           || || ||||||||||||||||  ||  |||||||   ||| ||||| || |||||||||
Sbjct: 100 cgtgctctctgcaccggcgagagaggaatcggcaaatccggaaagccactccactacaag 159

                                                    
Query: 269 ggcagctcgttccaccgcgtcatccccgacttcatgtgcca 309
           |||    | ||||||||||| |||||| | |||||||||||
Sbjct: 160 ggctcggctttccaccgcgtgatccccaagttcatgtgcca 200



to top

>ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative cyclophilin
           (OSJNAa0034B05.5), mRNA
          Length = 546

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 197 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 256

                           
Query: 336 gcaccggcggcgagtc 351
           ||||||||||||||||
Sbjct: 257 gcaccggcggcgagtc 272



to top

>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone
            OSJNBa0004E08, complete sequence
          Length = 158294

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                        
Query: 276  cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
            |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 8927 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 8986

                            
Query: 336  gcaccggcggcgagtc 351
            ||||||||||||||||
Sbjct: 8987 gcaccggcggcgagtc 9002



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                         
Query: 251   aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310
             |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 16348 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 16407

                      
Query: 311   ggcggcgac 319
              ||||||||
Sbjct: 16408 agcggcgac 16416



to top

>gb|AF291180.1| Capsicum annuum cyclophilin CACYP1 mRNA, complete cds
          Length = 695

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcgg 240
           ||||| ||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 125 gacggcggaaaacttccgtgcactctgcaccggcgagaagggcgtcgg 172



to top

>emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA
          Length = 786

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA
          Length = 783

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270



to top

>emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA
          Length = 782

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA
          Length = 764

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 91  ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 150

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 151 ttccgcgccctctgcactggcgagaagggcttcggc 186



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 202 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 250



to top

>emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA
          Length = 776

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 104 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 163

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 164 ttccgcgccctctgcactggcgagaagggcttcggc 199



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 215 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 263



to top

>emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA
          Length = 769

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 97  ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 156

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 157 ttccgcgccctctgcactggcgagaagggcttcggc 192



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 208 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 256



to top

>emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA
          Length = 679

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 7   ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 66

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 67  ttccgcgccctctgcactggcgagaagggcttcggc 102



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 118 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 166



to top

>emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA
          Length = 781

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA
          Length = 778

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 106 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 165

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 166 ttccgcgccctctgcactggcgagaagggcttcggc 201



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 217 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 265



to top

>emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA
          Length = 782

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA
          Length = 783

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270



to top

>emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA
          Length = 780

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267



to top

>emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA
          Length = 781

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA
          Length = 779

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267



to top

>emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA
          Length = 780

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||||||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268



to top

>gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAa0034B05, complete sequence
          Length = 125655

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                         
Query: 276   cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
             |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 74582 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 74641

                             
Query: 336   gcaccggcggcgagtc 351
             ||||||||||||||||
Sbjct: 74642 gcaccggcggcgagtc 74657



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                         
Query: 251   aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310
             |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 82003 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 82062

                      
Query: 311   ggcggcgac 319
              ||||||||
Sbjct: 82063 agcggcgac 82071



to top

>ref|NM_079049.2| Drosophila melanogaster cyclophilin-33 CG4886-RA (cyp33), mRNA
          Length = 1317

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                        
Query: 262  ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
            |||||| ||| |||| ||||||||||| || ||||| || ||||| || || ||||||||
Sbjct: 943  ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 1002

                                                
Query: 322  caccaggggcaacggcaccggcggcgagtccatcta 357
            |||||    ||| |||||||||||| ||||||||||
Sbjct: 1003 caccaacaacaatggcaccggcggcaagtccatcta 1038



to top

>gb|AY061421.1| Drosophila melanogaster LD35248 full length cDNA
          Length = 946

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||| ||| |||| ||||||||||| || ||||| || ||||| || || ||||||||
Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 612

                                               
Query: 322 caccaggggcaacggcaccggcggcgagtccatcta 357
           |||||    ||| |||||||||||| ||||||||||
Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatcta 648



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                           
Query: 276     cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
               |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 3417798 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417857

                               
Query: 336     gcaccggcggcgagtc 351
               ||||||||||||||||
Sbjct: 3417858 gcaccggcggcgagtc 3417873



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                           
Query: 251     aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310
               |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 3425219 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425278

