ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet61f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 500 e-138
2gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 250 2e-63
3emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 244 1e-61
4dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 244 1e-61
5dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 1e-61
6dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 1e-61
7dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 1e-61
8gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 244 1e-61
9emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 236 3e-59
10dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 236 3e-59
11gb|AY103580.1| Zea mays PCO072544 mRNA sequence 228 7e-57
12dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 228 7e-57
13gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 228 7e-57
14emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 226 3e-56
15ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 218 7e-54
16emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 204 1e-49
17dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 204 1e-49
18dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 204 1e-49
19dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 204 1e-49
20dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 1e-49
21dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 1e-49
22dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 204 1e-49
23emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 196 3e-47
24gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 196 3e-47
25dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 3e-47
26dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 192 4e-46
27dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 188 6e-45
28gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 165 9e-38
29gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 165 9e-38
30gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 165 9e-38
31gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 157 2e-35
32gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 145 8e-32
33dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 143 3e-31
34gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrins... 141 1e-30
35ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 121 1e-24
36dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 121 1e-24
37dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 121 1e-24
38gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 109 5e-21
39dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 100 4e-18
40dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 100 4e-18
41dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 98 2e-17
42gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 94 3e-16
43gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic pro... 90 4e-15
44gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 90 4e-15
45gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 88 2e-14
46gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 88 2e-14
47dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 86 7e-14
48dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 86 7e-14
49emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ... 84 3e-13
50gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 82 1e-12
51ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 80 4e-12
52emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 80 4e-12
53emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 80 4e-12
54gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 80 4e-12
55gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 80 4e-12
56emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 80 4e-12
57gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali... 80 4e-12
58gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 80 4e-12
59gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 80 4e-12
60gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 74 3e-10
61dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 74 3e-10
62ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr... 72 1e-09
63ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0... 72 1e-09
64gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int... 72 1e-09
65emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, c... 72 1e-09
66emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 72 1e-09
67gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int... 72 1e-09
68gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int... 72 1e-09
69gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds 72 1e-09
70emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
71emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
72gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10 72 1e-09
73dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ... 72 1e-09
74gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10 72 1e-09
75ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 66 6e-08
76gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 66 6e-08
77emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 66 6e-08
78gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 66 6e-08
79emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 66 6e-08
80gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 66 6e-08
81gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map... 66 6e-08
82gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 66 6e-08
83gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 66 6e-08
84emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 66 6e-08
85emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 66 6e-08
86emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 66 6e-08
87gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 66 6e-08
88ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 64 2e-07
89ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 64 2e-07
90ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 64 2e-07
91dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 64 2e-07
92dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 64 2e-07
93dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 64 2e-07
94dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 2e-07
95dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 2e-07
96dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 2e-07
97dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 2e-07
98gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 64 2e-07
99ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 62 1e-06
100gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 62 1e-06
101emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 62 1e-06
102emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 62 1e-06
103emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 62 1e-06
104gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 62 1e-06
105gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 62 1e-06
106emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
107emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 62 1e-06
108gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 62 1e-06
109gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 60 4e-06
110emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 58 2e-05
111emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 58 2e-05
112gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 58 2e-05
113gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 58 2e-05
114emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene 58 2e-05
115dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ... 58 2e-05
116ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 56 6e-05
117emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 56 6e-05
118emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 56 6e-05
119gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR... 56 6e-05
120dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei... 56 6e-05
121dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
122dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
123dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
124dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 6e-05
125gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds 54 2e-04
126gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrin... 54 2e-04
127gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 54 2e-04
128gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 54 2e-04
129gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 54 2e-04
130gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi... 54 2e-04
131emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major... 52 0.001
132gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p... 50 0.004
133gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protei... 50 0.004
134dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo... 50 0.004
135ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.015
136gb|AF145708.1|AF145708 Lotus japonicus clone LJ-AQP2 plasma memb... 48 0.015
137gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 46 0.058
138gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 46 0.058
139gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cance... 46 0.058
140gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 46 0.058
141gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 44 0.23
142gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 44 0.23
143gb|AY109332.1| Zea mays CL502_5 mRNA sequence 44 0.23
144ref|XM_760098.1| Theileria parva strain Muguga chaperone protein... 42 0.91
145emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB 42 0.91
146emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 42 0.91
147gb|AC007472.6|AC007472 Drosophila melanogaster, chromosome 2R, r... 42 0.91
148gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma... 42 0.91
149gb|AE003820.3| Drosophila melanogaster chromosome 2R, section 30... 42 0.91
150gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 40 3.6
151ref|NM_193931.1| Oryza sativa (japonica cultivar-group), predic... 40 3.6
152gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 40 3.6
153ref|XM_541613.2| PREDICTED: Canis familiaris similar to Spectrin... 40 3.6
154emb|BX072361.1|CNS09RZX Single read from an extremity of a full-... 40 3.6
155emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-... 40 3.6
156emb|BX068379.1|CNS09OXB Single read from an extremity of a full-... 40 3.6
157emb|BX068378.1|CNS09OXA Single read from an extremity of a full-... 40 3.6
158emb|BX067609.1|CNS09OBX Single read from an extremity of a full-... 40 3.6
159emb|BX067608.1|CNS09OBW Single read from an extremity of a full-... 40 3.6
160emb|BX061944.1|CNS09JYK Single read from an extremity of a full-... 40 3.6
161emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-... 40 3.6
162emb|BX056299.1|CNS09FLR Single read from an extremity of a full-... 40 3.6
163emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-... 40 3.6
164emb|BX055253.1|CNS09ESP Single read from an extremity of a full-... 40 3.6
165emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-... 40 3.6
166emb|BX049557.1|CNS09AEH Single read from an extremity of a full-... 40 3.6
167emb|BX049556.1|CNS09AEG Single read from an extremity of a full-... 40 3.6
168emb|BX049060.1|CNS09A0O Single read from an extremity of a full-... 40 3.6
169emb|BX046605.1|CNS0984H Single read from an extremity of a full-... 40 3.6
170emb|BX046604.1|CNS0984G Single read from an extremity of a full-... 40 3.6
171emb|BX041706.1|CNS094CE Single read from an extremity of a full-... 40 3.6
172emb|BX041977.1|CNS094JX Single read from an extremity of a full-... 40 3.6
173emb|BX041661.1|CNS094B5 Single read from an extremity of a full-... 40 3.6
174emb|BX041260.1|CNS09400 Single read from an extremity of a full-... 40 3.6
175emb|BX039117.1|CNS092CH Single read from an extremity of a full-... 40 3.6
176emb|BX039116.1|CNS092CG Single read from an extremity of a full-... 40 3.6
177emb|BX038773.1|CNS0922X Single read from an extremity of a full-... 40 3.6
178emb|BX038772.1|CNS0922W Single read from an extremity of a full-... 40 3.6
179emb|BX038693.1|CNS0920P Single read from an extremity of a full-... 40 3.6
180emb|BX038692.1|CNS0920O Single read from an extremity of a full-... 40 3.6
181emb|BX038208.1|CNS091N8 Single read from an extremity of a full-... 40 3.6
182emb|BX038207.1|CNS091N7 Single read from an extremity of a full-... 40 3.6
183emb|BX038039.1|CNS091IJ Single read from an extremity of a full-... 40 3.6
184emb|BX038038.1|CNS091II Single read from an extremity of a full-... 40 3.6
185emb|BX037613.1|CNS0916P Single read from an extremity of a full-... 40 3.6
186emb|BX037612.1|CNS0916O Single read from an extremity of a full-... 40 3.6
187emb|BX037577.1|CNS0915P Single read from an extremity of a full-... 40 3.6
188emb|BX037488.1|CNS09138 Single read from an extremity of a full-... 40 3.6
189emb|BX037487.1|CNS09137 Single read from an extremity of a full-... 40 3.6
190emb|BX036984.1|CNS090P8 Single read from an extremity of a full-... 40 3.6
191emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-... 40 3.6
192emb|BX028080.1|CNS08TTW Single read from an extremity of a full-... 40 3.6
193emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-... 40 3.6
194emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-... 40 3.6
195emb|BX024766.1|CNS08R9U Single read from an extremity of a full-... 40 3.6
196emb|BX019545.1|CNS08N8T Single read from an extremity of a full-... 40 3.6
197emb|BX019544.1|CNS08N8S Single read from an extremity of a full-... 40 3.6
198emb|BX021590.1|CNS08OTM Single read from an extremity of a full-... 40 3.6
199emb|BX021589.1|CNS08OTL Single read from an extremity of a full-... 40 3.6
200emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-... 40 3.6
201emb|BX020809.1|CNS08O7X Single read from an extremity of a full-... 40 3.6
202emb|BX012334.1|CNS08HOI Single read from an extremity of a full-... 40 3.6
203emb|BX008016.1|CNS08ECK Single read from an extremity of a full-... 40 3.6
204emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-... 40 3.6
205gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 40 3.6
206gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 3.6
207gb|AY974145.1| Pinus resinosa p-166-5 (p-166-5) mRNA, partial cds 40 3.6
208dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.6
209gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 40 3.6
210gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 40 3.6
211gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 3.6
212dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 40 3.6
213dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane in... 40 3.6
214dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 3.6
215dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.6
216ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913 ... 40 3.6
217ref|NM_211499.1| Eremothecium gossypii AGL230Cp (AGL230C), mRNA 40 3.6
218gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 40 3.6
219dbj|AB028938.1| Roseateles depolymerans DNA for puf operon, comp... 40 3.6

