| Clone Name | baet63c10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF262984.1|AF262984 Triticum aestivum cyclophilin A-3 (CyP3) mRNA, complete cds Length = 869 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Plus Query: 82 cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 141 ||||||||||||||| |||||||||||||||| |||||||||||||||||| || ||||| Sbjct: 52 cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 111 Query: 142 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 201 ||| ||||| || |||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 112 cgcgccggcggggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 171 Query: 202 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 172 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 231 Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 232 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 291 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 292 caccaggggcaacggcaccggaggcgagtccatctacggcgagaagtt 339
>gb|AF262982.1|AF262982 Triticum aestivum cyclophilin A-1 (CyP1) mRNA, complete cds Length = 859 Score = 476 bits (240), Expect = e-131 Identities = 276/288 (95%) Strand = Plus / Plus Query: 82 cccgatcccggcgagtgagatggccaacccgaaggtgttcttcgacatgacggtgggcgg 141 ||||||||||||||| |||||||||||||||| |||||||||||||||||| || ||||| Sbjct: 44 cccgatcccggcgagcgagatggccaacccgagggtgttcttcgacatgaccgtcggcgg 103 Query: 142 cgccccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtgga 201 ||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 104 cgcgccggccgggcgcatcgtgatggagctgtacaaggacgcggtgccgcggacggtgga 163 Query: 202 gaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 261 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 164 gaacttccgcgcgctgtgcaccggcgagaagggcgtcggcaagagcggcaagccgctgca 223 Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 224 ctacaagggcagcgccttccaccgcgtgatccccgacttcatgtgccagggcggcgactt 283 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 |||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 284 cacccggggcaacggcaccggcggcgagtccatctacggcgagaagtt 331
>gb|AF262983.1|AF262983 Triticum aestivum cyclophilin A-2 (CyP2) mRNA, complete cds Length = 845 Score = 468 bits (236), Expect = e-129 Identities = 263/272 (96%) Strand = Plus / Plus Query: 98 gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 157 |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| ||| Sbjct: 68 gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 127 Query: 158 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 217 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 128 atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 187 Query: 218 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 277 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 188 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 247 Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 248 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 307 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 |||||||||||||||||||||||||||||||| Sbjct: 308 accggcggcgagtccatctacggcgagaagtt 339
>gb|AY456122.1| Triticum aestivum cyclophilin A (CYP18-2) gene, complete cds Length = 781 Score = 468 bits (236), Expect = e-129 Identities = 263/272 (96%) Strand = Plus / Plus Query: 98 gagatggccaacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgc 157 |||||||||||||||| |||||||||||||||||| || |||||||| |||||||| ||| Sbjct: 32 gagatggccaacccgagggtgttcttcgacatgaccgtcggcggcgcgccggccgggcgc 91 Query: 158 atcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctc 217 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 92 atcgtgatggagctgtacaaggacgcggtgccgcggacggtggagaacttccgcgcgctc 151 Query: 218 tgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcg 277 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 152 tgcaccggcgagaagggcgtcggcaagagcggcaagccactgcactacaagggcagctcg 211 Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 212 ttccaccgcgtgatccccgacttcatgtgccagggcggcgacttcaccaagggcaacggc 271 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 |||||||||||||||||||||||||||||||| Sbjct: 272 accggcggcgagtccatctacggcgagaagtt 303
>ref|XM_463914.1| Oryza sativa (japonica cultivar-group), mRNA Length = 885 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 348 ctacggcgagaagtt 362
>ref|XM_506694.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0088N06.23 mRNA Length = 887 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 349 ctacggcgagaagtt 363
>gb|BT016412.1| Zea mays clone Contig245 mRNA sequence Length = 858 Score = 283 bits (143), Expect = 2e-73 Identities = 224/251 (89%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||| Sbjct: 82 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 141 Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| Sbjct: 142 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 201 Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298 |||||| ||| |||||||| |||||||||||| | | |||||||||||||||||||| Sbjct: 202 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 261 Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 262 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 321 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 322 ggcgagaagtt 332
>gb|DQ480736.1| Oryza sativa (indica cultivar-group) cyclophilinA mRNA, complete cds Length = 588 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 25 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 84 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 85 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 144 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 145 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 204 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 205 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 264 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 265 ctacggcgagaagtt 279
>emb|X68678.1|ZMCYCL Z.mays gene for cyclophilin Length = 2598 Score = 283 bits (143), Expect = 2e-73 Identities = 224/251 (89%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||| Sbjct: 1080 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 1139 Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| Sbjct: 1140 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 1199 Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298 |||||| ||| |||||||| |||||||||||| | | |||||||||||||||||||| Sbjct: 1200 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 1259 Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 1260 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 1319 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 1320 ggcgagaagtt 1330
>dbj|AK061894.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G07, full insert sequence Length = 887 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 228 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 349 ctacggcgagaagtt 363
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 1116174 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1116233 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1116234 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1116293 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 1116294 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1116353 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 1116354 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1116413 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 1116414 ctacggcgagaagtt 1116428 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 |||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 32066599 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 32066643 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 ccggcgagaagggcgtcggc 241 |||||||||||||||||||| Sbjct: 7760546 ccggcgagaagggcgtcggc 7760565
>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1020_C02 Length = 124578 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 68698 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 68757 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 68758 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 68817 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 68818 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 68877 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 68878 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 68937 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 68938 ctacggcgagaagtt 68952
>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0088N06 Length = 123454 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 104882 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 104941 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 104942 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 105001 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 105002 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 105061 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 105062 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 105121 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 105122 ctacggcgagaagtt 105136
>dbj|AK098919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N03, full insert sequence Length = 885 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 108 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 167 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 168 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 227 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 228 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 287 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 288 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 347 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 348 ctacggcgagaagtt 362
>gb|M55021.1|MZECYP Zea mays cyclophilin (CyP) mRNA, complete cds Length = 792 Score = 283 bits (143), Expect = 2e-73 Identities = 224/251 (89%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178 |||||||||||||| || |||||||||||||| ||||| |||||||||||||||||| Sbjct: 43 ttcttcgacatgaccgtcggcggcgccccggcgggccggatcgtgatggagctgtacgcc 102 Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| Sbjct: 103 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 162 Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298 |||||| ||| |||||||| |||||||||||| | | |||||||||||||||||||| Sbjct: 163 ggcaagtccgggaagccgctccactacaagggctccaccttccaccgcgtcatccccgag 222 Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 223 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 282 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 283 ggcgagaagtt 293
>gb|L29470.1|RICCYP2R Oryza sativa cyclophilin 2 (Cyp2) mRNA, complete cds Length = 824 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 53 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 112 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 113 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 172 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 173 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 232 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 233 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 292 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 293 ctacggcgagaagtt 307
>gb|L29469.1|RICCYP2G Oryza sativa cyclophilin 2 (Cyp2) gene, complete cds Length = 2323 Score = 283 bits (143), Expect = 2e-73 Identities = 227/255 (89%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 1164 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 1223 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 1224 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaggg 1283 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 1284 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 1343 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 1344 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 1403 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 1404 ctacggcgagaagtt 1418
>gb|AF263544.1| Oryza sativa clone 20CAC microsatellite sequence Length = 905 Score = 276 bits (139), Expect = 5e-71 Identities = 226/255 (88%) Strand = Plus / Plus Query: 115 ggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgta 174 |||||||||||||||||| || ||||| || ||||| || || ||||||||||||||||| Sbjct: 109 ggtgttcttcgacatgaccgtcggcggagctccggcggggcggatcgtgatggagctgta 168 Query: 175 caaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg 234 | | | | |||||| |||||| ||||||||||||||||||||||||||||||||| || Sbjct: 169 cgcgaaggacgtgccgcggacggcggagaacttccgcgcgctctgcaccggcgagaaagg 228 Query: 235 cgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccc 294 ||| |||||||||||||||||||||||||||||||| ||| | ||||||||||| ||||| Sbjct: 229 cgtgggcaagagcggcaagccgctgcactacaaggggagcaccttccaccgcgtgatccc 288 Query: 295 cgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccat 354 || ||||||||||||||||||||||||||| | ||||||||||| || || ||||| || Sbjct: 289 ggagttcatgtgccagggcggcgacttcacccgcggcaacggcacgggaggggagtcgat 348 Query: 355 ctacggcgagaagtt 369 ||||||||||||||| Sbjct: 349 ctacggcgagaagtt 363
>gb|BT017873.1| Zea mays clone EL01N0513A10.c mRNA sequence Length = 978 Score = 260 bits (131), Expect = 3e-66 Identities = 221/251 (88%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178 |||||||||||||| || ||||| ||||| |||||||| |||||||||||||||||| Sbjct: 183 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagctgtacgcc 242 Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| Sbjct: 243 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 302 Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298 |||||| ||| |||||||| |||||||||||| | |||||||||||||||||| | Sbjct: 303 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 362 Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 363 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 422 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 423 ggcgagaagtt 433
>gb|BT016413.1| Zea mays clone Contig246 mRNA sequence Length = 868 Score = 252 bits (127), Expect = 7e-64 Identities = 220/251 (87%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagctgtacaag 178 |||||||||||||| || ||||| ||||| |||||||| ||||||||||||| |||| Sbjct: 67 ttcttcgacatgaccgtcggcggtgccccagccggccggatcgtgatggagccgtacgcc 126 Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 ||| |||||| | ||| | |||||||||||||||||| ||||| |||||||||||||| Sbjct: 127 aacgaggtgcccaagaccgcggagaacttccgcgcgctgtgcacgggcgagaagggcgtg 186 Query: 239 ggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgac 298 |||||| ||| |||||||| |||||||||||| | |||||||||||||||||| | Sbjct: 187 ggcaagtccgggaagccgctccactacaagggctctaccttccaccgcgtcatcccccag 246 Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct: 247 ttcatgtgccagggcggcgacttcacccgcggcaacggcaccggcggcgagtccatctac 306 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 307 ggcgagaagtt 317