                        
Query: 311     ggcggcgac 319
                ||||||||
Sbjct: 3425279 agcggcgac 3425287



to top

>ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (ppial), mRNA
          Length = 822

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||| ||  ||||||||||||||
Sbjct: 357 accggaggaaagtccatctacggc 380



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274



to top

>gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1) mRNA, partial cds
          Length = 471

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||| ||||| || ||| ||||||||||||| || || ||||||||||    |||||||
Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggtgacttcaccaaccacaacggc 219

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 220 actggcggcaagtccatctacggc 243



to top

>gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone
           MGC:86688 IMAGE:6895545), complete cds
          Length = 784

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 229 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 288

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||| ||  ||||||||||||||
Sbjct: 289 accggaggaaagtccatctacggc 312



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 172 gagaacttccgtgcactctgcaccggagagaaggg 206



to top

>dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-H03, full
           insert sequence
          Length = 927

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 319 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 378

                           
Query: 336 gcaccggcggcgagtc 351
           ||||||||||||||||
Sbjct: 379 gcaccggcggcgagtc 394



to top

>gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gene, complete cds
          Length = 945

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||||||||||   ||||||||  ||||||||||||||||||||    | | |||
Sbjct: 483 ttccaccgcgtcatccaaaacttcatgatccagggcggcgacttcaccaacttcgatggc 542

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || |||||| |||| ||||||||||| |||||
Sbjct: 543 acgggcggcaagtcgatctacggcgaaaagtt 574



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                           
Query: 276     cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
               |||||||||||||  | ||||  ||||||||||||||||||||| ||||    || ||||
Sbjct: 3417719 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417778

                               
Query: 336     gcaccggcggcgagtc 351
               ||||||||||||||||
Sbjct: 3417779 gcaccggcggcgagtc 3417794



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 57/69 (82%)
 Strand = Plus / Plus

                                                                           
Query: 251     aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310
               |||||||| ||||||||||||    |||||||||| ||  | ||||  ||||||||||||
Sbjct: 3425140 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425199

                        
Query: 311     ggcggcgac 319
                ||||||||
Sbjct: 3425200 agcggcgac 3425208



to top

>emb|CR956622.12| Pig DNA sequence from clone PigE-219N9 on chromosome 6, complete
             sequence
          Length = 174170

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                         
Query: 278   ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
             |||||| || |||||||| | |||||||||||||||||||| |||||||    |||||||
Sbjct: 95535 ttccactgcatcatcccccagttcatgtgccagggcggcgatttcaccaaccacaacggc 95476

                                 
Query: 338   accggcggcgagtccatcta 357
             || || ||| ||||||||||
Sbjct: 95475 actgggggcaagtccatcta 95456



to top

>gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone
           MGC:73102 IMAGE:4786094), complete cds
          Length = 822

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| | |||||||| |||||||| || |||||||    |||||| 
Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||| ||  ||||||||||||||
Sbjct: 357 accggaggaaagtccatctacggc 380



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274



to top

>ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis-trans isomerase
           (Afu3g07430) partial mRNA
          Length = 492

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||   ||||| || || ||||||| ||||||||||
Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213

                                  
Query: 338 accggcggcgagtccatctacgg 360
           || || ||| |||||||||||||
Sbjct: 214 actggtggcaagtccatctacgg 236



to top

>emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA
          Length = 767

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           ||||||||||||||| |||||||| |||||||||||| |||||
Sbjct: 147 ggagaacttccgcgccctctgcactggcgagaagggcttcggc 189



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 205 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 253



to top

>ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predicted mRNA
          Length = 531

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 168 agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 227
           ||||||||||||||  |||||| | ||||| |||||||||||| || || ||||| ||||
Sbjct: 104 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 163

                  
Query: 228 agaaggg 234
           |||||||
Sbjct: 164 agaaggg 170



to top

>emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (cyp1 gene)
          Length = 679

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                       
Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166
           ||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||| ||||||
Sbjct: 10  aaccctaaggtcttctttgacatgactgtcggcggtgctccggcgggccgcatagtgatg 69

                  
Query: 167 gagctgt 173
           |||||||
Sbjct: 70  gagctgt 76



to top

>dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, partial cds
          Length = 486

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 333
           |||||||||||| || ||||| |||||||||  |||||| || ||||||||   ||||||
Sbjct: 147 ctcgttccaccgtgtgatccctgacttcatgctccagggtggtgacttcactgcgggcaa 206