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  500 bits (252), Expect = e-138
 Identities = 258/260 (99%)
 Strand = Plus / Plus

                                                                       
Query: 16  agccgcccatctcgttccgttccagctcaggcgagccagcgaccaccggcctccggcgag 75
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agccgcccatctcgttccgttccagctcaggcgagccagcgaccaccggcctccggcgag 60

                                                                       
Query: 76  ggcagcagcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcgga 135
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggcagcagcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcgga 120

                                                                       
Query: 136 gcggcagcccatcggcacggcggcgcaggggtccgaggacaaggactacaaggagccccc 195
           ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gcggcacgccatcggcacggcggcgcaggggtccgaggacaaggactacaaggagccccc 180

                                                                       
Query: 196 gccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcat 255
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcat 240

                               
Query: 256 cgccgagttcatggccacct 275
           ||||||||||||||||||||
Sbjct: 241 cgccgagttcatggccacct 260



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  250 bits (126), Expect = 2e-63
 Identities = 174/190 (91%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| |||||||||||||| ||||| || || ||||||| ||||||||| ||||||
Sbjct: 1   atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccagccc 60

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||||||||||||||||||  | || |||||||||||||||||||||||||||||||||
Sbjct: 61  atcggcacggcggcgcagggcacggacgacaaggactacaaggagcccccgccggcgccg 120

                                                                       
Query: 206 ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
           || ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 121 ctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgccgagttc 180

                     
Query: 266 atggccacct 275
            | |||||||
Sbjct: 181 gtcgccacct 190



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 125 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 184

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 185 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 244

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 245 catggccacct 255



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                            
Query: 85       gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
                ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 28019923 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 28019982

                                                                            
Query: 145      catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
                 |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 28019983 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 28020042

                                                                            
Query: 205      gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
                |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 28020043 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 28020102

                           
Query: 265      catggccacct 275
                |||||||||||
Sbjct: 28020103 catggccacct 28020113



 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                           
Query: 175     caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
               |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 8907774 caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 8907715

                           
Query: 235     gtccttctaccg 246
               ||||||||||||
Sbjct: 8907714 gtccttctaccg 8907703



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 59  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 118

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 119 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 178

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 179 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 238

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 239 catggccacct 249



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 60  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 119

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 120 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 179

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 180 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 239

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 240 catggccacct 250



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
           insert sequence
          Length = 1462

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 358 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 417

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 418 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 477

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 478 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 537

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 538 catggccacct 548



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score =  244 bits (123), Expect = 1e-61
 Identities = 174/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 125 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 184

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 185 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 244

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 245 catggccacct 255



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  236 bits (119), Expect = 3e-59
 Identities = 173/191 (90%)
 Strand = Plus / Plus

                                                                         
Query: 85    gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
             ||||||||| ||||||||||| || || || || || ||||||| ||||||| |||||||
Sbjct: 27148 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 27207

                                                                         
Query: 145   catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
              |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 27208 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 27267

                                                                         
Query: 205   gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
             |||||||||||| || |||||||||||||||||| |||||||||| || |||||||||||
Sbjct: 27268 gctgttcgagccaggggagctcaagtcgtggtccctctaccgcgcagggatcgccgagtt 27327

                        
Query: 265   catggccacct 275
             |||||||||||
Sbjct: 27328 catggccacct 27338



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  236 bits (119), Expect = 3e-59
 Identities = 173/191 (90%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| ||||||||| | || || || || || ||||||| ||||||| |||||||
Sbjct: 62  gatggaggggaaggaggagaatgtccggctgggagccaacaagttctcggagaggcagcc 121