>gb|AF384147.1|AF384147 Triticum aestivum cyclophilin mRNA, partial cds Length = 430 Score = 226 bits (114), Expect = 4e-56 Identities = 132/138 (95%) Strand = Plus / Plus Query: 232 gggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgcgtcat 291 |||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||| || Sbjct: 12 gggcgtgggcaagagcggcaagccgctgcactacaaggggagcgcgttccaccgcgtgat 71 Query: 292 ccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtc 351 ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| Sbjct: 72 ccccgacttcatgtgccagggcggcgacttcaccaggggcaacgggacgggcggcgagtc 131 Query: 352 catctacggcgagaagtt 369 |||||||||||||||||| Sbjct: 132 catctacggcgagaagtt 149
>gb|AF052206.2| Chlamydomonas reinhardtii cyclophilin 1 (cyp1) mRNA, complete cds Length = 985 Score = 170 bits (86), Expect = 2e-39 Identities = 185/218 (84%) Strand = Plus / Plus Query: 152 ggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgc 211 |||||||||| ||||||||||||| |||| ||||| | ||| | ||||||||||||| Sbjct: 74 ggccgcatcgagatggagctgtacgccgacgacgtgcccaagaccgcggagaacttccgc 133 Query: 212 gcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggc 271 || || |||||||||||||||||||| ||| |||||||| ||||||| ||||||| Sbjct: 134 gccctgtgcaccggcgagaagggcgttggccgctctggcaagcccctgcacttcaagggc 193 Query: 272 agctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggc 331 | | |||||||| || |||||| ||||||||||||||||||| ||||||||| | ||| Sbjct: 194 tccaccttccaccgtgtgatccccaacttcatgtgccagggcggtgacttcacccgcggc 253 Query: 332 aacggcaccggcggcgagtccatctacggcgagaagtt 369 ||||||||||| || ||||||||||||||||||||||| Sbjct: 254 aacggcaccggtggtgagtccatctacggcgagaagtt 291
>gb|AF424658.1| Phytophthora infestans clone MY-08-C-01 peptidylprolyl isomerase mRNA, complete cds Length = 700 Score = 165 bits (83), Expect = 1e-37 Identities = 218/263 (82%) Strand = Plus / Plus Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166 |||||| ||||||| ||||||||||| || || || ||||| || ||||| ||| | | Sbjct: 45 aacccgcaggtgtttttcgacatgaccgttggtggtgcccccgctggccgtatcacgttc 104 Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226 ||||||| | ||| |||||||| ||||| |||||||||||||| || ||||| ||| Sbjct: 105 gagctgttcgccgacaaggtgccgaagacggctgagaacttccgcgctctttgcacaggc 164 Query: 227 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 286 ||||||||||| ||| |||||||| ||||||| |||||||||||| |||||||| Sbjct: 165 gagaagggcgtgggccgttcgggcaagcccctgcacttcaagggcagctctttccaccgt 224 Query: 287 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 346 || |||||| |||| ||||||||||||||||||||||| | || |||||||| ||||| Sbjct: 225 gtgatccccaactttatgtgccagggcggcgacttcacgcgtggtaacggcacgggcggt 284 Query: 347 gagtccatctacggcgagaagtt 369 ||||||||||||||||||||||| Sbjct: 285 gagtccatctacggcgagaagtt 307
>dbj|AK062540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-G01, full insert sequence Length = 749 Score = 161 bits (81), Expect = 2e-36 Identities = 153/177 (86%) Strand = Plus / Plus Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaa 252 |||||| ||||||||||||||||||||||| |||||||||||| | ||||||| ||||| Sbjct: 204 gacggtcgagaacttccgcgcgctctgcacgggcgagaagggcatgggcaagaagggcaa 263 Query: 253 gccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccaggg 312 |||||| ||||||||||||||| | ||||||||| | |||||| |||| ||| |||||| Sbjct: 264 gccgctccactacaagggcagcactttccaccgcattatccccaactttatgatccaggg 323 Query: 313 cggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||| ||||| || |||||||||| ||||||||||| ||||||||||||||||| Sbjct: 324 cggtgactttacggacggcaacggcatgggcggcgagtcgatctacggcgagaagtt 380
>gb|AY105212.1| Zea mays PCO124469 mRNA sequence Length = 886 Score = 151 bits (76), Expect = 2e-33 Identities = 103/112 (91%) Strand = Plus / Plus Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310 ||||||||||||||||||||| | ||||||||||||||||| | ||||||||||||| Sbjct: 415 aagccgctgcactacaagggctcggccttccaccgcgtcatcccgggcttcatgtgccag 474 Query: 311 ggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||| ||||||||||||| |||||||||||||||||||||| Sbjct: 475 ggcggcgacttcacccggggcaacggcacgggcggcgagtccatctacggcg 526
>gb|AY705800.1| Pinus halepensis clone 17r cyclophilin mRNA, complete cds Length = 1080 Score = 149 bits (75), Expect = 7e-33 Identities = 216/263 (82%) Strand = Plus / Plus Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166 ||||| ||||| ||||| || ||| ||| ||||| ||||| |||||||| ||||||||| Sbjct: 88 aacccaaaggttttctttgatatgcaggtcggcggtgccccagccggccggatcgtgatg 147 Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226 ||||| || ||| | |||||||| ||||| ||||||||||||||| | || |||||| Sbjct: 148 gagctctatgcggatgtggtgccgaagacggctgagaacttccgcgcgttgtgtaccggc 207 Query: 227 gagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagctcgttccaccgc 286 ||||| ||| |||| |||||||| ||||||| |||||| |||||||||||| Sbjct: 208 gagaaaggcaccggccgctcaggcaagcctctgcacttcaagggttcgtcgttccaccgc 267 Query: 287 gtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggc 346 || ||||| | ||||||||||||||||| |||||||| ||||||||||| ||||| || Sbjct: 268 gtgatcccagggttcatgtgccagggcggtgacttcacaaggggcaacggtaccggtgga 327 Query: 347 gagtccatctacggcgagaagtt 369 ||||| ||||||||||||||||| Sbjct: 328 gagtctatctacggcgagaagtt 350
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 145 bits (73), Expect = 1e-31 Identities = 130/149 (87%) Strand = Plus / Plus Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274 ||||||||||||||||||||| ||||| ||||||||||||||| |||||||| Sbjct: 22509020 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 22509079 Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334 | |||||||| |||| ||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 22509080 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 22509139 Query: 335 ggcaccggcggcgagtccatctacggcga 363 ||||||||||||||||||||||||||||| Sbjct: 22509140 ggcaccggcggcgagtccatctacggcga 22509168 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 72 cgatcccgatcccgatcccg 91 |||||||||||||||||||| Sbjct: 392141 cgatcccgatcccgatcccg 392160
>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1331F11 Length = 132205 Score = 145 bits (73), Expect = 1e-31 Identities = 130/149 (87%) Strand = Plus / Plus Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274 ||||||||||||||||||||| ||||| ||||||||||||||| |||||||| Sbjct: 24221 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 24280 Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334 | |||||||| |||| ||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 24281 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 24340 Query: 335 ggcaccggcggcgagtccatctacggcga 363 ||||||||||||||||||||||||||||| Sbjct: 24341 ggcaccggcggcgagtccatctacggcga 24369
>dbj|AK103109.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119A20, full insert sequence Length = 757 Score = 145 bits (73), Expect = 1e-31 Identities = 130/149 (87%) Strand = Plus / Plus Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274 ||||||||||||||||||||| ||||| ||||||||||||||| |||||||| Sbjct: 186 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 245 Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334 | |||||||| |||| ||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 246 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 305 Query: 335 ggcaccggcggcgagtccatctacggcga 363 ||||||||||||||||||||||||||||| Sbjct: 306 ggcaccggcggcgagtccatctacggcga 334
>gb|L29471.1|RICCYP1R Oryza sativa cyclophilin 1 (Cyp1) mRNA, complete cds Length = 590 Score = 145 bits (73), Expect = 1e-31 Identities = 130/149 (87%) Strand = Plus / Plus Query: 215 ctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaagggcagc 274 ||||||||||||||||||||| ||||| ||||||||||||||| |||||||| Sbjct: 167 ctctgcaccggcgagaagggcctcggcgcctccggcaagccgctgcattacaagggttct 226 Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334 | |||||||| |||| ||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 227 gccttccaccgtatcatacccaacttcatgtgccagggcggcgacttcacccgcggcaac 286 Query: 335 ggcaccggcggcgagtccatctacggcga 363 ||||||||||||||||||||||||||||| Sbjct: 287 ggcaccggcggcgagtccatctacggcga 315
>emb|Y08320.1|DLCYCLO D.lanata mRNA for cyclophilin Length = 765 Score = 141 bits (71), Expect = 2e-30 Identities = 140/163 (85%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| |||||||| |||||||| ||||||||||| | |||||||||||| Sbjct: 146 gagaacttccgcgctctctgcactggcgagaaaggcgtcggcaaaaccggcaagccgctc 205 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 |||||||| ||| |||| |||||||| ||||||| |||||||||||||| |||||| Sbjct: 206 cactacaaaggctcggcgtttcaccgcgtgatccccgggttcatgtgccagggaggcgac 265 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 |||||| || ||||||||||| ||||| || |||||||||| Sbjct: 266 ttcaccgccggaaacggcaccggaggcgaatctatctacggcg 308
>dbj|AK105186.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D12, full insert sequence Length = 682 Score = 141 bits (71), Expect = 2e-30 Identities = 146/171 (85%) Strand = Plus / Plus Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgct 258 |||||||||||||||||| ||||| |||||||||||| | ||| ||||||||||| Sbjct: 154 ggagaacttccgcgcgctttgcacgggcgagaagggcattggccgctcgggcaagccgct 213 Query: 259 gcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318 |||| ||||||| ||||||||||| || |||||| ||||||||||||||||||| || Sbjct: 214 ccacttcaagggctcgtcgttccaccgtgtgatccccaacttcatgtgccagggcggtga 273 Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 |||||| | ||||||||||| ||||||||||| || |||||||||||||| Sbjct: 274 cttcacgcgcggcaacggcacgggcggcgagtcgatttacggcgagaagtt 324
>dbj|AB020612.1| Vigna radiata mRNA for CYP1, complete cds Length = 823 Score = 135 bits (68), Expect = 1e-28 Identities = 142/164 (86%), Gaps = 2/164 (1%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| ||||||||||| |||||||| ||||| | ||||||||||||||| Sbjct: 138 gagaacttccgcgctctctgcaccggtgagaagggagtcggtaggagcggcaagccgctc 197 Query: 260 cactacaagggc-agctcgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318 |||||||||||| | || |||||||| || ||||| ||||||||||||| || ||||| Sbjct: 198 cactacaagggctcgatc-ttccaccgtgtgatcccgaacttcatgtgccaaggaggcga 256 Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 ||||||| || |||||||| ||||||||||| |||||||||| Sbjct: 257 cttcaccgccggaaacggcacaggcggcgagtcgatctacggcg 300
>gb|AY109901.1| Zea mays CL2214_-5 mRNA sequence Length = 636 Score = 129 bits (65), Expect = 7e-27 Identities = 84/92 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||| | ||||||||||||||||||||||||||| | ||||||||| Sbjct: 33 ttccaccgcgtcatnnnnnagttcatgtgccagggcggcgacttcacccgcggcaacggc 92 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 |||||||||||||||||||||||||||||||| Sbjct: 93 accggcggcgagtccatctacggcgagaagtt 124
>emb|Y08273.1|DLCYP18 D.lanata CYP18 gene Length = 1363 Score = 119 bits (60), Expect = 7e-24 Identities = 135/160 (84%) Strand = Plus / Plus Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcac 262 ||||||||||| ||||||||||| ||||| ||||| |||||| |||||||||||| ||| Sbjct: 611 aacttccgcgctctctgcaccggtgagaaaggcgtaggcaagtccggcaagccgctccac 670 Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 ||||| ||| |||||||||| || ||||||| |||||||| ||||||||||| ||| Sbjct: 671 tacaaaggctcggcgttccaccgagtgatccccgggttcatgtgtcagggcggcgatttc 730 Query: 323 accaggggcaacggcaccggcggcgagtccatctacggcg 362 ||| || ||||||||||| ||||| || |||||||||| Sbjct: 731 accgctggaaacggcaccggaggcgaatcgatctacggcg 770
>gb|AF456323.1|AF456323 Glycine max cyclophilin (Cyp) mRNA, complete cds Length = 873 Score = 119 bits (60), Expect = 7e-24 Identities = 129/152 (84%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||||||||||||||| |||||||||||||||||||| || |||||||||||| || Sbjct: 168 gagaacttccgcgcgctttgcaccggcgagaagggcgtagggcggagcggcaagcccctc 227 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 |||||||||||| || ||||||||||| ||||| |||||||| ||||| |||||| Sbjct: 228 cactacaagggctcgtccttccaccgcgtgatcccgagtttcatgtgtcagggtggcgac 287 Query: 320 ttcaccaggggcaacggcaccggcggcgagtc 351 |||||| || ||||| |||||||||||||| Sbjct: 288 ttcaccgccggaaacggaaccggcggcgagtc 319 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 ggccgcatcgtgatggagct 171 |||||||||||||||||||| Sbjct: 120 ggccgcatcgtgatggagct 139
>gb|DQ066345.1| Ixodes scapularis isolate IS-6-12-J-cluster-190 cyclophilin A mRNA, complete cds Length = 498 Score = 117 bits (59), Expect = 3e-23 Identities = 95/107 (88%) Strand = Plus / Plus Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||||||| |||||||| ||||||||| |||||||||||||||| || |||||| Sbjct: 142 tacaagggcagcattttccaccgagtcatccccaacttcatgtgccagggaggagacttc 201 Query: 323 accaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||| || ||||||||| |||||| |||||||||||||||||||||| Sbjct: 202 acccggcacaacggcacgggcggcaagtccatctacggcgagaagtt 248 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Plus Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcgg 240 ||||||||||| || |||||||||||||||||| |||| Sbjct: 103 aacttccgcgccctgtgcaccggcgagaagggcttcgg 140
>gb|AY456123.1| Triticum aestivum cyclophilin A (CYP18-1) gene, partial cds Length = 519 Score = 113 bits (57), Expect = 4e-22 Identities = 60/61 (98%) Strand = Plus / Plus Query: 309 agggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagt 368 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 agggcggcgacttcacccggggcaacggcaccggcggcgagtccatctacggcgagaagt 60 Query: 369 t 369 | Sbjct: 61 t 61
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 159821 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 159762 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 159761 actggcggcaagtccatctacggc 159738 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Minus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 159878 gagaacttccgcgccttgtgcaccggcgagaaggg 159844
>gb|AC010846.13| Drosophila melanogaster clone BACR13G13, complete sequence Length = 192540 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 62385 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 62326 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 62325 actggcggcaagtccatctacggc 62302 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Minus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 62442 gagaacttccgcgccttgtgcaccggcgagaaggg 62408
>gb|AY232025.1| Drosophila yakuba clone yak-ad_Cyp1 mRNA sequence Length = 456 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 160 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 219 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 220 actggcggcaagtccatctacggc 243 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 103 gagaacttccgcgccttgtgcaccggcgagaaggg 137