                                      
Query: 334 cggcaccggcggcgagtccatctacgg 360
           ||||||||| ||| ||  |||||||||
Sbjct: 207 cggcaccggtggcaagagcatctacgg 233



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||||||| ||||| ||||| || ||||||||| |||||
Sbjct: 93  ggagaacttccgtgcgctgtgcactggtgagaagggcttcggc 135



to top

>emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp f 27 gene), strain
           ATCC 42202
          Length = 492

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||   ||||| || || ||||||| ||||||||||
Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213

                                  
Query: 338 accggcggcgagtccatctacgg 360
           || || ||| |||||||||||||
Sbjct: 214 actggtggcaagtccatctacgg 236



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                           
Query: 168     agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 227
               ||||||||||||||  |||||| | ||||| |||||||||||| || || ||||| ||||
Sbjct: 1368420 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 1368479

                      
Query: 228     agaaggg 234
               |||||||
Sbjct: 1368480 agaaggg 1368486



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 308     cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaag 367
               ||||| || |||||||||   |||||||| ||||| || |||||||||||||| ||||||
Sbjct: 2361962 cagggaggagacttcaccgctggcaacggtaccggaggagagtccatctacggggagaag 2361903

                 
Query: 368     tt 369
               ||
Sbjct: 2361902 tt 2361901



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                           
Query: 278     ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
               |||||||| ||||||||| | ||||||   ||||| || ||||||||| |   |||||| 
Sbjct: 1424183 ttccaccgagtcatcccccagttcatgctgcagggtggagacttcacccgacacaacgga 1424242

                                        
Query: 338     accggcggcgagtccatctacggcg 362
               ||||| ||| |||||||||||||||
Sbjct: 1424243 accggaggcaagtccatctacggcg 1424267



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                   
Query: 200     gagaacttccgcgcgctctgcaccggcgagaagggc 235
               ||||||||||| || || ||||| ||||||||||||
Sbjct: 2362070 gagaacttccgagctctgtgcactggcgagaagggc 2362035



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 200     gagaacttccgcgcgctctgcaccggcgagaagggc 235
               ||||||||||| || || |||||||||||| |||||
Sbjct: 1424126 gagaacttccgagctctgtgcaccggcgagcagggc 1424161



to top

>gb|DQ079281.1| Drosophila arizonae strain 15081-1271.13 moj29 (moj29) gene,
           partial cds
          Length = 938

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  |||||| ||| |||||   ||||| |||  |||||| ||||||||
Sbjct: 608 ctacaagggcagcaagttccatcgcatcatcaaggactttatgatccagggtggcgactt 667

                                                      
Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364
           ||||| |||| ||||||| ||||||   |||||||| ||||||
Sbjct: 668 caccaagggcgacggcactggcggccgttccatctatggcgag 710



to top

>gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, complete cds; nuclear
            gene encoding mitochondrial and cytosolic products
          Length = 2215

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                      
Query: 278  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
            ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||
Sbjct: 955  ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 1012



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 335  ggcaccggcggcgagtccatctacggcgagaagtt 369
            |||||||| ||| ||||| ||||||||||||||||
Sbjct: 1090 ggcaccggtggcaagtccgtctacggcgagaagtt 1124



to top

>gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds
          Length = 814

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 102/126 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259
           ||||||||||| || |||||||| || |||||||| ||||||||  ||||||| || || 
Sbjct: 140 gagaacttccgtgcactctgcactggtgagaagggagtcggcaaaggcggcaaacccctt 199

                                                                       
Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319
           || ||||| ||   ||| |||||||| || |||||  | |||||||||||||| || || 
Sbjct: 200 cattacaaaggatcctccttccaccgtgtgatccctaatttcatgtgccagggaggtgat 259

                 
Query: 320 ttcacc 325
           ||||||
Sbjct: 260 ttcacc 265



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 171
           ||||||||||||||  | |||||| | ||||||||||| ||| | ||||||||
Sbjct: 59  ttcttcgacatgacaatcggcggcacaccggccggccggatcatcatggagct 111



to top

>gb|AY106356.1| Zea mays PCO149745 mRNA sequence
          Length = 1855

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 192 ggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||| |||||||||||||||||||||||| || ||||| ||| |||||
Sbjct: 369 ggacggcggagaacttccgcgcgctctgcacaggggagaaaggcatcggc 418



to top

>gb|AF041412.1|AF041412 Periplaneta americana peptidyl-prolyl cis-trans isomerase mRNA,
           partial cds
          Length = 235