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            |||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||
Sbjct: 122 gatcggcacggcggcgcagggctccgacgacaaggactacaaggagccgccgccggcgcc 181

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||||| || ||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 182 gctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgccgagtt 241

                      
Query: 265 catggccacct 275
           |||||||||||
Sbjct: 242 catggccacct 252



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  228 bits (115), Expect = 7e-57
 Identities = 174/193 (90%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| || ||||||||||||||||| || || ||||||| ||||||||| ||||||
Sbjct: 434 atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 493

                                                                       
Query: 146 atcggcacggcggcgcaggggtccg---aggacaaggactacaaggagcccccgccggcg 202
           ||||| ||||||||||||||  |||   | ||||||||||||||||||||||||||||||
Sbjct: 494 atcgggacggcggcgcagggcgccgctgacgacaaggactacaaggagcccccgccggcg 553

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           ||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 554 ccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgccgag 613

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 614 ttcgtcgccacct 626



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  228 bits (115), Expect = 7e-57
 Identities = 174/193 (90%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || || || |||| |||||||||||||||||||
Sbjct: 83  atggaggggaaggaggaggacgtgcggctgggcgccaacaggtactcggagcggcagccc 142

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggac---aaggactacaaggagcccccgccggcg 202
           ||||| ||||||||||||||   || ||||   ||||||||||||||||| |||||||||
Sbjct: 143 atcgggacggcggcgcagggcggcggggacgacaaggactacaaggagccgccgccggcg 202

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           ||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 203 ccgctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgccgag 262

                        
Query: 263 ttcatggccacct 275
           ||||| |||||||
Sbjct: 263 ttcatcgccacct 275



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  228 bits (115), Expect = 7e-57
 Identities = 174/193 (90%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| || ||||||||||||||||| || || ||||||| ||||||||| ||||||
Sbjct: 61  atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 120

                                                                       
Query: 146 atcggcacggcggcgcaggggtccg---aggacaaggactacaaggagcccccgccggcg 202
           ||||| ||||||||||||||  |||   | ||||||||||||||||||||||||||||||
Sbjct: 121 atcgggacggcggcgcagggcgccgctgacgacaaggactacaaggagcccccgccggcg 180

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           ||||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 181 ccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgccgag 240

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 241 ttcgtcgccacct 253



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  226 bits (114), Expect = 3e-56
 Identities = 171/190 (90%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| |||||||||||||| ||||| || || ||||||| ||||||||| ||  ||
Sbjct: 61  atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccacgcc 120

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||||||||||||||||||  | || |||||||||||||||||||||||||||||||||
Sbjct: 121 atcggcacggcggcgcagggcacggacgacaaggactacaaggagcccccgccggcgccg 180

                                                                       
Query: 206 ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
           || ||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||
Sbjct: 181 ctcttcgagcccggggagctcaagtcctggtccttctaccgccccggcatcgccgagttc 240

                     
Query: 266 atggccacct 275
            | |||||||
Sbjct: 241 gtcgccacct 250



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  218 bits (110), Expect = 7e-54
 Identities = 143/154 (92%)
 Strand = Plus / Plus

                                                                       
Query: 122 aacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccgaggacaaggac 181
           ||||||| ||||||| ||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 18  aacaagttctcggagaggcagccgatcggcacggcggcgcagggctccgacgacaaggac 77

                                                                       
Query: 182 tacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttc 241
           ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| ||
Sbjct: 78  tacaaggagccgccgccggcgccgctgttcgagccaggggagctcaagtcgtggtccctc 137

                                             
Query: 242 taccgcgccggcatcgccgagttcatggccacct 275
           |||||||| || ||||||||||||||||||||||
Sbjct: 138 taccgcgcagggatcgccgagttcatggccacct 171



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 25  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 84

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 85  atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 144

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 145 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 204

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 205 ttcgtcgccacct 217



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                            
Query: 86       atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
                |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 27062945 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 27063004

                                                                            
Query: 146      atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
                || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 27063005 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 27063064

                                                                            
Query: 203      ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
                |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 27063065 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 27063124

                             
Query: 263      ttcatggccacct 275
                ||| | |||||||
Sbjct: 27063125 ttcgtcgccacct 27063137



 Score =  121 bits (61), Expect = 1e-24
 Identities = 154/185 (83%)
 Strand = Plus / Plus

                                                                            
Query: 86       atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
                |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 35368315 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 35368374

                                                                            
Query: 146      atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
                ||||| ||||||||||||||| | ||||| |||||||||  |||||| ||| ||||||||
Sbjct: 35368375 atcgggacggcggcgcagggggcggaggagaaggactaccgggagccgccggcggcgccg 35368434

                                                                            
Query: 206      ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
                 ||||||||   |  ||||| | ||||||||| |||||||| || || ||||| ||||||
Sbjct: 35368435 gtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagttc 35368494

                     
Query: 266      atggc 270
                 ||||
Sbjct: 35368495 gtggc 35368499



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                         
Query: 86    atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
             |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 34594 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 34653

                                                                         
Query: 146   atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
             || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 34654 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 34713

                                                                         
Query: 203   ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
             |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 34714 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 34773

                          
Query: 263   ttcatggccacct 275
             ||| | |||||||
Sbjct: 34774 ttcgtcgccacct 34786



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                          
Query: 86     atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
              |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 116147 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 116206

                                                                          
Query: 146    atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
              || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 116207 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 116266

                                                                          
Query: 203    ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
              |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 116267 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 116326

                           
Query: 263    ttcatggccacct 275
              ||| | |||||||
Sbjct: 116327 ttcgtcgccacct 116339



to top

>dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-G11, full
           insert sequence
          Length = 1128

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 177

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 178 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 237

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 238 ttcgtcgccacct 250



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 177

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 178 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 237

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 238 ttcgtcgccacct 250



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||||||| 
Sbjct: 113 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 172

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 173 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 232

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 233 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 292

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 293 ttcgtcgccacct 305



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  196 bits (99), Expect = 3e-47
 Identities = 168/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           |||||||||||||||||||||||| ||||| || || |||   ||||||||||| |||||
Sbjct: 81  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 140

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            ||||||||||||||||||||  | ||||| ||||||||||||||||| |||||||||||
Sbjct: 141 aatcggcacggcggcgcagggcacggaggagaaggactacaaggagcctccgccggcgcc 200

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||| | |  ||||| | |||||||||||||||||| ||||| |||||||||||
Sbjct: 201 gctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgccgagtt 260