>gb|AY231912.1| Drosophila yakuba clone yak-em_Cyp1 mRNA sequence Length = 399 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 64 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 123 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 124 actggcggcaagtccatctacggc 147 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 7 gagaacttccgcgccttgtgcaccggcgagaaggg 41
>gb|BT009946.1| Drosophila melanogaster SD01793 full insert cDNA Length = 796 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 294 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 353 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 354 actggcggcaagtccatctacggc 377 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 237 gagaacttccgcgccttgtgcaccggcgagaaggg 271
>ref|NM_078642.3| Drosophila melanogaster Cyclophilin 1 CG9916-RA (Cyp1), mRNA Length = 1269 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 422 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 481 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 482 actggcggcaagtccatctacggc 505 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 365 gagaacttccgcgccttgtgcaccggcgagaaggg 399
>gb|AE003501.4| Drosophila melanogaster chromosome X, section 53 of 74 of the complete sequence Length = 323840 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Minus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 309493 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 309434 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 309433 actggcggcaagtccatctacggc 309410 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Minus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 309550 gagaacttccgcgccttgtgcaccggcgagaaggg 309516
>gb|AY456124.1| Triticum aestivum cyclophilin A (CYP18-3) gene, partial cds Length = 494 Score = 111 bits (56), Expect = 2e-21 Identities = 59/60 (98%) Strand = Plus / Plus Query: 310 gggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 1 gggcggcgacttcaccaggggcaacggcaccggaggcgagtccatctacggcgagaagtt 60
>gb|M62398.1|DROCYP1 Drosophila melanogaster CYP-1 protein mRNA, complete cds Length = 707 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 192 ttccaccgcgtcatccccaacttcatgtgccagggcggcgacttcaccaaccacaacggc 251 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 252 actggcggcaagtccatctacggc 275 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| | ||||||||||||||||| Sbjct: 135 gagaacttccgcgccttgtgcaccggcgagaaggg 169
>gb|AF055990.1|AF055990 Fucus distichus cyclophilin mRNA, partial cds Length = 417 Score = 109 bits (55), Expect = 6e-21 Identities = 82/91 (90%) Strand = Plus / Plus Query: 279 tccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggca 338 |||||||||| ||||| ||||||||||||||||| ||||||||||| | || ||||| | Sbjct: 1 tccaccgcgtgatcccggacttcatgtgccagggtggcgacttcactcgtggaaacggta 60 Query: 339 ccggcggcgagtccatctacggcgagaagtt 369 |||||||||||||||||||||| |||||||| Sbjct: 61 ccggcggcgagtccatctacggggagaagtt 91
>ref|XM_366228.1| Magnaporthe grisea 70-15 hypothetical protein (MG10447.4) partial mRNA Length = 648 Score = 103 bits (52), Expect = 4e-19 Identities = 82/92 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||||| Sbjct: 307 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 366 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||| ||| ||||| |||||||||||||||| Sbjct: 367 accggtggcaagtccgtctacggcgagaagtt 398
>dbj|AB062457.1| Magnaporthe grisea CYP1 mRNA for cyclophilin, complete cds Length = 775 Score = 103 bits (52), Expect = 4e-19 Identities = 82/92 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||||| Sbjct: 210 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacggc 269 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||| ||| ||||| |||||||||||||||| Sbjct: 270 accggtggcaagtccgtctacggcgagaagtt 301
>gb|AF178458.1|AF178458 Lupinus luteus cytosolic cyclophilin gene, complete cds Length = 1968 Score = 99.6 bits (50), Expect = 6e-18 Identities = 107/126 (84%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||||||||| || |||||||||||||||||||| |||||| ||||||||||| || Sbjct: 1198 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 1257 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 || |||||||| | | ||||||||||| ||||| ||||||||||||||||||| || Sbjct: 1258 cattacaagggatccaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 1317 Query: 320 ttcacc 325 |||||| Sbjct: 1318 ttcacc 1323 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 149 gccggccgcatcgtgatggagctgtac 175 |||||||||||||| |||||||||||| Sbjct: 1147 gccggccgcatcgtcatggagctgtac 1173
>gb|DQ012959.1| Streptomyces antibioticus strain ETH7451 cyclophilin gene, partial cds Length = 393 Score = 99.6 bits (50), Expect = 6e-18 Identities = 83/94 (88%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||||||||| |||||||| ||||||||||||||| ||| ||||||| Sbjct: 110 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttacccaaggcaacg 169 Query: 336 gcaccggcggcgagtccatctacggcgagaagtt 369 ||||||||||| || |||||||||||||||||| Sbjct: 170 gcaccggcggcaagagcatctacggcgagaagtt 203
>emb|Z15137.1|SCCYCLOA Streptomyces chrysomallus orfA, estA, cypA genes Length = 3538 Score = 95.6 bits (48), Expect = 1e-16 Identities = 81/92 (88%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||||||| | ||||||||| ||||||||||||||||||| | || ||||| Sbjct: 2587 ttccaccgcgtcatcacggacttcatgctccagggcggcgacttcacccgcggtgacggc 2646 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||||||| || |||||||||||||||||| Sbjct: 2647 accggcggcaagagcatctacggcgagaagtt 2678 Score = 65.9 bits (33), Expect = 9e-08 Identities = 45/49 (91%) Strand = Plus / Plus Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||| ||||||||||||||||||| |||||||||||||||| ||||| Sbjct: 2523 gacggcggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 2571
>ref|XM_323171.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563) peptidyl-prolyl cis-trans isomerase [Neurospora crassa OR74A] ) (NCU03853.1) partial mRNA Length = 1128 Score = 93.7 bits (47), Expect = 4e-16 Identities = 134/163 (82%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| | ||||||||||||||||| || |||||| ||||||||||| Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 ||||||||||| | |||||||||| |||||| | |||||| |||||| || ||| Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 |||||| || |||||||| || ||||||||||||||||||| Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 286
>ref|XM_950770.1| Neurospora crassa OR74A hypothetical protein ( (AJ292563) peptidyl-prolyl cis-trans isomerase [Neurospora crassa OR74A] ) (NCU03853.1) partial mRNA Length = 1128 Score = 93.7 bits (47), Expect = 4e-16 Identities = 134/163 (82%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| | ||||||||||||||||| || |||||| ||||||||||| Sbjct: 124 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 183 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 ||||||||||| | |||||||||| |||||| | |||||| |||||| || ||| Sbjct: 184 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 243 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 |||||| || |||||||| || ||||||||||||||||||| Sbjct: 244 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 286
>emb|AJ292563.1|NCR292563 Neurospora crassa mRNA for cyclophilin41 Length = 1632 Score = 93.7 bits (47), Expect = 4e-16 Identities = 134/163 (82%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| | ||||||||||||||||| || |||||| ||||||||||| Sbjct: 359 gagaacttccgcgctttgtgcaccggcgagaagggtgttggcaagttgggcaagccgcta 418 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 ||||||||||| | |||||||||| |||||| | |||||| |||||| || ||| Sbjct: 419 cactacaagggttccacgttccaccgtgtcatcaagcagttcatgatccagggtggtgac 478 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 |||||| || |||||||| || ||||||||||||||||||| Sbjct: 479 ttcaccgctggaaacggcactggtggcgagtccatctacggcg 521
>emb|Y13576.1|LMCYCL Leishmania major mRNA for cyclophilin Length = 2165 Score = 91.7 bits (46), Expect = 1e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 |||||||||| || ||||| || |||||||||||||| || |||||||||| ||||||| Sbjct: 312 cgttccaccgtgtgatcccggatttcatgtgccagggtggtgacttcaccaacggcaacg 371 Query: 336 gcaccggcggcgagtccatctacggc 361 |||| |||||| |||||||||||||| Sbjct: 372 gcactggcggcaagtccatctacggc 397 Score = 61.9 bits (31), Expect = 1e-06 Identities = 67/79 (84%) Strand = Plus / Plus Query: 163 gatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 222 ||||||||| | ||||||||| || || ||||| ||||||||||||||||| ||||| Sbjct: 220 gatggagctcttcaaggacgccgttccccagacggccgagaacttccgcgcgctgtgcac 279 Query: 223 cggcgagaagggcgtcggc 241 |||||||||||| ||||| Sbjct: 280 gggcgagaagggcttcggc 298
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Minus Query: 184 ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 5950025 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 5949968
>dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0024N18 Length = 128739 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Minus Query: 184 ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 71677 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 71620
>emb|Y16088.1|LLCYCLOPH Lupinus luteus mRNA for cyclophilin Length = 758 Score = 91.7 bits (46), Expect = 1e-15 Identities = 106/126 (84%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||||||||| || |||||||||||||||||||| |||||| ||||||||||| || Sbjct: 129 gagaacttccgtgccctctgcaccggcgagaagggagtcggccgcagcggcaagccactc 188 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 || |||||||| | ||||||||||| ||||| ||||||||||||||||||| || Sbjct: 189 cattacaagggatcgaccttccaccgcgtgatccctaacttcatgtgccagggcggtgat 248 Query: 320 ttcacc 325 |||||| Sbjct: 249 ttcacc 254 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 149 gccggccgcatcgtgatggagctgtac 175 |||||||||||||| |||||||||||| Sbjct: 78 gccggccgcatcgtcatggagctgtac 104
>dbj|AK068112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013134M21, full insert sequence Length = 1633 Score = 91.7 bits (46), Expect = 1e-15 Identities = 55/58 (94%) Strand = Plus / Plus Query: 184 ggtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 299 ggtgccgcggacggcggagaacttccgcgcgctctgcaccggggagaagggcgtcggc 356
>gb|DQ012958.1| Streptomyces antibioticus strain ATCC 11891 cyclophilin gene, partial cds Length = 457 Score = 91.7 bits (46), Expect = 1e-15 Identities = 86/97 (88%), Gaps = 3/97 (3%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt-ca--ccaggggca 332 ||||||||||||||||||| |||||||| ||||||||||||||| || |||||| || Sbjct: 107 cgttccaccgcgtcatcccgaacttcatgctccagggcggcgactttcaacccagggtca 166 Query: 333 acggcaccggcggcgagtccatctacggcgagaagtt 369 |||||||||||||| || |||||||||||||||||| Sbjct: 167 acggcaccggcggcaagagcatctacggcgagaagtt 203
>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV, complete sequence Length = 1466886 Score = 89.7 bits (45), Expect = 6e-15 Identities = 81/93 (87%) Strand = Plus / Minus Query: 277 gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 336 |||||||||||| ||| | ||||||||||||| |||||||||||||| ||| |||| Sbjct: 867232 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 867173 Query: 337 caccggcggcgagtccatctacggcgagaagtt 369 ||| || |||||||||||||||||||||||||| Sbjct: 867172 cacgggtggcgagtccatctacggcgagaagtt 867140
>ref|NM_209536.1| Eremothecium gossypii ADR087Cp (ADR087C), mRNA Length = 1110 Score = 89.7 bits (45), Expect = 6e-15 Identities = 81/93 (87%) Strand = Plus / Plus Query: 277 gttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacgg 336 |||||||||||| ||| | ||||||||||||| |||||||||||||| ||| |||| Sbjct: 186 gttccaccgcgtgatcaagggcttcatgtgccagttcggcgacttcaccaacggcgacgg 245 Query: 337 caccggcggcgagtccatctacggcgagaagtt 369 ||| || |||||||||||||||||||||||||| Sbjct: 246 cacgggtggcgagtccatctacggcgagaagtt 278
>gb|AF542516.1| Beauveria bassiana cyclophilin A mRNA, complete cds Length = 705 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||||||||||| |||||||||||||||||| || ||||| | |||||| Sbjct: 196 ttccaccgcgtcatccccggcttcatgtgccagggcggtgatttcacgaaccataacggc 255 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||||||||||||||| Sbjct: 256 actggtggcaagtccatctacggcgagaagtt 287 Score = 61.9 bits (31), Expect = 1e-06 Identities = 34/35 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| |||||||||||||||||||| Sbjct: 139 gagaacttccgcgctctctgcaccggcgagaaggg 173
>emb|AJ862840.1| Streptomyces griseus subsp. griseus streptomycin gene cluster, strain DSM 40236 Length = 90600 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| |||||| ||||||||||| |||||||||||||||||| | || ||||| Sbjct: 55880 ttccaccgtgtcatcaccgacttcatgcttcagggcggcgacttcacccgcggtgacggc 55939 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||||||| || |||||||||||||||||| Sbjct: 55940 accggcggcaagagcatctacggcgagaagtt 55971 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||||||||||||||||| |||||||||||||||| ||||| Sbjct: 55822 ggagaacttccgcgcgctcgccaccggcgagaagggcttcggc 55864
>emb|AJ271126.1|PAB271126 Picea abies mRNA for putative cyclosporin A-binding protein, (pPA0005 gene) Length = 1026 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||| ||||| | ||||||||||| |||||||||||||| | || ||||| Sbjct: 279 ttccaccgcgtgatcccagggttcatgtgccaaggcggcgacttcacgcgtggtaacggt 338 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 |||||||| ||||| ||||||||||||||||| Sbjct: 339 accggcggggagtcgatctacggcgagaagtt 370 Score = 87.7 bits (44), Expect = 2e-14 Identities = 104/124 (83%) Strand = Plus / Plus Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166 ||||| ||||| ||||| |||||| ||| ||||||||||| |||||||| ||||||||| Sbjct: 108 aacccaaaggttttctttgacatgcaggtcggcggcgccccagccggccggatcgtgatg 167 Query: 167 gagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggc 226 ||||| ||| || | |||||||| ||||| |||||||| || ||||| ||||||||| Sbjct: 168 gagctctacgccgatgtggtgccgaagacggccgagaactttcgtgcgctgtgcaccggc 227 Query: 227 gaga 230 |||| Sbjct: 228 gaga 231
>dbj|AB231815.1| Malassezia yamatoensis CYP mRNA for cyclophilin, partial cds Length = 423 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| || ||||||||||||||| ||||||||| ||||||||| ||||||||| Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgccggcaacggc 210 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || |||||| |||| ||||||||| ||||||| Sbjct: 211 acgggcggcaagtcgatctacggccagaagtt 242
>dbj|AB231812.1| Malassezia obtusa CYP mRNA for cyclophilin, partial cds Length = 486 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| || ||||||||||||||| ||||||||| ||||||||| ||||||||| Sbjct: 151 ttccaccgtgtgatccccgacttcatgctccagggcggtgacttcaccgctggcaacggc 210 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || |||||| |||| ||||||||| ||||||| Sbjct: 211 actggcggcaagtcgatctacggccagaagtt 242