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322
           |||||||| ||| | ||||||||||| |||||| |||||||||| ||||| || ||||||
Sbjct: 13  tacaagggtagcaccttccaccgcgttatccccaacttcatgtgtcagggaggagacttc 72

             
Query: 323 ac 324
           ||
Sbjct: 73  ac 74



to top

>dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, complete cds
          Length = 1652

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           ||||||||  |||||||||||||||||  ||||||||| ||||||||| | |||||||
Sbjct: 654 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 711



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369
           |||||||| ||| ||||| ||||||||||||||||
Sbjct: 789 ggcaccggtggcaagtccgtctacggcgagaagtt 823



to top

>gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complete cds
          Length = 760

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 171
           |||||||||||||| || |||||  | ||||||||||| ||||||||||||||
Sbjct: 75  ttcttcgacatgaccgtcggcggatcaccggccggccgaatcgtgatggagct 127



to top

>ref|XM_571478.1| Cryptococcus neoformans var. neoformans JEC21 peptidyl-prolyl
           cis-trans isomerase (CNF00430) partial mRNA
          Length = 1329

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 317 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369
           ||||| ||||||||| |||| ||||| || ||||||||||| |||||||||||
Sbjct: 310 gactttaccaggggcgacggaaccggtggagagtccatctatggcgagaagtt 362



to top

>emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allergen Mal s 6, strain ATCC no.
           42132
          Length = 573

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| || ||||| ||||| |||  |||||| || |||||||||   |||||||||
Sbjct: 166 ttccaccgtgtgatccctgactttatgctccagggtggtgacttcaccgctggcaacggc 225

                                    
Query: 338 accggcggcgagtccatctacggcg 362
           || |||||| |||| ||||||||||
Sbjct: 226 acgggcggcaagtcgatctacggcg 250



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| || |||||||| |||||||||||| |||||
Sbjct: 112 aacttccgtgctctctgcactggcgagaagggcttcggc 150



to top

>ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predicted mRNA
          Length = 687

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 297 acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 356
           ||||||||  ||||||||| ||||||||| | ||  ||||||| || |||||||||||||
Sbjct: 260 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 319

                
Query: 357 acggc 361
           |||||
Sbjct: 320 acggc 324



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 197 gtggagaacttccgcgcgctctgcaccggcgaga 230
           |||||||||||||| || || |||||||||||||
Sbjct: 181 gtggagaacttccgagctctgtgcaccggcgaga 214



to top

>ref|NM_067427.3| Caenorhabditis elegans CYclophyliN family member (cyn-2) (cyn-2)
           mRNA, complete cds
          Length = 655

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 155 cgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcg 214
           |||||||| |||||||| ||||| |||   ||||||| ||| | ||| ||||||||||| 
Sbjct: 71  cgcatcgttatggagctctacaacgacatcgtgccgaagacagcggaaaacttccgcgct 130

                            
Query: 215 ctctgcaccggcgagaa 231
           || ||||||||||||||
Sbjct: 131 ctgtgcaccggcgagaa 147



to top

>gb|AY229877.1| Populus tremuloides cyclophilin mRNA, complete cds
          Length = 709

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 137 ggcggcgccccggccggccgcatcgtgatggagctgt 173
           ||||||||||| |||||||| ||||||||||||||||
Sbjct: 63  ggcggcgccccagccggccggatcgtgatggagctgt 99



to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                           
Query: 297     acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 356
               ||||||||  ||||||||| ||||||||| | ||  ||||||| || |||||||||||||
Sbjct: 2719818 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 2719877

                    
Query: 357     acggc 361
               |||||
Sbjct: 2719878 acggc 2719882



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 197     gtggagaacttccgcgcgctctgcaccggcgaga 230
               |||||||||||||| || || |||||||||||||
Sbjct: 2719739 gtggagaacttccgagctctgtgcaccggcgaga 2719772



to top

>gb|AY391451.1| Danio rerio peptidylprolyl isomerase A (PPIA-1) mRNA, complete cds
          Length = 743

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||||||||||||| | |||||||| |||||||| || || ||||    |||||| 
Sbjct: 220 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgattttaccaatcacaacgga 279

                                   
Query: 338 accggcggcgagtccatctacggc 361
           ||||| ||  ||||||||||||||
Sbjct: 280 accggaggaaagtccatctacggc 303