                      
Query: 265 catggccacct 275
           | |||||||||
Sbjct: 261 cgtggccacct 271



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  196 bits (99), Expect = 3e-47
 Identities = 168/191 (87%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           |||||||||||||||||||||||| ||||| || || |||   ||||||||||| |||||
Sbjct: 72  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 131

                                                                       
Query: 145 catcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgcc 204
            ||||||||||||||||||||  | ||||| ||||||||||||||||| |||||||||||
Sbjct: 132 aatcggcacggcggcgcagggcacggaggagaaggactacaaggagcctccgccggcgcc 191

                                                                       
Query: 205 gctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
           |||||||||| | |  ||||| | |||||||||||||||||| ||||| |||||||||||
Sbjct: 192 gctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgccgagtt 251

                      
Query: 265 catggccacct 275
           | |||||||||
Sbjct: 252 cgtggccacct 262



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  196 bits (99), Expect = 3e-47
 Identities = 170/193 (88%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| || |||||||||| |||||||||| ||| ||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcggccg 117

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 177

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 178 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 237

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 238 ttcgtcgccacct 250



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score =  192 bits (97), Expect = 4e-46
 Identities = 159/179 (88%), Gaps = 3/179 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| |||||||| ||||||   |||||||| ||||||||||||||||||||||| 
Sbjct: 97  atggaggggaaggaggaagacgtgaagctcggggccaacaagtactcggagcggcagccg 156

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||||||||||||||||    || |||||| ||||||||||||||| || |||||||||
Sbjct: 157 atcggcacggcggcgcaga---cccaggacagggactacaaggagccgccaccggcgccg 213

                                                                      
Query: 206 ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
            | ||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 214 tttttcgagcccggtgagctcaagtcatggtccttctaccgtgccggcatcgccgagtt 272



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  188 bits (95), Expect = 6e-45
 Identities = 169/193 (87%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||||||||| |   ||||||||| |||||||||| ||||||| 
Sbjct: 56  atggaggggaaggaggaggacgtgcggccgcgggcgaacaggtactcggagaggcagccg 115

                                                                       
Query: 146 atcggcacggcggcgcaggggtcc---gaggacaaggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||   || |||||||||||||||||||| |||||||||
Sbjct: 116 atagggacggcggcgcagggcgccggggacgacaaggactacaaggagccgccgccggcg 175

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           |||||||||||||| || ||||||||||||||||| |||||||| ||||| |||||||||
Sbjct: 176 ccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgag 235

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 236 ttcgtcgccacct 248



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  165 bits (83), Expect = 9e-38
 Identities = 98/103 (95%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 50  gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggggagctcaagtcc 109

                                                      
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||||||| ||||||||||||||| | |||||||
Sbjct: 110 tggtccttctaccgcgcgggcatcgccgagttcgtcgccacct 152



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 136 gcggcagcccatcggcacggcggcgcaggg 165
           |||||| |||||||| ||||||||||||||
Sbjct: 1   gcggcaacccatcggtacggcggcgcaggg 30



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  165 bits (83), Expect = 9e-38
 Identities = 98/103 (95%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 200 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggggagctcaagtcc 259

                                                      
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||||||| ||||||||||||||| | |||||||
Sbjct: 260 tggtccttctaccgcgcgggcatcgccgagttcgtcgccacct 302



 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| |||||||||||||||||||| || || ||||||| |||||||||||||||
Sbjct: 100 gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 159

                                
Query: 145 catcggcacggcggcgcaggg 165
           |||||||||||||||||||||
Sbjct: 160 catcggcacggcggcgcaggg 180



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  165 bits (83), Expect = 9e-38
 Identities = 98/103 (95%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 195 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggggagctcaagtcc 254

                                                      
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||||||| ||||||||||||||| | |||||||
Sbjct: 255 tggtccttctaccgcgcgggcatcgccgagttcgtcgccacct 297



 Score =  121 bits (61), Expect = 1e-24
 Identities = 76/81 (93%)
 Strand = Plus / Plus

                                                                       
Query: 85  gatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||| |||||||||||||||||||| || || ||||||| |||||||||||||||
Sbjct: 95  gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 154

                                
Query: 145 catcggcacggcggcgcaggg 165
           |||||||||||||||||||||
Sbjct: 155 catcggcacggcggcgcaggg 175



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  157 bits (79), Expect = 2e-35
 Identities = 165/193 (85%), Gaps = 3/193 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| |||||||| ||| |||| || |||||||||| || ||||||  ||||||| 
Sbjct: 53  atggaggggaaggaggaagacttgcggctgggggcgaacaggttctcggaaaggcagccg 112

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaa---ggactacaaggagcccccgccggcg 202
           || || ||||||||||||||  ||| ||||||   ||||||||||||||| |||||||||
Sbjct: 113 atagggacggcggcgcagggcgccggggacaacaaggactacaaggagccgccgccggcg 172

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           ||||| |||||||| || ||||||||||||||||| |||||||| ||||| |||||||| 
Sbjct: 173 ccgcttttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgccgat 232

                        
Query: 263 ttcatggccacct 275
           ||| | |||||||
Sbjct: 233 ttcgtcgccacct 245



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  145 bits (73), Expect = 8e-32
 Identities = 166/194 (85%), Gaps = 6/194 (3%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           ||||||||||||||||||||||||||||| || ||||||   ||||||||||  ||||||
Sbjct: 63  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 122

                                                                       
Query: 146 atcggcacggcggcgcaggg-gtc--cgaggac---aaggactacaaggagcccccgccg 199
           |||||||||||||||||||| | |  || ||||   ||||||||||||||||| || |||
Sbjct: 123 atcggcacggcggcgcagggcggcggcgcggacaaaaaggactacaaggagccgcccccg 182

                                                                       
Query: 200 gcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgcc 259
           || ||  | |||||| |||| |||||||  || |||||||||||||| ||||||||||||
Sbjct: 183 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 242

                         
Query: 260 gagttcatggccac 273
           |||||| |||||||
Sbjct: 243 gagttcctggccac 256



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  143 bits (72), Expect = 3e-31
 Identities = 167/199 (83%), Gaps = 6/199 (3%)
 Strand = Plus / Plus

                                                                       
Query: 83  gcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcag 142
           |||||||||||||||||||||||||||||||| || ||||||   ||||||||||  |||
Sbjct: 75  gcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccag 134

                                                                       
Query: 143 cccatcggcacggcggcgcag------gggtccgaggacaaggactacaaggagcccccg 196
           |||||||||||||||||||||      ||  |||| || ||||||||||||||||| || 
Sbjct: 135 cccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccc 194