>ref|NM_166539.1| Drosophila melanogaster CG2852-RB, transcript variant B (CG2852), mRNA Length = 759 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 166 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 225 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 226 caccaagggcgacggcaccggcggtcgctccatctacggcgag 268
>ref|NM_137851.2| Drosophila melanogaster CG2852-RA, transcript variant A (CG2852), mRNA Length = 887 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393
>gb|AC008350.4|AC008350 Drosophila melanogaster, chromosome 2R, region 58E-59A, BAC clone BACR11M08, complete sequence Length = 169534 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 41299 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 41240 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 41239 caccaagggcgacggcaccggcggtcgctccatctacggcgag 41197
>gb|BT021266.1| Drosophila melanogaster RE50843 full insert cDNA Length = 898 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 291 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 350 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 351 caccaagggcgacggcaccggcggtcgctccatctacggcgag 393
>gb|AE003458.3| Drosophila melanogaster chromosome 2R, section 66 of 73 of the complete sequence Length = 302225 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 51781 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 51722 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 51721 caccaagggcgacggcaccggcggtcgctccatctacggcgag 51679
>gb|AC004377.1|AC004377 Drosophila melanogaster DNA sequence (P1 DS00837 (D87)), complete sequence Length = 81677 Score = 85.7 bits (43), Expect = 9e-14 Identities = 88/103 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 12768 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 12827 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||||||||| ||||||||||||||| Sbjct: 12828 caccaagggcgacggcaccggcggtcgctccatctacggcgag 12870
>ref|XM_467917.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1722 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 |||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386
>gb|DQ122910.1| Chlamydomonas incerta peptidylprolyl isomerase/cyclophilin-like protein mRNA, complete cds Length = 739 Score = 81.8 bits (41), Expect = 1e-12 Identities = 74/85 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||||||||| | |||||| ||||||||||||||||||| ||||||||| Sbjct: 265 ttccaccgcgtcatcaagcagttcatgatccagggcggcgacttcaccgccggcaacggc 324 Query: 338 accggcggcgagtccatctacggcg 362 ||||||||| ||||||||||||||| Sbjct: 325 accggcggcaagtccatctacggcg 349 Score = 73.8 bits (37), Expect = 4e-10 Identities = 46/49 (93%) Strand = Plus / Plus Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||| ||||| |||||||||||| ||||| Sbjct: 201 gacggtggagaacttccgcgcgctgtgcacgggcgagaagggcttcggc 249
>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1175_B01 Length = 96191 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 |||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 86974 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 87018
>dbj|AP005002.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0486G03 Length = 146713 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 |||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 3255 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 3299
>dbj|AK070404.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023054M07, full insert sequence Length = 1722 Score = 81.8 bits (41), Expect = 1e-12 Identities = 44/45 (97%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtc 238 |||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 342 acggcggagaacttccgcgcgctctgcaccggcgagaagggcgtc 386
>dbj|AB012947.1| Vicia faba vcCyP mRNA, complete cds Length = 829 Score = 81.8 bits (41), Expect = 1e-12 Identities = 131/161 (81%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||| ||||| || ||||||||||||||||| || ||||| ||||||||||| || Sbjct: 146 gagaatttccgtgctctctgcaccggcgagaaaggagtcggtcgtagcggcaagccactc 205 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 |||| |||||| ||| |||||||| || ||||| |||||||||||||||| || ||| Sbjct: 206 cacttcaagggatcctccttccaccgtgtgatccctaacttcatgtgccagggaggtgac 265 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacgg 360 |||||| || ||||||||||| || || || |||||||| Sbjct: 266 ttcaccgccggaaacggcaccggaggagaatcgatctacgg 306
>ref|XM_959286.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin (cytosolic form) [Neurospora crassa OR74A] ) (NCU00726.1) partial mRNA Length = 543 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| | |||||||| |||||| |||||| || ||||||||| | || |||||| Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||||||||||||||| Sbjct: 253 actggtggcaagtccatctacggcgagaagtt 284
>ref|XM_324905.1| Neurospora crassa OR74A hypothetical protein ( (X17692) cyclophilin (cytosolic form) [Neurospora crassa OR74A] ) (NCU00726.1) partial mRNA Length = 543 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| | |||||||| |||||| |||||| || ||||||||| | || |||||| Sbjct: 193 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 252 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||||||||||||||| Sbjct: 253 actggtggcaagtccatctacggcgagaagtt 284
>ref|XM_851866.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33), transcript variant 3 (LOC607232), mRNA Length = 1159 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | |||||||||||||||||||| ||||| | ||||||| Sbjct: 533 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 592 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||| ||| ||||||||||||| ||||||| Sbjct: 593 accgggggcaagtccatctacgggaagaagtt 624
>ref|XM_843646.1| PREDICTED: Canis familiaris similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33), transcript variant 2 (LOC607232), mRNA Length = 1216 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | |||||||||||||||||||| ||||| | ||||||| Sbjct: 590 ttccaccgcatcatcccccagttcatgtgccagggcggcgatttcacgaaccacaacggc 649 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 ||||| ||| ||||||||||||| ||||||| Sbjct: 650 accgggggcaagtccatctacgggaagaagtt 681
>gb|AY232181.1| Drosophila yakuba clone yak-ad_CG2852 mRNA sequence Length = 417 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||||||| ||||| ||||||||| ||||||||| ||||| Sbjct: 216 ctacaagggcagcaagttccaccgcatcatcaaggacttcatgatccagggcggtgactt 275 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| |||| ||||||||||||| Sbjct: 276 caccaagggcgacggcaccggcgg 299
>emb|BX045917.1|CNS097LD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 791 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 700 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 641 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 640 caccaagggagacggcaccggcgg 617
>emb|BX045916.1|CNS097LC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 308 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 367 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 368 caccaagggagacggcaccggcgg 391
>emb|BX032973.1|CNS08XLT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1006 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 704 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 645 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 644 caccaagggagacggcaccggcgg 621
>emb|BX032972.1|CNS08XLS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1012 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 345 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 404 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 405 caccaagggagacggcaccggcgg 428
>emb|BX027426.1|CNS08TBQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 835 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 634 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 575 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 574 caccaagggagacggcaccggcgg 551
>emb|BX027425.1|CNS08TBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 870 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 284 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 343 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 344 caccaagggagacggcaccggcgg 367
>emb|BX025264.1|CNS08RNO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 667 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 415 caccaagggagacggcaccggcgg 392
>emb|BX023395.1|CNS08Q7R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 709 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 650 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 649 caccaagggagacggcaccggcgg 626
>emb|BX023394.1|CNS08Q7Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 933 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 409 caccaagggagacggcaccggcgg 432
>emb|BX010692.1|CNS08GEW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 935 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 722 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 663 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 662 caccaagggagacggcaccggcgg 639
>emb|BX010691.1|CNS08GEV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 346 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 405 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 406 caccaagggagacggcaccggcgg 429
>gb|U68268.1|TCU68268 Trypanosoma congolense cyclophilin A (cypA) mRNA, complete cds Length = 1179 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||| ||| |||||||| |||||||||||||||| ||||||||||| | ||||||| Sbjct: 277 ttccatcgcatcatccccaacttcatgtgccagggtggcgacttcactcgtcacaacggc 336 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || |||||| | || ||||||||||||||||| Sbjct: 337 acgggcggcaaatctatctacggcgagaagtt 368 Score = 48.1 bits (24), Expect = 0.020 Identities = 39/44 (88%) Strand = Plus / Plus Query: 179 gacgcggtgccgaggacggtggagaacttccgcgcgctctgcac 222 ||||| ||||||| ||| | |||||||||||||||||| ||||| Sbjct: 199 gacgccgtgccgaagaccgcggagaacttccgcgcgctgtgcac 242
>gb|AF182826.1| Drosophila melanogaster cyclophilin-33 (cyp33) mRNA, complete cds Length = 945 Score = 79.8 bits (40), Expect = 6e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 |||||| ||| |||| ||||||||||| || ||||| || |||||||| ||||||||||| Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgccaaggcggcgactt 612 Query: 322 caccaggggcaacggcaccggcggcgagtccatcta 357 ||||| ||| |||||||||||| |||||||||| Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatcta 648
>gb|AF025803.1|AF025803 Drosophila pseudoobscura cyclophilin 1 (Cyp1) mRNA, partial cds Length = 471 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||| ||||| || ||| ||||||||||||| || ||||||||||||| ||||||| Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggcgacttcaccaaccacaacggc 219 Query: 338 accggcggcgagtccatctacggc 361 ||||||||| |||||||||||||| Sbjct: 220 accggcggcaagtccatctacggc 243
>gb|AY754447.1| Drosophila affinis cyclophylin 1 (Cyp1) gene, exons 1, 2 and partial cds Length = 1783 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||| ||||| || ||| |||||||||||||||| ||||||||||||| ||||||| Sbjct: 1472 ttccatcgcgttattcccaacttcatgtgccagggaggcgacttcaccaaccacaacggc 1531 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 1532 actggcggcaagtccatctacggc 1555
>ref|XM_308669.2| Anopheles gambiae str. PEST ENSANGP00000011257 (ENSANGG00000008768), mRNA Length = 1064 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 349 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 408 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 409 caccaagggagacggcaccggcgg 432
>gb|J03963.1|NEUCYCLO N.crassa cytosolic cyclosporin A-binding protein mRNA, complete cds Length = 928 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| | |||||||| |||||| |||||| || ||||||||| | || |||||| Sbjct: 459 ttccaccgcattatccccgagttcatgctccagggtggtgacttcacccgtggtaacggc 518 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||||||||||||||| Sbjct: 519 actggtggcaagtccatctacggcgagaagtt 550
>gb|AY389742.1| Hyacinthus orientalis cyclophilin mRNA, complete cds Length = 681 Score = 77.8 bits (39), Expect = 2e-11 Identities = 60/67 (89%) Strand = Plus / Plus Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166 |||||||| ||||||||||||||| || | ||||| || ||||| ||||||||||||||| Sbjct: 54 aacccgaaagtgttcttcgacatgtcgatcggcggggctccggcgggccgcatcgtgatg 113 Query: 167 gagctgt 173 ||||||| Sbjct: 114 gagctgt 120 Score = 75.8 bits (38), Expect = 9e-11 Identities = 56/62 (90%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||||||||||||| |||||||| |||||||||||||| || ||| Sbjct: 246 ttcatgtgccagggcggcgacttcaccgccggcaacgggaccggcggcgagtctatatac 305 Query: 359 gg 360 || Sbjct: 306 gg 307 Score = 67.9 bits (34), Expect = 2e-08 Identities = 34/34 (100%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagg 233 |||||||||||||||||||||||||||||||||| Sbjct: 147 gagaacttccgcgcgctctgcaccggcgagaagg 180
>emb|AJ311666.1|BVE311666 Betula verrucosa mRNA for peptidylprolyl isomerase (cyclophilin), ppiase gene (CyP) Length = 823 Score = 77.8 bits (39), Expect = 2e-11 Identities = 132/163 (80%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||||||||| || ||||||||||| ||||||||| |||| ||||||||| || Sbjct: 137 gagaacttccgggccctctgcaccggtgagaagggcaacggccgctccggcaagcccctc 196 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 ||||||||| || |||||| | || ||||||| |||||||||||||| |||||| Sbjct: 197 cactacaagaaatcgtccttccacagggtgatccccgggttcatgtgccaggggggcgac 256 Query: 320 ttcaccaggggcaacggcaccggcggcgagtccatctacggcg 362 ||||| || ||||||||||| ||||||||||||||||||| Sbjct: 257 ttcactgccggaaacggcaccggtggcgagtccatctacggcg 299
>ref|XM_362521.1| Magnaporthe grisea 70-15 hypothetical protein (MG08104.4) partial mRNA Length = 1131 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||||||||| |||||||||||||||||||||||||||||||| Sbjct: 252 gggcaacggtaccggcggcgagtccatctacggcgagaagtt 293 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| || || || ||||||||||| | || |||||||||||||| || Sbjct: 124 gagaacttccgcgccctgtgtacgggcgagaaggggattggaaagagcggcaagcccctt 183 Query: 260 cactacaagggc 271 |||||||||||| Sbjct: 184 cactacaagggc 195
>emb|BX072404.1|CNS09S14 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 566 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Minus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 562 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 521 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 502 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 461
>emb|BX069873.1|CNS09Q2T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 269 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 310 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 329 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 370