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234
           ||||||||||| || ||||||||||| ||||||||
Sbjct: 163 gagaacttccgtgcactctgcaccggagagaaggg 197



to top

>ref|XM_513346.1| PREDICTED: Pan troglodytes similar to peptidylprolyl isomerase E
           isoform 2; peptidyl-prolyl cis-trans isomerase E;
           cyclophilin 33; cyclophilin E; PPIase E; rotamase E
           (LOC456784), mRNA
          Length = 1113

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||||||||||||| || ||||| |    |||||||
Sbjct: 566 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 625

                               
Query: 338 accggcggcgagtccatcta 357
           || || ||| ||||||||||
Sbjct: 626 actgggggcaagtccatcta 645



to top

>ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8605.2), mRNA
          Length = 489

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| ||||| ||| | ||||||  |||||| || ||||||||| |    ||||||
Sbjct: 151 ttccaccgtgtcattccccagttcatgctccagggtggtgacttcacccgccagaacggc 210

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || |||||| ||||||||||||| ||||||||
Sbjct: 211 actggcggcaagtccatctacggtgagaagtt 242



to top

>ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM03726.1) partial mRNA
          Length = 489

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 73/88 (82%)
 Strand = Plus / Plus

                                                                       
Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334
           ||||||||||| |||||||| |||||||||   ||||| || |||||||||   || |||
Sbjct: 148 tcgttccaccgtgtcatcccggacttcatgctgcagggtggtgacttcaccgccggtaac 207

                                       
Query: 335 ggcaccggcggcgagtccatctacggcg 362
           || ||||| ||| |||| ||||||||||
Sbjct: 208 ggtaccggaggcaagtcgatctacggcg 235



to top

>ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A
           (CNB01230) partial mRNA
          Length = 620

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| || |||||| | ||||||  |||||| || ||||||||||    |||||||
Sbjct: 202 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 261

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 262 actggcggcaagtccatctacggc 285



to top

>ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A
           (CNB01290) partial mRNA
          Length = 591

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| || |||||| | ||||||  |||||| || ||||||||||    |||||||
Sbjct: 253 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 312

                                   
Query: 338 accggcggcgagtccatctacggc 361
           || |||||| ||||||||||||||
Sbjct: 313 actggcggcaagtccatctacggc 336



to top

>emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA
          Length = 784

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| |||||||| |||| ||||||| |||||
Sbjct: 169 ttccgcgccctctgcactggcgggaagggcttcggc 204



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 280 ccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 223 ccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269



to top

>emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 79/96 (82%)
 Strand = Plus / Plus

                                                                       
Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205
           ||||| ||||||||||||||||||||  ||   |||| ||| || |  || | |||||||
Sbjct: 22  ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 81

                                               
Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241
           |||||||| ||||| || |||||||||||| |||||
Sbjct: 82  ttccgcgccctctgaactggcgagaagggcttcggc 117



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326
           |||||||||||||||||  | |||||||||||||| || || |||||||
Sbjct: 133 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 181



to top

>emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
           |||||||||||||  || |||||| || | || ||||||||||  ||||||||| |||||
Sbjct: 336 ctacaagggcagcaagtcccaccgggtgacccgcgacttcatgatccagggcggtgactt 395

                               
Query: 322 caccaggggcaacggcaccg 341
           ||||| |||  |||||||||
Sbjct: 396 caccaagggagacggcaccg 415



to top

>emb|CR860299.1| Pongo pygmaeus mRNA; cDNA DKFZp459B225 (from clone DKFZp459B225)
          Length = 4360

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           ||||||||| |||||||| | ||||||||||||||||| || ||||| |    |||||||
Sbjct: 586 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 645

                               
Query: 338 accggcggcgagtccatcta 357
           || || ||| ||||||||||
Sbjct: 646 actgggggcaagtccatcta 665



to top

>emb|AJ609278.1| Cicer arietinum partial mRNA for cyclophilin-type peptidyl-prolyl
           cis-trans isomerase (ppi gene)
          Length = 651

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 245 agcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatg 304
           ||||||||||| || |||| ||||||   ||| ||||| || || |||||| ||||||||
Sbjct: 7   agcggcaagccacttcacttcaagggatcctccttccatcgtgtgatccccaacttcatg 66