                                                                       
Query: 197 ccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatc 256
           ||||| ||  | |||||| |||| |||||||  || |||||||||||||| || || |||
Sbjct: 195 ccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggcagggatc 254

                              
Query: 257 gccgagttcatggccacct 275
           ||||||||| |||||||||
Sbjct: 255 gccgagttcctggccacct 273



to top

>gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrinsic protein 3 (PIP3) mRNA,
           complete cds
          Length = 1271

 Score =  141 bits (71), Expect = 1e-30
 Identities = 167/196 (85%), Gaps = 6/196 (3%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||||||||||||||||||||| || || ||||||   ||||||||||  ||||||
Sbjct: 74  atggagggcaaggaggaggacgtgcggctgggcgcgaaccgctactcggagcaccagccc 133

                                                                       
Query: 146 atcggcacggcggcgcaggg-gtc--cgaggac---aaggactacaaggagcccccgccg 199
           |||||||||||||||||||| | |  || ||||   ||||||||||||||||| || |||
Sbjct: 134 atcggcacggcggcgcagggcggcggcgcggacgagaaggactacaaggagccgcccccg 193

                                                                       
Query: 200 gcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgcc 259
           || ||  | |||||| |||| |||||||  || |||||||||||||| ||||||||||||
Sbjct: 194 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 253

                           
Query: 260 gagttcatggccacct 275
           |||||| |||||||||
Sbjct: 254 gagttcctggccacct 269



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score =  121 bits (61), Expect = 1e-24
 Identities = 154/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 153 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 212

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||| ||||||||||||||| | ||||| |||||||||  |||||| ||| ||||||||
Sbjct: 213 atcgggacggcggcgcagggggcggaggagaaggactaccgggagccgccggcggcgccg 272

                                                                       
Query: 206 ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
            ||||||||   |  ||||| | ||||||||| |||||||| || || ||||| ||||||
Sbjct: 273 gtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagttc 332

                
Query: 266 atggc 270
            ||||
Sbjct: 333 gtggc 337



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score =  121 bits (61), Expect = 1e-24
 Identities = 154/185 (83%)
 Strand = Plus / Plus

                                                                         
Query: 86    atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
             |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 28863 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 28922

                                                                         
Query: 146   atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
             ||||| ||||||||||||||| | ||||| |||||||||  |||||| ||| ||||||||
Sbjct: 28923 atcgggacggcggcgcagggggcggaggagaaggactaccgggagccgccggcggcgccg 28982

                                                                         
Query: 206   ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
              ||||||||   |  ||||| | ||||||||| |||||||| || || ||||| ||||||
Sbjct: 28983 gtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagttc 29042

                  
Query: 266   atggc 270
              ||||
Sbjct: 29043 gtggc 29047



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score =  121 bits (61), Expect = 1e-24
 Identities = 154/185 (83%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 152 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 211

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||| ||||||||||||||| | ||||| |||||||||  |||||| ||| ||||||||
Sbjct: 212 atcgggacggcggcgcagggggcggaggagaaggactaccgggagccgccggcggcgccg 271

                                                                       
Query: 206 ctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagttc 265
            ||||||||   |  ||||| | ||||||||| |||||||| || || ||||| ||||||
Sbjct: 272 gtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagttc 331

                
Query: 266 atggc 270
            ||||
Sbjct: 332 gtggc 336



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score =  109 bits (55), Expect = 5e-21
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||||||||||| |||| | |||||| || |||||||||||||| ||||||||   |||
Sbjct: 170 gacaaggactacacggaggcaccgccgacggcgctgttcgagcccagcgagctctcctcg 229

                                                      
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           |||||||| ||||||||||| |||||||||||||| |||||||
Sbjct: 230 tggtccttttaccgcgccggaatcgccgagttcatagccacct 272



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 154/186 (82%), Gaps = 2/186 (1%)
 Strand = Plus / Plus

                                                                        
Query: 86   atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
            |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 3820 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 3879

                                                                        
Query: 146  atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
            ||||| ||||||||||||||| | ||||| |||||||||  |||| || || ||||||||
Sbjct: 3880 atcgggacggcggcgcagggggcggaggagaaggactaccgggag-ccgcggcggcgccg 3938

                                                                        
Query: 206  ctgttcga-gcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
             ||||||| | | |  ||||| | ||||||||| |||||||| || || ||||| |||||
Sbjct: 3939 gtgttcgacggcggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagtt 3998

                  
Query: 265  catggc 270
            | ||||
Sbjct: 3999 cgtggc 4004



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 154/186 (82%), Gaps = 2/186 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||| ||||||||||| ||| | || |||||||||| |||| ||||| ||||||| 
Sbjct: 133 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 192

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgccg 205
           ||||| ||||||||||||||| | ||||| |||||||||  |||| || || ||||||||
Sbjct: 193 atcgggacggcggcgcagggggcggaggagaaggactaccgggag-ccgcggcggcgccg 251

                                                                       
Query: 206 ctgttcga-gcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagtt 264
            ||||||| | | |  ||||| | ||||||||| |||||||| || || ||||| |||||
Sbjct: 252 gtgttcgacggcggaggagctgacgtcgtggtcgttctaccgggcggggatcgcggagtt 311

                 
Query: 265 catggc 270
           | ||||
Sbjct: 312 cgtggc 317



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 156/191 (81%), Gaps = 3/191 (1%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||||||||| ||||| ||  | || || |||||||||||||| ||| ||||||| 
Sbjct: 88  atggagggcaaggaagaggatgttaggctgggagcgaacaagtactcagagaggcagccg 147

                                                                       
Query: 146 atcggcacggcggcgcaggggtccgaggac---aaggactacaaggagcccccgccggcg 202
           ||||| ||| |||| ||| |    || |||   |||||||||||||| || ||||| || 
Sbjct: 148 atcgggacgtcggctcagagccaggacgacgggaaggactacaaggaaccaccgcctgct 207

                                                                       
Query: 203 ccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgag 262
           || |||||||||||||||||||| | ||| ||||| |||||| | ||||| |||||||||
Sbjct: 208 ccactgttcgagcccggcgagctgacgtcatggtcgttctacagggccgggatcgccgag 267

                      
Query: 263 ttcatggccac 273
           ||||| |||||
Sbjct: 268 ttcatcgccac 278



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtcc 238
           |||||||  ||||||||| ||||||||||||||||| |    ||||||   |||||||||
Sbjct: 313 gactacagcgagcccccggcggcgccgctgttcgaggcgtcggagctctcctcgtggtcc 372