>emb|BX057302.1|CNS09GDM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 258 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 299 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 318 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 359
>emb|BX050608.1|CNS09B7O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 504 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 243 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 284 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 303 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 344
>emb|BX046149.1|CNS097RT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 267 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 308 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 327 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 368
>emb|BX036923.1|CNS090NJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 289 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 330
>emb|BX024694.1|CNS08R7U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 265 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 155 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 196
>emb|BX016404.1|CNS08KTK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24CE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 287 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 328 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 347 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 388
>emb|BX014873.1|CNS08JN1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 276 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 317 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 336 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 377
>emb|BX013233.1|CNS08IDH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 492 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 271 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 312 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 331 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 372
>emb|BX011227.1|CNS08GTR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA17DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 810 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 265 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 306 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 325 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 366
>emb|BX008702.1|CNS08EVM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14BA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 323 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 364
>emb|BX006580.1|CNS08D8O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 263 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 304 Score = 44.1 bits (22), Expect = 0.31 Identities = 37/42 (88%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| | |||||||||||||| ||||||||| Sbjct: 323 caccgcgtgatcccgaatttcatgtgccaggggggcgacttc 364
>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29 Length = 303550 Score = 75.8 bits (38), Expect = 9e-11 Identities = 80/94 (85%) Strand = Plus / Minus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 |||||||||| || ||||| | |||||| ||||||||| |||||||||| ||||||| Sbjct: 263153 cgttccaccgtgtgatcccgcagttcatgctccagggcggtgacttcaccaacggcaacg 263094 Query: 336 gcaccggcggcgagtccatctacggcgagaagtt 369 ||||||| ||| || |||||||||||||||||| Sbjct: 263093 gcaccgggggcaagagcatctacggcgagaagtt 263060
>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I, complete sequence Length = 691920 Score = 75.8 bits (38), Expect = 9e-11 Identities = 47/50 (94%) Strand = Plus / Minus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325 |||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 250067 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 250018
>ref|XM_310632.2| Anopheles gambiae str. PEST ENSANGP00000020778 (ENSANGG00000018289), mRNA Length = 1289 Score = 75.8 bits (38), Expect = 9e-11 Identities = 41/42 (97%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||||||||||||||||||||||||| ||||| Sbjct: 584 gagaacttccgcgcgctctgcaccggcgagaagggcttcggc 625 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Plus Query: 281 caccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||||| |||||||||||||||| ||||||||| Sbjct: 644 caccgcgtgatcccgaacttcatgtgccaggggggcgacttc 685
>ref|NM_207839.1| Eremothecium gossypii AAL056Cp (AAL056C), mRNA Length = 612 Score = 75.8 bits (38), Expect = 9e-11 Identities = 47/50 (94%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325 |||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 218 cgttccaccgcgtcatccccaacttcatgatccagggcggcgacttcacc 267
>ref|XM_586293.2| PREDICTED: Bos taurus similar to Peptidyl-prolyl cis-trans isomerase E (PPIase E) (Rotamase E) (Cyclophilin E) (Cyclophilin 33) (LOC509352), mRNA Length = 2522 Score = 73.8 bits (37), Expect = 4e-10 Identities = 88/105 (83%) Strand = Plus / Plus Query: 265 caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 |||||||||| ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 399 caagggcagcagtttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 458 Query: 325 caggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 || ||| |||||||| ||| ||||||||||||| ||||||| Sbjct: 459 caaccacaatggcaccgggggcaagtccatctacgggaagaagtt 503
>emb|CR956427.7| Pig DNA sequence from clone CH242-51O7 on chromosome 6, complete sequence Length = 187800 Score = 73.8 bits (37), Expect = 4e-10 Identities = 79/93 (84%) Strand = Plus / Plus Query: 265 caagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 |||||||||| ||||||||| |||||||| | |||||||||||||||||||| ||||| Sbjct: 174628 caagggcagcagcttccaccgcatcatcccccagttcatgtgccagggcggcgatttcac 174687 Query: 325 caggggcaacggcaccggcggcgagtccatcta 357 || ||||||||| || ||| |||||||||| Sbjct: 174688 caaccacaacggcactgggggcaagtccatcta 174720
>gb|DQ440048.1| Aedes aegypti clone AE-296 cyclophylin isoform mRNA, complete cds Length = 597 Score = 71.9 bits (36), Expect = 1e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||||||||||| ||||||||| ||||||||| ||||| Sbjct: 201 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 260 Query: 322 cacc 325 |||| Sbjct: 261 cacc 264
>gb|AY368274.1| Nicotiana tabacum cyclophilin-like (CYP1) mRNA, complete sequence Length = 768 Score = 71.9 bits (36), Expect = 1e-09 Identities = 60/68 (88%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| ||||||||||||||||| |||||||| | || |||||||| || Sbjct: 130 gagaacttccgcgctctctgcaccggcgagaaaggcgtcggaaggatgggcaagcctttg 189 Query: 260 cactacaa 267 |||||||| Sbjct: 190 cactacaa 197
>ref|XM_380953.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00777.1) partial mRNA Length = 675 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||||| ||||||||| ||||| || ||||||||| | ||||||||| Sbjct: 325 ttccaccgaatcatccctgacttcatgcttcagggtggtgacttcacccgtggcaacggc 384 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| ||||||||||||| |||||||| Sbjct: 385 actggtggcaagtccatctacggtgagaagtt 416 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 |||||||||||||| |||||||| ||||||||||| Sbjct: 268 gagaacttccgcgctctctgcactggcgagaaggg 302
>emb|CR715907.2|CNS0GFCF Tetraodon nigroviridis full-length cDNA Length = 772 Score = 71.9 bits (36), Expect = 1e-09 Identities = 81/96 (84%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| ||||||||||||||||||||| ||||| Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR711184.2|CNS0GBP8 Tetraodon nigroviridis full-length cDNA Length = 771 Score = 71.9 bits (36), Expect = 1e-09 Identities = 81/96 (84%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| ||||||||||||||||||||| ||||| Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR708069.2|CNS0G9AP Tetraodon nigroviridis full-length cDNA Length = 772 Score = 71.9 bits (36), Expect = 1e-09 Identities = 81/96 (84%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| ||||||||||||||||||||| ||||| Sbjct: 170 ttccgcgccctctgcaccggcgagaagggcttcggc 205 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR706426.2|CNS0G812 Tetraodon nigroviridis full-length cDNA Length = 773 Score = 71.9 bits (36), Expect = 1e-09 Identities = 81/96 (84%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| ||||||||||||||||||||| ||||| Sbjct: 169 ttccgcgccctctgcaccggcgagaagggcttcggc 204 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268
>gb|AY346337.1| Branchiostoma belcheri tsingtaunese cyclophilin A mRNA, complete cds Length = 1358 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||| || | ||||||||||||||| || ||||||| |||||| | ||| Sbjct: 232 ttccaccgcgtcattcctggcttcatgtgccagggaggtgacttcatcaggggagatggc 291 Query: 338 accggcggcgagtccatctacggc 361 ||||||||| || |||||||||| Sbjct: 292 accggcggcaagagcatctacggc 315
>gb|AY325152.1| Rattus norvegicus Ab1-210 mRNA, complete cds Length = 814 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | ||||||||||||||||| |||||||| | ||||||| Sbjct: 605 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 664 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||| ||| ||||||| Sbjct: 665 acagggggcaagtccatctatggcaagaagtt 696
>emb|BX053495.1|CNS09DFV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 821 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||| ||||||||| Sbjct: 415 caccaagggagacgacaccggcgg 392
>emb|BX053494.1|CNS09DFU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 915 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 339 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 398 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||| ||||||||| Sbjct: 399 caccaagggagacgacaccggcgg 422
>emb|BX059546.1|CNS09I3Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||| ||||| ||||| Sbjct: 335 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccaaggcggtgactt 394 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 395 caccaagggagacggcaccggcgg 418
>emb|BX043476.1|CNS095PK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 872 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||| ||||||||| Sbjct: 415 caccaagggagacgacaccggcgg 392
>emb|BX043545.1|CNS095RH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 475 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 416 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||| ||||||||| Sbjct: 415 caccaagggagacgacaccggcgg 392
>emb|BX043544.1|CNS095RG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 992 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||||||||| ||||| Sbjct: 358 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccagggcggtgactt 417 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||| ||||||||| Sbjct: 418 caccaagggagacgacaccggcgg 441
>emb|BX025263.1|CNS08RNN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||| || |||| |||||||||| ||| ||||| ||||| Sbjct: 326 ctacaagggcagcaagttccaccgggtgatccgcgacttcatgatccacggcggtgactt 385 Query: 322 caccaggggcaacggcaccggcgg 345 ||||| ||| ||||||||||||| Sbjct: 386 caccaagggagacggcaccggcgg 409
>emb|CR938346.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YC07AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 845 Score = 71.9 bits (36), Expect = 1e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||||||||||| ||||||||| ||||||||| ||||| Sbjct: 371 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 430 Query: 322 cacc 325 |||| Sbjct: 431 cacc 434
>emb|CR938040.1| Single read from an extremity of a full-length cDNA clone made from Aedes aegypti total adult females. 5-prime end of clone KW0AAA2YM12AAM1 from strain Liverpool of Aedes aegypti (yellow fever mosquito) Length = 862 Score = 71.9 bits (36), Expect = 1e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||||||||||||||| ||||||||| ||||||||| ||||| Sbjct: 388 ctacaagggcagcaagttccaccgcgtcatccaggacttcatgatccagggcggtgactt 447 Query: 322 cacc 325 |||| Sbjct: 448 cacc 451
>ref|XM_216524.3| PREDICTED: Rattus norvegicus peptidylprolyl isomerase E (cyclophilin E) (predicted) (Ppie_predicted), mRNA Length = 944 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | ||||||||||||||||| |||||||| | ||||||| Sbjct: 602 ttccaccgcatcatcccccagttcatgtgccagggcggtgacttcacaaaccacaacggc 661 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || ||| |||||||||| ||| ||||||| Sbjct: 662 acagggggcaagtccatctatggcaagaagtt 693
>gb|AY134669.1| Drosophila melanogaster peptidylprolyl cis-trans isomerase mRNA, complete cds Length = 3177 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389
>emb|AJ238310.1|LRU238310 Lumbricus rubellus mRNA for cyclophilin A Length = 1158 Score = 69.9 bits (35), Expect = 5e-09 Identities = 62/71 (87%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 ||||||||||||||||| |||||||||| |||| |||||||||| || || ||||||| Sbjct: 277 ttcatgtgccagggcggtgacttcaccaagggcgacggcaccggtggaaagagcatctac 336 Query: 359 ggcgagaagtt 369 || |||||||| Sbjct: 337 ggagagaagtt 347
>dbj|AB231810.1| Malassezia japonica CYP mRNA for cyclophilin, partial cds Length = 486 Score = 69.9 bits (35), Expect = 5e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 274 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 333 |||||||||||| |||||||||||||| ||| |||||| || |||||||| ||||| Sbjct: 147 ctcgttccaccgtgtcatccccgactttatgctccagggtggtgacttcactgccggcaa 206 Query: 334 cggcaccggcggcgagtccatctacgg 360 ||| ||||| ||| ||||||||||||| Sbjct: 207 cggtaccggtggcaagtccatctacgg 233
>ref|NM_170367.1| Drosophila melanogaster Moca-cyp CG1866-RA, transcript variant A (Moca-cyp), mRNA Length = 3162 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389
>ref|NM_143361.3| Drosophila melanogaster Moca-cyp CG1866-RB, transcript variant B (Moca-cyp), mRNA Length = 3705 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcg 374
>gb|AY051595.1| Drosophila melanogaster GH23813 full length cDNA Length = 3726 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 340 gggcaacggcaccggcggcgagtccatctacggcg 374
>gb|AC009345.7|AC009345 Drosophila melanogaster, chromosome 3R, region 98C-98C, BAC clone BACR28F20, complete sequence Length = 158895 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 131821 gggcaacggcaccggcggcgagtccatctacggcg 131855
>gb|AC008028.3|AC008028 Drosophila melanogaster, chromosome 3R, region 98C-98D, BAC clone BACR14L13, complete sequence Length = 197348 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 35036 gggcaacggcaccggcggcgagtccatctacggcg 35070