                                                                   
Query: 305 tgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360
           || ||||| || |||||||||   || ||||||||||| || || || ||||||||
Sbjct: 67  tgtcagggaggtgacttcaccgccgggaacggcaccggaggagaatcgatctacgg 122



to top

>dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122
          Length = 1101

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337
           |||||||| |||||||||   || |||  |||||| || ||||||||| | |||||||||
Sbjct: 432 ttccaccgtgtcatccccagttttatgctccagggaggtgacttcacccgtggcaacggc 491

                                           
Query: 338 accggcggcgagtccatctacggcgagaagtt 369
           || || ||  ||||||||||||| ||||||||
Sbjct: 492 actggtggtaagtccatctacggtgagaagtt 523



to top

>gb|AF411956.1| Takifugu rubripes lck gene locus, partial sequence
          Length = 60169

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                         
Query: 262   ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321
             |||||||||||||   ||||| ||| |||||||  | || |||||||| || ||||||||
Sbjct: 47447 ctacaagggcagcagcttccatcgcatcatccctcagtttatgtgccaaggtggcgactt 47506

                                                     
Query: 322   caccaggggcaacggcaccggcggcgagtccatctacggc 361
             |||||    |||||||||||| ||| |||| |||||||||
Sbjct: 47507 caccaaccacaacggcaccgggggcaagtctatctacggc 47546



to top

>gb|BC107736.1| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript
           variant 1, mRNA (cDNA clone MGC:111222 IMAGE:4809032),
           complete cds
          Length = 1300

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 580 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 626



to top

>ref|XM_507866.1| PREDICTED: Pan troglodytes similar to Peptidyl-prolyl cis-trans
           isomerase, mitochondrial precursor (PPIase) (Rotamase)
           (Cyclophilin F) (LOC450545), mRNA
          Length = 1020

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 298 cttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatcta 357
           ||||||||||||||  |||||||||||||    ||||||||| |||||  ||||||||||
Sbjct: 363 cttcatgtgccaggcgggcgacttcaccaaccacaacggcacaggcgggaagtccatcta 422

              
Query: 358 cgg 360
           |||
Sbjct: 423 cgg 425



to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
              sequence
          Length = 1438950

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 317    gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaag 367
              ||||| ||||||||| |||| ||||| || ||||||||||| |||||||||
Sbjct: 157435 gactttaccaggggcgacggaaccggtggagagtccatctatggcgagaag 157385



to top

>gb|AC091701.3| Trypanosoma brucei chromosome 8 clone RPCI93-26N11, complete sequence
          Length = 142253

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 74/87 (85%), Gaps = 2/87 (2%)
 Strand = Plus / Plus

                                                                         
Query: 185   gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243
             ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || ||
Sbjct: 76563 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 76621

                                        
Query: 244   gagcggcaagccgctgcactacaaggg 270
             ||| || ||||||||||| ||||||||
Sbjct: 76622 gagtggaaagccgctgcattacaaggg 76648



to top

>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence
          Length = 2481190

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 74/87 (85%), Gaps = 2/87 (2%)
 Strand = Plus / Plus

                                                                          
Query: 185    gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243
              ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || ||
Sbjct: 635476 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 635534

                                         
Query: 244    gagcggcaagccgctgcactacaaggg 270
              ||| || ||||||||||| ||||||||
Sbjct: 635535 gagtggaaagccgctgcattacaaggg 635561



to top

>gb|BC008451.1| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript
           variant 1, mRNA (cDNA clone MGC:14691 IMAGE:4134572),
           complete cds
          Length = 1307

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 584 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 630



to top

>gb|BC004898.2| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript
           variant 1, mRNA (cDNA clone MGC:3736 IMAGE:3545997),
           complete cds
          Length = 1273

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 571 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 617



to top

>gb|DQ160195.1| Homo sapiens cyclophilin-33B mRNA, complete cds, alternatively
           spliced
          Length = 1026

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 565 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 611



to top

>ref|XM_820486.1| Trypanosoma brucei TREU927 clone RPCI93-26N11 cyclophilin type
           peptidyl-prolyl cis-trans isomerase (Tb927.8.2000)
           partial mRNA
          Length = 906

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 74/87 (85%), Gaps = 2/87 (2%)
 Strand = Plus / Plus

                                                                       
Query: 185 gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243
           ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || ||
Sbjct: 262 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 320