                                              
Query: 239 ttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||||||||||||||||||| |||||||
Sbjct: 373 ttctaccgcgccggcatcgccgagttcgtggccac 407



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 132 cggagcggcagcccatcggcacggcggcg 160
           |||||||||||||||||||||||||||||
Sbjct: 269 cggagcggcagcccatcggcacggcggcg 297



to top

>gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic protein mRNA, partial
           cds
          Length = 604

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||||||||| || ||||| ||||| |||||||| |||||||| | ||| ||
Sbjct: 93  caaggactacaaggagcctcccccggcaccgctcttcgagccaggcgagctgacgtcatg 152

                                                    
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||| || ||| | ||||| |||||||||||||| |||||||
Sbjct: 153 gtcgttttacagggccgggatcgccgagttcatcgccacct 193



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           ||||||| ||||||||| || ||| || | || || ||||||||| ||||| ||||||||
Sbjct: 1   atggaggccaaggaggaagatgtgagcttgggagccaacaagtacccggagaggcagccc 60

                
Query: 146 atcgg 150
           |||||
Sbjct: 61  atcgg 65



to top

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||| |||||||||||||| || || |||||| |||||||||||||||||||   ||||
Sbjct: 100 gacaaagactacaaggagccgcctcctgcgccgttgttcgagcccggcgagcttgcgtcg 159

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | ||||| |||||||||||||| |||||
Sbjct: 160 tggtccttctggagagccggaatcgccgagttcatcgccac 200



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 188 gagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgc 247
           ||||| || ||||| ||| |||| |||||||||||||| |  |||||||| |||||||||
Sbjct: 185 gagccgccaccggcaccgttgtttgagcccggcgagctgagctcgtggtctttctaccgc 244

                               
Query: 248 gccggcatcgccgagttcat 267
           ||||||||||||||||||||
Sbjct: 245 gccggcatcgccgagttcat 264



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 84  cgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagc 143
           |||||||||| |||||||| |||||| |  | || || ||||||| ||||||||||||||
Sbjct: 87  cgatggaggggaaggaggaagacgtgaggttgggagcaaacaagttctcggagcggcagc 146

                              
Query: 144 ccatcggcacggcggcgca 162
           | ||||| ||| |||||||
Sbjct: 147 cgatcgggacgtcggcgca 165



to top

>gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipD) mRNA, complete cds
          Length = 1135

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 176 aaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtgg 235
           ||||||||||||||||| || |||||||||||||||||||| |  ||||||||||| |||
Sbjct: 146 aaggactacaaggagccaccaccggcgccgctgttcgagccggatgagctcaagtcctgg 205

                                                   
Query: 236 tccttctaccgcgccggcatcgccgagttcatggccacct 275
           || || ||| | || ||  ||||||||||||| |||||||
Sbjct: 206 tcgttttacagagctgggctcgccgagttcatcgccacct 245



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtcc 238
           |||||||| ||||| |||||||| || |||||||||||||| ||||| | ||| ||||| 
Sbjct: 180 gactacaaagagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 239

                                              
Query: 239 ttctaccgcgccggcatcgccgagttcatggccac 273
           |||||| | ||||| |||||||||||||| |||||
Sbjct: 240 ttctacagggccgggatcgccgagttcatcgccac 274



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
           1-1, complete cds
          Length = 1351

 Score = 85.7 bits (43), Expect = 7e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtcc 238
           |||||||||||||| |||||||| || |||||||||||||| ||||| | ||| ||||| 
Sbjct: 321 gactacaaggagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 380

                                              
Query: 239 ttctaccgcgccggcatcgccgagttcatggccac 273
           || ||| | ||||| |||||||||||||| |||||
Sbjct: 381 ttttacagggccgggatcgccgagttcatcgccac 415



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 86  atggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagccc 145
           |||||||||||||| ||||| ||  | || || |||||||||| ||||||| ||||||| 
Sbjct: 225 atggagggcaaggaagaggatgttaggctgggagcgaacaagttctcggagaggcagccg 284

                
Query: 146 atcgg 150
           |||||
Sbjct: 285 atcgg 289



to top

>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb
          Length = 1179

 Score = 83.8 bits (42), Expect = 3e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||| ||||| |||||||| || ||||||||||||||||| || |||||
Sbjct: 142 ggacaaagactacaaagagccgccgccggctccactgttcgagcccggcgaactaaagtc 201

                                                     
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
            ||||| || ||| | || || |||||||||||| |||||||
Sbjct: 202 atggtctttttacagggctggtatcgccgagttcgtggccac 243



to top

>gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1135

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 128/157 (81%)
 Strand = Plus / Plus

                                                                       
Query: 119 gcgaacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccgaggacaag 178
           |||||||||||||||||  |||| || ||||| ||  | ||||||  | | || ||||||
Sbjct: 71  gcgaacaagtactcggaaaggcaaccgatcggaacatcagcgcagatgacggaagacaag 130

                                                                       
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtcc 238
           |||||||| ||||| || || || ||  | ||||||||||| ||||||||||||||||||
Sbjct: 131 gactacaaagagccacctcccgcccctttcttcgagcccggagagctcaagtcgtggtcc 190

                                                
Query: 239 ttctaccgcgccggcatcgccgagttcatggccacct 275
           || ||| | || || ||||| || |||||||||||||
Sbjct: 191 ttttacagagctggaatcgctgaattcatggccacct 227



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 207 ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 266

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 267 gtggtccttctacagagccggaatcgccgagttcatagccacct 310



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 113 ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 172

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 173 gtggtccttctacagagccggaatcgccgagttcatagccacct 216



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 94  ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 153

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 154 gtggtccttctacagagccggaatcgccgagttcatagccacct 197



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 135 ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 194

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 195 gtggtccttctacagagccggaatcgccgagttcatagccacct 238



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 81  ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 140

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 141 gtggtccttctacagagccggaatcgccgagttcatagccacct 184



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 125 ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 184

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 185 gtggtccttctacagagccggaatcgccgagttcatagccacct 228



to top

>gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 66131

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                         
Query: 172   ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
             |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 64203 ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 64144

                                                         
Query: 232   gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
             ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 64143 gtggtccttctacagagccggaatcgccgagttcatagccacct 64100



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           |||||| |||||||||||||| || || || ||  | |||||||| |||||||| |  ||
Sbjct: 81  ggacaaagactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttc 140