>gb|AF242312.1|AF242312 Euphorbia esula cyclophilin mRNA, partial cds Length = 695 Score = 69.9 bits (35), Expect = 5e-09 Identities = 134/167 (80%) Strand = Plus / Plus Query: 194 acggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaag 253 |||| ||||||||||||||| || |||||||||||||| |||||||| ||| |||| Sbjct: 60 acggcggagaacttccgcgctctttgcaccggcgagaaaggcgtcgggcgcagccgcaaa 119 Query: 254 ccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggc 313 || || |||| ||| || |||||||||||||| ||||| | ||||||||||| || Sbjct: 120 cctctccacttcaaaggatcatcgttccaccgcgtgatccctggattcatgtgccaagga 179 Query: 314 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360 ||||| ||||| || ||||||||||| ||||| || |||||||| Sbjct: 180 ggcgatttcactgccggaaacggcaccggaggcgaatcgatctacgg 226
>gb|AE003765.3| Drosophila melanogaster chromosome 3R, section 103 of 118 of the complete sequence Length = 239049 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 10715 gggcaacggcaccggcggcgagtccatctacggcg 10749
>gb|BT001578.1| Drosophila melanogaster RE23622 full insert cDNA Length = 3180 Score = 69.9 bits (35), Expect = 5e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 328 gggcaacggcaccggcggcgagtccatctacggcg 362 ||||||||||||||||||||||||||||||||||| Sbjct: 355 gggcaacggcaccggcggcgagtccatctacggcg 389
>gb|AY150052.1| Kandelia candel cyclophilin (Cyp1) mRNA, complete cds Length = 884 Score = 67.9 bits (34), Expect = 2e-08 Identities = 132/162 (81%), Gaps = 2/162 (1%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 |||||||||||||| ||||| |||||||||||||| || | ||| || ||||| || Sbjct: 124 gagaacttccgcgccctctgtaccggcgagaagggaaaagggaggagtgggaagcctctc 183 Query: 260 cactacaagggcagct-cgttccaccgcgtcatccccgacttcatgtgccagggcggcga 318 ||||| ||||| | || | ||||||| || |||||| ||||||||||||||||||| || Sbjct: 184 cactataaggg-atctaccttccaccttgtaatccccaacttcatgtgccagggcggaga 242 Query: 319 cttcaccaggggcaacggcaccggcggcgagtccatctacgg 360 ||||||| || |||| ||||| |||||||| |||||||| Sbjct: 243 cttcaccgccggaaacgaaaccggaggcgagtcgatctacgg 284
>emb|Z48002.1|TNCYCABPR T.niveum gene for cyclophilin A-binding protein Length = 1750 Score = 67.9 bits (34), Expect = 2e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 764 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 805 Score = 56.0 bits (28), Expect = 8e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325 |||||||| |||||||||| |||||| ||||||||||||||||||| Sbjct: 821 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 868 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369 ||||| |||||| |||||||||||||||||||||| Sbjct: 936 ggcactggcggcaagtccatctacggcgagaagtt 970
>emb|Z32674.1|TNCPTAG T.niveum (ATCC34921) cptA gene for cyclophilin Length = 1488 Score = 67.9 bits (34), Expect = 2e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 878 gagaacttccgcgctctctgcaccggcgagaagggcttcggc 919 Score = 56.0 bits (28), Expect = 8e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacc 325 |||||||| |||||||||| |||||| ||||||||||||||||||| Sbjct: 935 ttccaccgtatcatccccgagttcatgctccagggcggcgacttcacc 982 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369 ||||| |||||| |||||||||||||||||||||| Sbjct: 1050 ggcactggcggcaagtccatctacggcgagaagtt 1084
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 65.9 bits (33), Expect = 9e-08 Identities = 75/89 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| |||||||| | ||| ||| |||||||| |||||||||| | ||||||| Sbjct: 1868078 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 1868137 Query: 338 accggcggcgagtccatctacggcgagaa 366 |||||||||| || |||||||||||||| Sbjct: 1868138 accggcggcgtctctatctacggcgagaa 1868166
>ref|XM_838488.1| Leishmania major strain Friedlin peptidyl-prolyl cis-trans isomerase (cyclophilin-40) (LMJ_1407) partial mRNA Length = 1065 Score = 65.9 bits (33), Expect = 9e-08 Identities = 75/89 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| |||||||| | ||| ||| |||||||| |||||||||| | ||||||| Sbjct: 187 ttccaccgtgtcatcccgggctttatgattcagggcggagacttcaccaagcacaacggc 246 Query: 338 accggcggcgagtccatctacggcgagaa 366 |||||||||| || |||||||||||||| Sbjct: 247 accggcggcgtctctatctacggcgagaa 275
>emb|AJ417659.1|POS417659 Pleurotus ostreatus partial mRNA for putative cyclophilin (cpa1 gene) Length = 595 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Plus Query: 314 ggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaa 366 ||||||||||||| |||||||||||| ||||| ||||||||||||| ||||| Sbjct: 195 ggcgacttcaccaagggcaacggcactggcggaaagtccatctacggagagaa 247
>dbj|AB254820.1| Cryptomeria japonica mRNA for putative peptidyl-prolyl cis-trans isomerase, complete cds Length = 793 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Plus Query: 248 ggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgc 307 |||||||| || |||| ||||||| ||| |||||||| |||||||| | ||| |||||| Sbjct: 212 ggcaagccccttcacttcaagggctcctccttccaccgggtcatccctggctttatgtgc 271 Query: 308 cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360 |||||||| ||||| || || || ||||||||||| |||||||| ||||| Sbjct: 272 cagggcggtgactttactgctggaaatggcaccggcggtgagtccatttacgg 324
>gb|M55018.1|BNACYP Brassica napus cyclophilin (CyP) mRNA, 3' end Length = 661 Score = 65.9 bits (33), Expect = 9e-08 Identities = 129/161 (80%) Strand = Plus / Plus Query: 149 gccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttc 208 ||||||||||||||||||||||| ||| ||| | || || ||||| ||||||||| Sbjct: 40 gccggccgcatcgtgatggagctttacgccgacacagtccccgagacggccgagaacttc 99 Query: 209 cgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctgcactacaag 268 || || |||||||||||||||| || ||||||| ||| ||||| || ||||||||| Sbjct: 100 cgtgctctctgcaccggcgagagaggaatcggcaaatccggaaagccactccactacaag 159 Query: 269 ggcagctcgttccaccgcgtcatccccgacttcatgtgcca 309 ||| | ||||||||||| |||||| | ||||||||||| Sbjct: 160 ggctcggctttccaccgcgtgatccccaagttcatgtgcca 200
>ref|NM_194920.1| Oryza sativa (japonica cultivar-group) putative cyclophilin (OSJNAa0034B05.5), mRNA Length = 546 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 197 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 256 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 257 gcaccggcggcgagtc 272
>gb|AC091724.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBa0004E08, complete sequence Length = 158294 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 8927 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 8986 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 8987 gcaccggcggcgagtc 9002 Score = 42.1 bits (21), Expect = 1.2 Identities = 57/69 (82%) Strand = Plus / Plus Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310 |||||||| |||||||||||| |||||||||| || | |||| |||||||||||| Sbjct: 16348 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 16407 Query: 311 ggcggcgac 319 |||||||| Sbjct: 16408 agcggcgac 16416
>gb|AF291180.1| Capsicum annuum cyclophilin CACYP1 mRNA, complete cds Length = 695 Score = 63.9 bits (32), Expect = 3e-07 Identities = 44/48 (91%) Strand = Plus / Plus Query: 193 gacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcgg 240 ||||| ||| |||||||| || |||||||||||||||||||||||||| Sbjct: 125 gacggcggaaaacttccgtgcactctgcaccggcgagaagggcgtcgg 172
>emb|CR720665.2|CNS0GJ0F Tetraodon nigroviridis full-length cDNA Length = 786 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR701424.2|CNS0G464 Tetraodon nigroviridis full-length cDNA Length = 783 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270
>emb|CR694759.2|CNS0FZ0Z Tetraodon nigroviridis full-length cDNA Length = 782 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268
>emb|CR680608.2|CNS0FO3W Tetraodon nigroviridis full-length cDNA Length = 764 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 91 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 150 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 151 ttccgcgccctctgcactggcgagaagggcttcggc 186 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 202 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 250
>emb|CR680454.2|CNS0FNZM Tetraodon nigroviridis full-length cDNA Length = 776 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 104 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 163 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 164 ttccgcgccctctgcactggcgagaagggcttcggc 199 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 215 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 263
>emb|CR679705.2|CNS0FNET Tetraodon nigroviridis full-length cDNA Length = 769 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 97 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 156 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 157 ttccgcgccctctgcactggcgagaagggcttcggc 192 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 208 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 256
>emb|CR679007.2|CNS0FMVF Tetraodon nigroviridis full-length cDNA Length = 679 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 7 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 66 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 67 ttccgcgccctctgcactggcgagaagggcttcggc 102 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 118 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 166
>emb|CR672286.2|CNS0FHPG Tetraodon nigroviridis full-length cDNA Length = 781 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268
>emb|CR664740.2|CNS0FBVU Tetraodon nigroviridis full-length cDNA Length = 778 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 106 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 165 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 166 ttccgcgccctctgcactggcgagaagggcttcggc 201 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 217 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 265
>emb|CR659051.2|CNS0F7HT Tetraodon nigroviridis full-length cDNA Length = 782 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 110 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 169 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 170 ttccgcgccctctgcactggcgagaagggcttcggc 205 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 221 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR658192.2|CNS0F6TY Tetraodon nigroviridis full-length cDNA Length = 783 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 111 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 170 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 171 ttccgcgccctctgcactggcgagaagggcttcggc 206 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 222 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 270
>emb|CR653466.2|CNS0F36O Tetraodon nigroviridis full-length cDNA Length = 780 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267
>emb|CR650031.2|CNS0F0J9 Tetraodon nigroviridis full-length cDNA Length = 781 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268
>emb|CR646067.2|CNS0EXH5 Tetraodon nigroviridis full-length cDNA Length = 779 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 108 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 167 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 168 ttccgcgccctctgcactggcgagaagggcttcggc 203 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 219 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 267
>emb|CR642611.2|CNS0EUT5 Tetraodon nigroviridis full-length cDNA Length = 780 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||||||||||| ||||| Sbjct: 169 ttccgcgccctctgcactggcgagaagggcttcggc 204 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 220 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 268
>gb|AC122145.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAa0034B05, complete sequence Length = 125655 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 74582 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 74641 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 74642 gcaccggcggcgagtc 74657 Score = 42.1 bits (21), Expect = 1.2 Identities = 57/69 (82%) Strand = Plus / Plus Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310 |||||||| |||||||||||| |||||||||| || | |||| |||||||||||| Sbjct: 82003 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 82062 Query: 311 ggcggcgac 319 |||||||| Sbjct: 82063 agcggcgac 82071
>ref|NM_079049.2| Drosophila melanogaster cyclophilin-33 CG4886-RA (cyp33), mRNA Length = 1317 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 |||||| ||| |||| ||||||||||| || ||||| || ||||| || || |||||||| Sbjct: 943 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 1002 Query: 322 caccaggggcaacggcaccggcggcgagtccatcta 357 ||||| ||| |||||||||||| |||||||||| Sbjct: 1003 caccaacaacaatggcaccggcggcaagtccatcta 1038
>gb|AY061421.1| Drosophila melanogaster LD35248 full length cDNA Length = 946 Score = 63.9 bits (32), Expect = 3e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 |||||| ||| |||| ||||||||||| || ||||| || ||||| || || |||||||| Sbjct: 553 ctacaaaggctgctccttccaccgcgtgatacccgagtttatgtgtcaaggaggcgactt 612 Query: 322 caccaggggcaacggcaccggcggcgagtccatcta 357 ||||| ||| |||||||||||| |||||||||| Sbjct: 613 caccaacaacaatggcaccggcggcaagtccatcta 648
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 3417798 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417857 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 3417858 gcaccggcggcgagtc 3417873 Score = 42.1 bits (21), Expect = 1.2 Identities = 57/69 (82%) Strand = Plus / Plus Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310 |||||||| |||||||||||| |||||||||| || | |||| |||||||||||| Sbjct: 3425219 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425278 Query: 311 ggcggcgac 319 |||||||| Sbjct: 3425279 agcggcgac 3425287
>ref|NM_199957.1| Danio rerio peptidylprolyl isomerase A, like (ppial), mRNA Length = 822 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| | |||||||| |||||||| || ||||||| |||||| Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356 Query: 338 accggcggcgagtccatctacggc 361 ||||| || |||||||||||||| Sbjct: 357 accggaggaaagtccatctacggc 380 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 ||||||||||| || ||||||||||| |||||||| Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274
>gb|AF025804.1|AF025804 Drosophila subobscura cyclophilin 1 (Cyp1) mRNA, partial cds Length = 471 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||| ||||| || ||| ||||||||||||| || || |||||||||| ||||||| Sbjct: 160 ttccatcgcgttattcccaacttcatgtgccaaggaggtgacttcaccaaccacaacggc 219 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 220 actggcggcaagtccatctacggc 243
>gb|BC071370.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone MGC:86688 IMAGE:6895545), complete cds Length = 784 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| | |||||||| |||||||| || ||||||| |||||| Sbjct: 229 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 288 Query: 338 accggcggcgagtccatctacggc 361 ||||| || |||||||||||||| Sbjct: 289 accggaggaaagtccatctacggc 312 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 ||||||||||| || ||||||||||| |||||||| Sbjct: 172 gagaacttccgtgcactctgcaccggagagaaggg 206