                                      
Query: 244 gagcggcaagccgctgcactacaaggg 270
           ||| || ||||||||||| ||||||||
Sbjct: 321 gagtggaaagccgctgcattacaaggg 347



to top

>gb|AY231875.1| Drosophila yakuba clone yak-em_CG2852 mRNA sequence
          Length = 315

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 307 ccagggcggcgacttcaccaggggcaacggcaccggcgg 345
           ||||||||| |||||||||| |||| |||||||||||||
Sbjct: 6   ccagggcggagacttcaccaagggcgacggcaccggcgg 44



to top

>ref|XM_774688.1| Giardia lamblia ATCC 50803 cyclophilin (GLP_170_10820_10314)
           partial mRNA
          Length = 507

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335
           |||||||||||||||||||| | ||||||  |||||| || |||||||| |     ||||
Sbjct: 164 cgttccaccgcgtcatccccaagttcatgatccagggtggggacttcacgaaccataacg 223

                                      
Query: 336 gcaccggcggcgagtccatctacggcg 362
           |||| |||||| |||||||||| ||||
Sbjct: 224 gcactggcggcaagtccatctatggcg 250



to top

>emb|CR703044.2|CNS0G5F4 Tetraodon nigroviridis full-length cDNA
          Length = 1007

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 253 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 312

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 313 ggcgagaagtt 323



to top

>emb|CR700424.2|CNS0G3EC Tetraodon nigroviridis full-length cDNA
          Length = 1146

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 266 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 325

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 326 ggcgagaagtt 336



to top

>emb|CR698177.2|CNS0G1NX Tetraodon nigroviridis full-length cDNA
          Length = 975

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 235 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 294

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 295 ggcgagaagtt 305



to top

>emb|CR692157.2|CNS0FX0P Tetraodon nigroviridis full-length cDNA
          Length = 963

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 221 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 280

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 281 ggcgagaagtt 291



to top

>emb|CR693402.1|CNS0FXZA Tetraodon nigroviridis full-length cDNA
          Length = 970

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 235 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 294

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 295 ggcgagaagtt 305



to top

>emb|CR691999.2|CNS0FWWB Tetraodon nigroviridis full-length cDNA
          Length = 1015

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 264 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 323

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 324 ggcgagaagtt 334



to top

>emb|CR684939.2|CNS0FRG7 Tetraodon nigroviridis full-length cDNA
          Length = 1007

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 254 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 313

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 314 ggcgagaagtt 324



to top

>emb|CR684835.2|CNS0FRDB Tetraodon nigroviridis full-length cDNA
          Length = 1004

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358
           |||||||||||||| || ||||| ||||    |||||| || || ||| |||||||||||
Sbjct: 252 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 311

                      
Query: 359 ggcgagaagtt 369
           |||||||||||
Sbjct: 312 ggcgagaagtt 322



to top

>emb|AL049824.4|HSJ117L23 Human DNA sequence from clone RP1-117L23 on chromosome 1p33-34.2
            Contains part of the PPIE gene for peptidylprolyl
            isomerase E (cyclophilin E) and the 3' end of the BMP8B
            gene for bone morphogenetic protein 8b (osteogenic
            protein 2), complete sequence
          Length = 19783

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 278  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
            ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 9172 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 9218



to top

>emb|CR625617.1| full-length cDNA clone CS0DC021YB24 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1173

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 535 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 581



to top

>emb|CR617834.1| full-length cDNA clone XCL0BA001ZG09 of Placenta of Homo sapiens
           (human)
          Length = 1591

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 561 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 607



to top

>dbj|AK094660.1| Homo sapiens cDNA FLJ37341 fis, clone BRAMY2020713, highly similar to
            Homo sapiens peptidyl-prolyl cis-trans isomerase E (PPIE)
            mRNA
          Length = 2532

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 278  ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
            ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 1848 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 1894



to top

>emb|CR595696.1| full-length cDNA clone CS0DL005YD19 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 829

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324
           ||||||||| |||||||| | ||||||||||||||||| || |||||
Sbjct: 144 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 190


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,928,201
Number of Sequences: 3902068
Number of extensions: 1928201
Number of successful extensions: 55816
Number of sequences better than 10.0: 718
Number of HSP's better than 10.0 without gapping: 715
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 52110
Number of HSP's gapped (non-prelim): 3475
length of query: 369
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 347
effective length of database: 17,147,199,772
effective search space: 5950078320884
effective search space used: 5950078320884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top