                                                       
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||||||||||| | ||||| |||||||||||||| |||||||
Sbjct: 141 gtggtccttctacagagccggaatcgccgagttcatagccacct 184



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 79.8 bits (40), Expect = 4e-12
 Identities = 129/158 (81%), Gaps = 3/158 (1%)
 Strand = Plus / Plus

                                                                       
Query: 119 gcgaacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccgaggac--- 175
           |||||||||| ||||||| ||||||||||||| |||||||| ||| |    || |||   
Sbjct: 89  gcgaacaagttctcggagaggcagcccatcgggacggcggctcagagccaagacgacggc 148

                                                                       
Query: 176 aaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtgg 235
           ||||||||| ||||||| || |||||||| |||||||| ||    ||||| | |||||||
Sbjct: 149 aaggactaccaggagccaccaccggcgccactgttcgaaccatctgagctgacgtcgtgg 208

                                                 
Query: 236 tccttctaccgcgccggcatcgccgagttcatggccac 273
           || |||||| | ||||| |||||||||||| |||||||
Sbjct: 209 tcgttctacagagccggtatcgccgagttcgtggccac 246



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 90/107 (84%), Gaps = 3/107 (2%)
 Strand = Plus / Plus

                                                                       
Query: 119 gcgaacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccgaggacaag 178
           |||||||||| ||| ||| ||||||| || || |||||||| |||||    || ||||||
Sbjct: 62  gcgaacaagttctcagagaggcagccgatagggacggcggctcaggga---gatgacaag 118

                                                          
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           ||||||||||| || || |||||||||||||||||||| || |||||
Sbjct: 119 gactacaaggaaccgccaccggcgccgctgttcgagcctggagagct 165



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || |||||  |||||||||||||||||||    |||
Sbjct: 103 gacaaggactacaaggagccacctcctgcgcccttgttcgagcccggcgagcttgcttcg 162

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | ||||| ||||| |||||||| |||||
Sbjct: 163 tggtccttctggagagccgggatcgctgagttcatcgccac 203



to top

>ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) transcript variant
           AT4G00430.2 mRNA, complete cds
          Length = 1367

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 171 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 230

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 231 tggtctttctac 242



to top

>ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G00430 (TMP-C)
           transcript variant AT4G00430.1 mRNA, complete cds
          Length = 1643

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 171 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 230

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 231 tggtctttctac 242



to top

>gb|BT000330.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1331

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 85  gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 144

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 145 tggtctttctac 156



to top

>emb|AL161471.2|ATCHRIV1 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 1
          Length = 197119

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                          
Query: 173    gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
              |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 186447 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 186388

                          
Query: 233    tggtccttctac 244
              ||||| ||||||
Sbjct: 186387 tggtctttctac 186376



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 112 cctcggggcgaacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccga 171
           |||||| || ||||||||||||||| ||||||| || || |||||||| |||     |||
Sbjct: 12  cctcggagccaacaagtactcggagaggcagccgattggtacggcggctcagacccacga 71

                                                                   
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctca 227
            |||||||||||||||||||| || || |||||  |||| |||||||| |||||||
Sbjct: 72  tgacaaggactacaaggagccgccacctgcgcccttgtttgagcccggtgagctca 127



to top

>gb|AY120785.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1083

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 163 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 222

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 223 tggtctttctac 234



to top

>gb|AY099825.1| Arabidopsis thaliana probable plasma membrane intrinsic protein 1c
           (At4g00430) mRNA, complete cds
          Length = 1631

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 159 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 218

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 219 tggtctttctac 230



to top

>gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds
          Length = 864

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 85  gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 144

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 145 tggtctttctac 156



to top

>emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZD01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1155

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 148 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 207

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 208 tggtctttctac 219



to top

>emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1000

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 146 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 205

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 206 tggtctttctac 217



to top

>gb|AF195115.1|F5I10 Arabidopsis thaliana BAC F5I10
          Length = 111906

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                         
Query: 173   gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
             |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 86966 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 86907

                         
Query: 233   tggtccttctac 244
             ||||| ||||||
Sbjct: 86906 tggtctttctac 86895



to top

>dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 218 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 277

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 278 tggtctttctac 289



to top

>gb|AF013293.1|IG005I10 Arabidopsis thaliana BAC IG005I10
          Length = 111906

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                         
Query: 173   gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
             |||||||||||||| ||||| || || ||||| ||||||||||||||||||||||  || 
Sbjct: 24941 gacaaggactacaaagagccacctcctgcgccactgttcgagcccggcgagctcagctca 25000

                         
Query: 233   tggtccttctac 244
             ||||| ||||||
Sbjct: 25001 tggtctttctac 25012



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 221 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 273



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || ||||| ||||| ||||| ||||| |||||    || 
Sbjct: 104 gacaaggactacaaggagccaccaccggcaccgcttttcgatcccggtgagctgtcctca 163

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||| |||||| | || ||||| ||||||||||| |||||
Sbjct: 164 tggtcgttctacagagctggcatagccgagttcatagccac 204



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||||||||||||||||||    |||
Sbjct: 119 gacaaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcg 178

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | || || |||||||||||||| |||||
Sbjct: 179 tggtccttctggagagcaggaatcgccgagttcatcgccac 219



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 82  gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 134



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 136 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 188



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 142 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 194



to top

>gb|AC004665.3| Arabidopsis thaliana chromosome 2 clone F4I18 map CIC02E07, complete
             sequence
          Length = 101647

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 173   gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
             |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 16386 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 16334



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 142 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 194



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||||||||||||||||||    |||
Sbjct: 118 gacaaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcg 177

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | || || |||||||||||||| |||||
Sbjct: 178 tggtccttctggagagcaggaatcgccgagttcatcgccac 218



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 122 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 174



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 127 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 179



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 114 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 166



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 142 gacaaggactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 194



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 161 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 219

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 220 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 259



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 163 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 221

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 222 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 261



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 164 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 222

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 223 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 262



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                            
Query: 175      caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
                ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 15353025 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 15353083

                                                        
Query: 234      ggtccttctaccgcgccggcatcgccgagttcatggccac 273
                ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 15353084 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 15353123



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 232      gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
                ||||||| | |||||||||| ||||||||||||| |||||||
Sbjct: 15315657 gtggtccctgtaccgcgccgtcatcgccgagttcgtggccac 15315698



 Score = 48.1 bits (24), Expect = 0.015
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 242      taccgcgccggcatcgccgagttcatggccac 273
                |||||||||| ||||||||||||| |||||||
Sbjct: 15323525 taccgcgccgtcatcgccgagttcgtggccac 15323556