>dbj|AK058898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-H03, full insert sequence Length = 927 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 319 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 378 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 379 gcaccggcggcgagtc 394
>gb|AF158368.1|AF158368 Leishmania donovani cyclophilin (CYP) gene, complete cds Length = 945 Score = 63.9 bits (32), Expect = 3e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||| |||||||| |||||||||||||||||||| | | ||| Sbjct: 483 ttccaccgcgtcatccaaaacttcatgatccagggcggcgacttcaccaacttcgatggc 542 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || |||||| |||| ||||||||||| ||||| Sbjct: 543 acgggcggcaagtcgatctacggcgaaaagtt 574
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 63.9 bits (32), Expect = 3e-07 Identities = 65/76 (85%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 ||||||||||||| | |||| ||||||||||||||||||||| |||| || |||| Sbjct: 3417719 cgttccaccgcgtggtgcccgggttcatgtgccagggcggcgacatcacggccgggaacg 3417778 Query: 336 gcaccggcggcgagtc 351 |||||||||||||||| Sbjct: 3417779 gcaccggcggcgagtc 3417794 Score = 42.1 bits (21), Expect = 1.2 Identities = 57/69 (82%) Strand = Plus / Plus Query: 251 aagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccag 310 |||||||| |||||||||||| |||||||||| || | |||| |||||||||||| Sbjct: 3425140 aagccgctccactacaagggctcaacgttccaccgggtggtgcccgggttcatgtgccag 3425199 Query: 311 ggcggcgac 319 |||||||| Sbjct: 3425200 agcggcgac 3425208
>emb|CR956622.12| Pig DNA sequence from clone PigE-219N9 on chromosome 6, complete sequence Length = 174170 Score = 63.9 bits (32), Expect = 3e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||| || |||||||| | |||||||||||||||||||| ||||||| ||||||| Sbjct: 95535 ttccactgcatcatcccccagttcatgtgccagggcggcgatttcaccaaccacaacggc 95476 Query: 338 accggcggcgagtccatcta 357 || || ||| |||||||||| Sbjct: 95475 actgggggcaagtccatcta 95456
>gb|BC059470.1| Danio rerio peptidylprolyl isomerase A, like, mRNA (cDNA clone MGC:73102 IMAGE:4786094), complete cds Length = 822 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| | |||||||| |||||||| || ||||||| |||||| Sbjct: 297 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgatttcaccaatcacaacgga 356 Query: 338 accggcggcgagtccatctacggc 361 ||||| || |||||||||||||| Sbjct: 357 accggaggaaagtccatctacggc 380 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 ||||||||||| || ||||||||||| |||||||| Sbjct: 240 gagaacttccgtgcactctgcaccggagagaaggg 274
>ref|XM_749773.1| Aspergillus fumigatus Af293 peptidyl-prolyl cis-trans isomerase (Afu3g07430) partial mRNA Length = 492 Score = 61.9 bits (31), Expect = 1e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | |||||| ||||| || || ||||||| |||||||||| Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213 Query: 338 accggcggcgagtccatctacgg 360 || || ||| ||||||||||||| Sbjct: 214 actggtggcaagtccatctacgg 236
>emb|CR660141.2|CNS0F8C3 Tetraodon nigroviridis full-length cDNA Length = 767 Score = 61.9 bits (31), Expect = 1e-06 Identities = 40/43 (93%) Strand = Plus / Plus Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 ||||||||||||||| |||||||| |||||||||||| ||||| Sbjct: 147 ggagaacttccgcgccctctgcactggcgagaagggcttcggc 189 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 205 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 253
>ref|XM_501664.1| Yarrowia lipolytica CLIB122, YALI0C09988g predicted mRNA Length = 531 Score = 61.9 bits (31), Expect = 1e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 168 agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 227 |||||||||||||| |||||| | ||||| |||||||||||| || || ||||| |||| Sbjct: 104 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 163 Query: 228 agaaggg 234 ||||||| Sbjct: 164 agaaggg 170
>emb|AJ245940.1|RCO245940 Ricinus communis mRNA for cyclophilin (cyp1 gene) Length = 679 Score = 61.9 bits (31), Expect = 1e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 107 aacccgaaggtgttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatg 166 ||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||| |||||| Sbjct: 10 aaccctaaggtcttctttgacatgactgtcggcggtgctccggcgggccgcatagtgatg 69 Query: 167 gagctgt 173 ||||||| Sbjct: 70 gagctgt 76
>dbj|AB231814.1| Malassezia slooffiae CYP mRNA for cyclophilin, partial cds Length = 486 Score = 61.9 bits (31), Expect = 1e-06 Identities = 73/87 (83%) Strand = Plus / Plus Query: 274 ctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaa 333 |||||||||||| || ||||| ||||||||| |||||| || |||||||| |||||| Sbjct: 147 ctcgttccaccgtgtgatccctgacttcatgctccagggtggtgacttcactgcgggcaa 206 Query: 334 cggcaccggcggcgagtccatctacgg 360 ||||||||| ||| || ||||||||| Sbjct: 207 cggcaccggtggcaagagcatctacgg 233 Score = 46.1 bits (23), Expect = 0.080 Identities = 38/43 (88%) Strand = Plus / Plus Query: 199 ggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||||||| ||||| ||||| || ||||||||| ||||| Sbjct: 93 ggagaacttccgtgcgctgtgcactggtgagaagggcttcggc 135
>emb|AJ937743.1| Aspergillus fumigatus mRNA for cyclophilin (asp f 27 gene), strain ATCC 42202 Length = 492 Score = 61.9 bits (31), Expect = 1e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | |||||| ||||| || || ||||||| |||||||||| Sbjct: 154 ttccaccgcatcatcccccagttcatgctgcagggtggtgatttcaccaagggcaacggc 213 Query: 338 accggcggcgagtccatctacgg 360 || || ||| ||||||||||||| Sbjct: 214 actggtggcaagtccatctacgg 236
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 61.9 bits (31), Expect = 1e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 168 agctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcgctctgcaccggcg 227 |||||||||||||| |||||| | ||||| |||||||||||| || || ||||| |||| Sbjct: 1368420 agctgtacaaggaccaggtgcccaagacggcggagaacttccgagctctgtgcactggcg 1368479 Query: 228 agaaggg 234 ||||||| Sbjct: 1368480 agaaggg 1368486 Score = 52.0 bits (26), Expect = 0.001 Identities = 53/62 (85%) Strand = Plus / Minus Query: 308 cagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaag 367 ||||| || ||||||||| |||||||| ||||| || |||||||||||||| |||||| Sbjct: 2361962 cagggaggagacttcaccgctggcaacggtaccggaggagagtccatctacggggagaag 2361903 Query: 368 tt 369 || Sbjct: 2361902 tt 2361901 Score = 50.1 bits (25), Expect = 0.005 Identities = 70/85 (82%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||||||| | |||||| ||||| || ||||||||| | |||||| Sbjct: 1424183 ttccaccgagtcatcccccagttcatgctgcagggtggagacttcacccgacacaacgga 1424242 Query: 338 accggcggcgagtccatctacggcg 362 ||||| ||| ||||||||||||||| Sbjct: 1424243 accggaggcaagtccatctacggcg 1424267 Score = 40.1 bits (20), Expect = 4.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggc 235 ||||||||||| || || ||||| |||||||||||| Sbjct: 2362070 gagaacttccgagctctgtgcactggcgagaagggc 2362035 Score = 40.1 bits (20), Expect = 4.9 Identities = 32/36 (88%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggc 235 ||||||||||| || || |||||||||||| ||||| Sbjct: 1424126 gagaacttccgagctctgtgcaccggcgagcagggc 1424161
>gb|DQ079281.1| Drosophila arizonae strain 15081-1271.13 moj29 (moj29) gene, partial cds Length = 938 Score = 61.9 bits (31), Expect = 1e-06 Identities = 85/103 (82%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| |||||| ||| ||||| ||||| ||| |||||| |||||||| Sbjct: 608 ctacaagggcagcaagttccatcgcatcatcaaggactttatgatccagggtggcgactt 667 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggcgag 364 ||||| |||| ||||||| |||||| |||||||| |||||| Sbjct: 668 caccaagggcgacggcactggcggccgttccatctatggcgag 710
>gb|AF293848.1| Pyricularia grisea cyclophilin (CYP1) gene, complete cds; nuclear gene encoding mitochondrial and cytosolic products Length = 2215 Score = 60.0 bits (30), Expect = 5e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||| Sbjct: 955 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 1012 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369 |||||||| ||| ||||| |||||||||||||||| Sbjct: 1090 ggcaccggtggcaagtccgtctacggcgagaagtt 1124
>gb|AY942800.1| Cucumis sativus cyclophilin (M2) mRNA, complete cds Length = 814 Score = 60.0 bits (30), Expect = 5e-06 Identities = 102/126 (80%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaagggcgtcggcaagagcggcaagccgctg 259 ||||||||||| || |||||||| || |||||||| |||||||| ||||||| || || Sbjct: 140 gagaacttccgtgcactctgcactggtgagaagggagtcggcaaaggcggcaaacccctt 199 Query: 260 cactacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgac 319 || ||||| || ||| |||||||| || ||||| | |||||||||||||| || || Sbjct: 200 cattacaaaggatcctccttccaccgtgtgatccctaatttcatgtgccagggaggtgat 259 Query: 320 ttcacc 325 |||||| Sbjct: 260 ttcacc 265 Score = 42.1 bits (21), Expect = 1.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 171 |||||||||||||| | |||||| | ||||||||||| ||| | |||||||| Sbjct: 59 ttcttcgacatgacaatcggcggcacaccggccggccggatcatcatggagct 111
>gb|AY106356.1| Zea mays PCO149745 mRNA sequence Length = 1855 Score = 60.0 bits (30), Expect = 5e-06 Identities = 45/50 (90%) Strand = Plus / Plus Query: 192 ggacggtggagaacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||| |||||||||||||||||||||||| || ||||| ||| ||||| Sbjct: 369 ggacggcggagaacttccgcgcgctctgcacaggggagaaaggcatcggc 418
>gb|AF041412.1|AF041412 Periplaneta americana peptidyl-prolyl cis-trans isomerase mRNA, partial cds Length = 235 Score = 60.0 bits (30), Expect = 5e-06 Identities = 54/62 (87%) Strand = Plus / Plus Query: 263 tacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttc 322 |||||||| ||| | ||||||||||| |||||| |||||||||| ||||| || |||||| Sbjct: 13 tacaagggtagcaccttccaccgcgttatccccaacttcatgtgtcagggaggagacttc 72 Query: 323 ac 324 || Sbjct: 73 ac 74
>dbj|AB062672.1| Magnaporthe grisea CYP1 gene for cyclophilin, complete cds Length = 1652 Score = 60.0 bits (30), Expect = 5e-06 Identities = 51/58 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 |||||||| ||||||||||||||||| ||||||||| ||||||||| | ||||||| Sbjct: 654 ttccaccgtatcatccccgacttcatgctccagggcggtgacttcacccgtggcaacg 711 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 335 ggcaccggcggcgagtccatctacggcgagaagtt 369 |||||||| ||| ||||| |||||||||||||||| Sbjct: 789 ggcaccggtggcaagtccgtctacggcgagaagtt 823
>gb|AY392408.1| Thellungiella halophila cyclophilin mRNA, complete cds Length = 760 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 119 ttcttcgacatgacggtgggcggcgccccggccggccgcatcgtgatggagct 171 |||||||||||||| || ||||| | ||||||||||| |||||||||||||| Sbjct: 75 ttcttcgacatgaccgtcggcggatcaccggccggccgaatcgtgatggagct 127
>ref|XM_571478.1| Cryptococcus neoformans var. neoformans JEC21 peptidyl-prolyl cis-trans isomerase (CNF00430) partial mRNA Length = 1329 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 317 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaagtt 369 ||||| ||||||||| |||| ||||| || ||||||||||| ||||||||||| Sbjct: 310 gactttaccaggggcgacggaaccggtggagagtccatctatggcgagaagtt 362
>emb|AJ011956.1|MFU011956 Malassezia sympodialis mRNA for allergen Mal s 6, strain ATCC no. 42132 Length = 573 Score = 58.0 bits (29), Expect = 2e-05 Identities = 71/85 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| || ||||| ||||| ||| |||||| || ||||||||| ||||||||| Sbjct: 166 ttccaccgtgtgatccctgactttatgctccagggtggtgacttcaccgctggcaacggc 225 Query: 338 accggcggcgagtccatctacggcg 362 || |||||| |||| |||||||||| Sbjct: 226 acgggcggcaagtcgatctacggcg 250 Score = 46.1 bits (23), Expect = 0.080 Identities = 35/39 (89%) Strand = Plus / Plus Query: 203 aacttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| || |||||||| |||||||||||| ||||| Sbjct: 112 aacttccgtgctctctgcactggcgagaagggcttcggc 150
>ref|XM_504296.1| Yarrowia lipolytica CLIB122, YALI0E23155g predicted mRNA Length = 687 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 297 acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 356 |||||||| ||||||||| ||||||||| | || ||||||| || ||||||||||||| Sbjct: 260 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 319 Query: 357 acggc 361 ||||| Sbjct: 320 acggc 324 Score = 44.1 bits (22), Expect = 0.31 Identities = 31/34 (91%) Strand = Plus / Plus Query: 197 gtggagaacttccgcgcgctctgcaccggcgaga 230 |||||||||||||| || || ||||||||||||| Sbjct: 181 gtggagaacttccgagctctgtgcaccggcgaga 214
>ref|NM_067427.3| Caenorhabditis elegans CYclophyliN family member (cyn-2) (cyn-2) mRNA, complete cds Length = 655 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 155 cgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaacttccgcgcg 214 |||||||| |||||||| ||||| ||| ||||||| ||| | ||| ||||||||||| Sbjct: 71 cgcatcgttatggagctctacaacgacatcgtgccgaagacagcggaaaacttccgcgct 130 Query: 215 ctctgcaccggcgagaa 231 || |||||||||||||| Sbjct: 131 ctgtgcaccggcgagaa 147
>gb|AY229877.1| Populus tremuloides cyclophilin mRNA, complete cds Length = 709 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Plus Query: 137 ggcggcgccccggccggccgcatcgtgatggagctgt 173 ||||||||||| |||||||| |||||||||||||||| Sbjct: 63 ggcggcgccccagccggccggatcgtgatggagctgt 99
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 297 acttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatct 356 |||||||| ||||||||| ||||||||| | || ||||||| || ||||||||||||| Sbjct: 2719818 acttcatgatccagggcggagacttcacccgaggagacggcactggaggcgagtccatct 2719877 Query: 357 acggc 361 ||||| Sbjct: 2719878 acggc 2719882 Score = 44.1 bits (22), Expect = 0.31 Identities = 31/34 (91%) Strand = Plus / Plus Query: 197 gtggagaacttccgcgcgctctgcaccggcgaga 230 |||||||||||||| || || ||||||||||||| Sbjct: 2719739 gtggagaacttccgagctctgtgcaccggcgaga 2719772
>gb|AY391451.1| Danio rerio peptidylprolyl isomerase A (PPIA-1) mRNA, complete cds Length = 743 Score = 56.0 bits (28), Expect = 8e-05 Identities = 70/84 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||||||||||||| | |||||||| |||||||| || || |||| |||||| Sbjct: 220 ttccaccgcgtcatcccccaattcatgtgtcagggcggtgattttaccaatcacaacgga 279 Query: 338 accggcggcgagtccatctacggc 361 ||||| || |||||||||||||| Sbjct: 280 accggaggaaagtccatctacggc 303 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Plus Query: 200 gagaacttccgcgcgctctgcaccggcgagaaggg 234 ||||||||||| || ||||||||||| |||||||| Sbjct: 163 gagaacttccgtgcactctgcaccggagagaaggg 197
>ref|XM_513346.1| PREDICTED: Pan troglodytes similar to peptidylprolyl isomerase E isoform 2; peptidyl-prolyl cis-trans isomerase E; cyclophilin 33; cyclophilin E; PPIase E; rotamase E (LOC456784), mRNA Length = 1113 Score = 56.0 bits (28), Expect = 8e-05 Identities = 67/80 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | ||||||||||||||||| || ||||| | ||||||| Sbjct: 566 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 625 Query: 338 accggcggcgagtccatcta 357 || || ||| |||||||||| Sbjct: 626 actgggggcaagtccatcta 645
>ref|XM_676782.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8605.2), mRNA Length = 489 Score = 56.0 bits (28), Expect = 8e-05 Identities = 76/92 (82%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||| ||| | |||||| |||||| || ||||||||| | |||||| Sbjct: 151 ttccaccgtgtcattccccagttcatgctccagggtggtgacttcacccgccagaacggc 210 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || |||||| ||||||||||||| |||||||| Sbjct: 211 actggcggcaagtccatctacggtgagaagtt 242
>ref|XM_754780.1| Ustilago maydis 521 hypothetical protein (UM03726.1) partial mRNA Length = 489 Score = 56.0 bits (28), Expect = 8e-05 Identities = 73/88 (82%) Strand = Plus / Plus Query: 275 tcgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaac 334 ||||||||||| |||||||| ||||||||| ||||| || ||||||||| || ||| Sbjct: 148 tcgttccaccgtgtcatcccggacttcatgctgcagggtggtgacttcaccgccggtaac 207 Query: 335 ggcaccggcggcgagtccatctacggcg 362 || ||||| ||| |||| |||||||||| Sbjct: 208 ggtaccggaggcaagtcgatctacggcg 235
>ref|XM_568796.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A (CNB01230) partial mRNA Length = 620 Score = 56.0 bits (28), Expect = 8e-05 Identities = 70/84 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| || |||||| | |||||| |||||| || |||||||||| ||||||| Sbjct: 202 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 261 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 262 actggcggcaagtccatctacggc 285
>ref|XM_568801.1| Cryptococcus neoformans var. neoformans JEC21 cyclophilin A (CNB01290) partial mRNA Length = 591 Score = 56.0 bits (28), Expect = 8e-05 Identities = 70/84 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| || |||||| | |||||| |||||| || |||||||||| ||||||| Sbjct: 253 ttccaccgagtgatcccccagttcatgctccagggtggtgacttcaccaaccacaacggc 312 Query: 338 accggcggcgagtccatctacggc 361 || |||||| |||||||||||||| Sbjct: 313 actggcggcaagtccatctacggc 336
>emb|CR663102.2|CNS0FAMC Tetraodon nigroviridis full-length cDNA Length = 784 Score = 56.0 bits (28), Expect = 8e-05 Identities = 79/96 (82%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 109 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 168 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| |||||||| |||| ||||||| ||||| Sbjct: 169 ttccgcgccctctgcactggcgggaagggcttcggc 204 Score = 46.1 bits (23), Expect = 0.080 Identities = 41/47 (87%) Strand = Plus / Plus Query: 280 ccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 223 ccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 269
>emb|CR656960.2|CNS0F5VQ Tetraodon nigroviridis full-length cDNA Length = 694 Score = 56.0 bits (28), Expect = 8e-05 Identities = 79/96 (82%) Strand = Plus / Plus Query: 146 ccggccggccgcatcgtgatggagctgtacaaggacgcggtgccgaggacggtggagaac 205 ||||| |||||||||||||||||||| || |||| ||| || | || | ||||||| Sbjct: 22 ccggcgggccgcatcgtgatggagctcaacgccgacgtggttcccaaaactgcggagaac 81 Query: 206 ttccgcgcgctctgcaccggcgagaagggcgtcggc 241 |||||||| ||||| || |||||||||||| ||||| Sbjct: 82 ttccgcgccctctgaactggcgagaagggcttcggc 117 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcacca 326 ||||||||||||||||| | |||||||||||||| || || ||||||| Sbjct: 133 ttccaccgcgtcatccctcagttcatgtgccagggaggtgatttcacca 181
>emb|BX069275.1|CNS09PM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 415 Score = 56.0 bits (28), Expect = 8e-05 Identities = 67/80 (83%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| || |||||| || | || |||||||||| ||||||||| ||||| Sbjct: 336 ctacaagggcagcaagtcccaccgggtgacccgcgacttcatgatccagggcggtgactt 395 Query: 322 caccaggggcaacggcaccg 341 ||||| ||| ||||||||| Sbjct: 396 caccaagggagacggcaccg 415
>emb|CR860299.1| Pongo pygmaeus mRNA; cDNA DKFZp459B225 (from clone DKFZp459B225) Length = 4360 Score = 56.0 bits (28), Expect = 8e-05 Identities = 67/80 (83%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 ||||||||| |||||||| | ||||||||||||||||| || ||||| | ||||||| Sbjct: 586 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcacaaaccacaacggc 645 Query: 338 accggcggcgagtccatcta 357 || || ||| |||||||||| Sbjct: 646 actgggggcaagtccatcta 665
>emb|AJ609278.1| Cicer arietinum partial mRNA for cyclophilin-type peptidyl-prolyl cis-trans isomerase (ppi gene) Length = 651 Score = 56.0 bits (28), Expect = 8e-05 Identities = 94/116 (81%) Strand = Plus / Plus Query: 245 agcggcaagccgctgcactacaagggcagctcgttccaccgcgtcatccccgacttcatg 304 ||||||||||| || |||| |||||| ||| ||||| || || |||||| |||||||| Sbjct: 7 agcggcaagccacttcacttcaagggatcctccttccatcgtgtgatccccaacttcatg 66 Query: 305 tgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctacgg 360 || ||||| || ||||||||| || ||||||||||| || || || |||||||| Sbjct: 67 tgtcagggaggtgacttcaccgccgggaacggcaccggaggagaatcgatctacgg 122
>dbj|AB226263.1| Aspergillus oryzae cDNA, contig sequence: AoEST3122 Length = 1101 Score = 56.0 bits (28), Expect = 8e-05 Identities = 76/92 (82%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacggc 337 |||||||| ||||||||| || ||| |||||| || ||||||||| | ||||||||| Sbjct: 432 ttccaccgtgtcatccccagttttatgctccagggaggtgacttcacccgtggcaacggc 491 Query: 338 accggcggcgagtccatctacggcgagaagtt 369 || || || ||||||||||||| |||||||| Sbjct: 492 actggtggtaagtccatctacggtgagaagtt 523
>gb|AF411956.1| Takifugu rubripes lck gene locus, partial sequence Length = 60169 Score = 56.0 bits (28), Expect = 8e-05 Identities = 82/100 (82%) Strand = Plus / Plus Query: 262 ctacaagggcagctcgttccaccgcgtcatccccgacttcatgtgccagggcggcgactt 321 ||||||||||||| ||||| ||| ||||||| | || |||||||| || |||||||| Sbjct: 47447 ctacaagggcagcagcttccatcgcatcatccctcagtttatgtgccaaggtggcgactt 47506 Query: 322 caccaggggcaacggcaccggcggcgagtccatctacggc 361 ||||| |||||||||||| ||| |||| ||||||||| Sbjct: 47507 caccaaccacaacggcaccgggggcaagtctatctacggc 47546
>gb|BC107736.1| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript variant 1, mRNA (cDNA clone MGC:111222 IMAGE:4809032), complete cds Length = 1300 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 580 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 626
>ref|XM_507866.1| PREDICTED: Pan troglodytes similar to Peptidyl-prolyl cis-trans isomerase, mitochondrial precursor (PPIase) (Rotamase) (Cyclophilin F) (LOC450545), mRNA Length = 1020 Score = 54.0 bits (27), Expect = 3e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 298 cttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatcta 357 |||||||||||||| ||||||||||||| ||||||||| ||||| |||||||||| Sbjct: 363 cttcatgtgccaggcgggcgacttcaccaaccacaacggcacaggcgggaagtccatcta 422 Query: 358 cgg 360 ||| Sbjct: 423 cgg 425
>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete sequence Length = 1438950 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 317 gacttcaccaggggcaacggcaccggcggcgagtccatctacggcgagaag 367 ||||| ||||||||| |||| ||||| || ||||||||||| ||||||||| Sbjct: 157435 gactttaccaggggcgacggaaccggtggagagtccatctatggcgagaag 157385
>gb|AC091701.3| Trypanosoma brucei chromosome 8 clone RPCI93-26N11, complete sequence Length = 142253 Score = 54.0 bits (27), Expect = 3e-04 Identities = 74/87 (85%), Gaps = 2/87 (2%) Strand = Plus / Plus Query: 185 gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243 ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || || Sbjct: 76563 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 76621 Query: 244 gagcggcaagccgctgcactacaaggg 270 ||| || ||||||||||| |||||||| Sbjct: 76622 gagtggaaagccgctgcattacaaggg 76648
>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence Length = 2481190 Score = 54.0 bits (27), Expect = 3e-04 Identities = 74/87 (85%), Gaps = 2/87 (2%) Strand = Plus / Plus Query: 185 gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243 ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || || Sbjct: 635476 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 635534 Query: 244 gagcggcaagccgctgcactacaaggg 270 ||| || ||||||||||| |||||||| Sbjct: 635535 gagtggaaagccgctgcattacaaggg 635561
>gb|BC008451.1| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript variant 1, mRNA (cDNA clone MGC:14691 IMAGE:4134572), complete cds Length = 1307 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 584 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 630
>gb|BC004898.2| Homo sapiens peptidylprolyl isomerase E (cyclophilin E), transcript variant 1, mRNA (cDNA clone MGC:3736 IMAGE:3545997), complete cds Length = 1273 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 571 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 617
>gb|DQ160195.1| Homo sapiens cyclophilin-33B mRNA, complete cds, alternatively spliced Length = 1026 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 565 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 611
>ref|XM_820486.1| Trypanosoma brucei TREU927 clone RPCI93-26N11 cyclophilin type peptidyl-prolyl cis-trans isomerase (Tb927.8.2000) partial mRNA Length = 906 Score = 54.0 bits (27), Expect = 3e-04 Identities = 74/87 (85%), Gaps = 2/87 (2%) Strand = Plus / Plus Query: 185 gtgccgaggacggtggagaacttccgcgcgctctgcaccggcgagaaggg-cgtcggcaa 243 ||||||||||| | |||||| ||||| || || ||||| ||||||||||| ||| || || Sbjct: 262 gtgccgaggacagcggagaatttccgtgcactatgcacgggcgagaagggtcgt-gggaa 320 Query: 244 gagcggcaagccgctgcactacaaggg 270 ||| || ||||||||||| |||||||| Sbjct: 321 gagtggaaagccgctgcattacaaggg 347
>gb|AY231875.1| Drosophila yakuba clone yak-em_CG2852 mRNA sequence Length = 315 Score = 54.0 bits (27), Expect = 3e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 307 ccagggcggcgacttcaccaggggcaacggcaccggcgg 345 ||||||||| |||||||||| |||| ||||||||||||| Sbjct: 6 ccagggcggagacttcaccaagggcgacggcaccggcgg 44
>ref|XM_774688.1| Giardia lamblia ATCC 50803 cyclophilin (GLP_170_10820_10314) partial mRNA Length = 507 Score = 54.0 bits (27), Expect = 3e-04 Identities = 72/87 (82%) Strand = Plus / Plus Query: 276 cgttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcaccaggggcaacg 335 |||||||||||||||||||| | |||||| |||||| || |||||||| | |||| Sbjct: 164 cgttccaccgcgtcatccccaagttcatgatccagggtggggacttcacgaaccataacg 223 Query: 336 gcaccggcggcgagtccatctacggcg 362 |||| |||||| |||||||||| |||| Sbjct: 224 gcactggcggcaagtccatctatggcg 250
>emb|CR703044.2|CNS0G5F4 Tetraodon nigroviridis full-length cDNA Length = 1007 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 253 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 312 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 313 ggcgagaagtt 323
>emb|CR700424.2|CNS0G3EC Tetraodon nigroviridis full-length cDNA Length = 1146 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 266 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 325 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 326 ggcgagaagtt 336
>emb|CR698177.2|CNS0G1NX Tetraodon nigroviridis full-length cDNA Length = 975 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 235 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 294 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 295 ggcgagaagtt 305
>emb|CR692157.2|CNS0FX0P Tetraodon nigroviridis full-length cDNA Length = 963 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 221 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 280 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 281 ggcgagaagtt 291
>emb|CR693402.1|CNS0FXZA Tetraodon nigroviridis full-length cDNA Length = 970 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 235 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 294 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 295 ggcgagaagtt 305
>emb|CR691999.2|CNS0FWWB Tetraodon nigroviridis full-length cDNA Length = 1015 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 264 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 323 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 324 ggcgagaagtt 334
>emb|CR684939.2|CNS0FRG7 Tetraodon nigroviridis full-length cDNA Length = 1007 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 254 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 313 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 314 ggcgagaagtt 324
>emb|CR684835.2|CNS0FRDB Tetraodon nigroviridis full-length cDNA Length = 1004 Score = 54.0 bits (27), Expect = 3e-04 Identities = 60/71 (84%) Strand = Plus / Plus Query: 299 ttcatgtgccagggcggcgacttcaccaggggcaacggcaccggcggcgagtccatctac 358 |||||||||||||| || ||||| |||| |||||| || || ||| ||||||||||| Sbjct: 252 ttcatgtgccagggtggggactttaccaaccacaacggaactggaggcaagtccatctac 311 Query: 359 ggcgagaagtt 369 ||||||||||| Sbjct: 312 ggcgagaagtt 322
>emb|AL049824.4|HSJ117L23 Human DNA sequence from clone RP1-117L23 on chromosome 1p33-34.2 Contains part of the PPIE gene for peptidylprolyl isomerase E (cyclophilin E) and the 3' end of the BMP8B gene for bone morphogenetic protein 8b (osteogenic protein 2), complete sequence Length = 19783 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 9172 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 9218
>emb|CR625617.1| full-length cDNA clone CS0DC021YB24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1173 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 535 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 581
>emb|CR617834.1| full-length cDNA clone XCL0BA001ZG09 of Placenta of Homo sapiens (human) Length = 1591 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 561 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 607
>dbj|AK094660.1| Homo sapiens cDNA FLJ37341 fis, clone BRAMY2020713, highly similar to Homo sapiens peptidyl-prolyl cis-trans isomerase E (PPIE) mRNA Length = 2532 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 1848 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 1894
>emb|CR595696.1| full-length cDNA clone CS0DL005YD19 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 829 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 278 ttccaccgcgtcatccccgacttcatgtgccagggcggcgacttcac 324 ||||||||| |||||||| | ||||||||||||||||| || ||||| Sbjct: 144 ttccaccgcatcatcccccagttcatgtgccagggcggtgatttcac 190 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,928,201 Number of Sequences: 3902068 Number of extensions: 1928201 Number of successful extensions: 55816 Number of sequences better than 10.0: 718 Number of HSP's better than 10.0 without gapping: 715 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 52110 Number of HSP's gapped (non-prelim): 3475 length of query: 369 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 347 effective length of database: 17,147,199,772 effective search space: 5950078320884 effective search space used: 5950078320884 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)