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                         
Query: 175   caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
             ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 60024 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 60082

                                                     
Query: 234   ggtccttctaccgcgccggcatcgccgagttcatggccac 273
             ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 60083 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 60122



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 232   gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
             ||||||| | |||||||||| ||||||||||||| |||||||
Sbjct: 22656 gtggtccctgtaccgcgccgtcatcgccgagttcgtggccac 22697



 Score = 48.1 bits (24), Expect = 0.015
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 242   taccgcgccggcatcgccgagttcatggccac 273
             |||||||||| ||||||||||||| |||||||
Sbjct: 30524 taccgcgccgtcatcgccgagttcgtggccac 30555



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                          
Query: 175    caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
              ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 139038 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 139096

                                                      
Query: 234    ggtccttctaccgcgccggcatcgccgagttcatggccac 273
              ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 139097 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 139136



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                        
Query: 232    gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
              ||||||| | |||||||||| ||||||||||||| |||||||
Sbjct: 101670 gtggtccctgtaccgcgccgtcatcgccgagttcgtggccac 101711



 Score = 48.1 bits (24), Expect = 0.015
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 242    taccgcgccggcatcgccgagttcatggccac 273
              |||||||||| ||||||||||||| |||||||
Sbjct: 109538 taccgcgccgtcatcgccgagttcgtggccac 109569



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 161 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 219

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 220 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 259



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 161 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 219

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 220 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 259



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 163 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 221

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 222 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 261



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 164 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 222

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 223 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 262



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 85/100 (85%), Gaps = 2/100 (2%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcg-agctcaagtcgt 233
           ||||||||||| ||| || ||||||||||||||| |||| | ||||| ||||   |||||
Sbjct: 151 caaggactacacggacccgccgccggcgccgctgatcga-cgcggcggagctggggtcgt 209

                                                   
Query: 234 ggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||  | |||||||||| ||||||||||||||| |||||
Sbjct: 210 ggtcgctgtaccgcgccgtcatcgccgagttcatcgccac 249



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 136 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 195

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 196 gtctttctacagagcagggatagctgagttcatagccac 234



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 171 aggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagt 230
           ||||||||||||||||||| || || |||||||| || |||||||| || |||||    |
Sbjct: 100 aggacaaggactacaaggaaccaccaccggcgccacttttcgagccgggtgagctgtcct 159

                                                      
Query: 231 cgtggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||| |||||| | || ||||| || |||||||| |||||
Sbjct: 160 cgtggtcgttctacagagctggcatagcagagttcatagccac 202



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                         
Query: 175   caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
             ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 74460 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 74519

                                                    
Query: 235   gtccttctaccgcgccggcatcgccgagttcatggccac 273
             ||| |||||| | || || || || |||||||| |||||
Sbjct: 74520 gtctttctacagagcagggatagctgagttcatagccac 74558



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                         
Query: 175   caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
             ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 32928 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 32987

                                                    
Query: 235   gtccttctaccgcgccggcatcgccgagttcatggccac 273
             ||| |||||| | || || || || |||||||| |||||
Sbjct: 32988 gtctttctacagagcagggatagctgagttcatagccac 33026



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || ||||| |||||||| ||||| ||||| || |  || 
Sbjct: 176 gacaaggactacaaggagccacccccggcaccgctgtttgagccaggcgaactgacttca 235

                                                      
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccacct 275
           ||||| || ||| | || || || || ||||||||||||||||
Sbjct: 236 tggtctttttacagggctggtattgcagagttcatggccacct 278



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 87  caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 146

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 147 gtctttctacagagcagggatagctgagttcatagccac 185



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 136 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 195

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 196 gtctttctacagagcagggatagctgagttcatagccac 234



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 125 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 184

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 185 gtctttctacagagcagggatagctgagttcatagccac 223



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 100 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 159

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 160 gtctttctacagagcagggatagctgagttcatagccac 198



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||| ||||| || || ||||||||| | ||||| |||||||||||||| || ||
Sbjct: 134 caaggactataaggaaccaccaccggcgccgtttttcgaacccggcgagctcaaatcttg 193

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||| |||||| | || || || || |||||||| |||||
Sbjct: 194 gtctttctacagagcagggatagctgagttcatagccac 232



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 ggacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtc 231
           ||||||||||||||||||||| || || || ||  |||| |||||||| ||| | |||||
Sbjct: 137 ggacaaggactacaaggagccaccaccagcacccttgtttgagcccggggagttgaagtc 196

                                                     
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
            ||||| || ||| | ||||| || || ||||||||||||||
Sbjct: 197 atggtctttttacagagccgggattgctgagttcatggccac 238



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||| ||||||||||||||
Sbjct: 141 gacaaggactacaaagagccaccacctgcgccgttgttagagcccggcgagct 193



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||||||||| ||||||||    || 
Sbjct: 100 gacaaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcc 159

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | ||||| |||||||||||||| |||||
Sbjct: 160 tggtccttctggagagccggtatcgccgagttcatcgccac 200



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 128/161 (79%)
 Strand = Plus / Plus

                                                                       
Query: 113 ctcggggcgaacaagtactcggagcggcagcccatcggcacggcggcgcaggggtccgag 172
           ||||| ||||||||||   ||||| ||||||| || || ||||| || |||||  | | |
Sbjct: 28  ctcggagcgaacaagtttgcggagaggcagcctattgggacggctgcccagggtgcgggg 87

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||||||  | || || ||||||||||| || ||  |    |||
Sbjct: 88  gacaaggactacaaagagccccccgcagcccctctgttcgagcctggtgaattgtcctcg 147

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||| ||||| || || ||||| |||||||||||||||||
Sbjct: 148 tggtcgttctatcgtgctggcattgccgagttcatggccac 188



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||||||||| ||||||||    || 
Sbjct: 101 gacaaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcc 160

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | ||||| |||||||||||||| |||||
Sbjct: 161 tggtccttctggagagccggtatcgccgagttcatcgccac 201



to top

>emb|Z17399.1|ATORFB Arabidopsis thaliana PIP1b gene
          Length = 2773

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || || |||||| |||| ||||||||||||||
Sbjct: 387 gacaaggactacaaagagccaccacctgcgccgttgttagagcccggcgagct 439



to top

>dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane aquaporin 1c,
           complete cds
          Length = 1074

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||||||||| ||||||||    || 
Sbjct: 108 gacaaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcc 167

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||||   | ||||| |||||||||||||| |||||
Sbjct: 168 tggtccttctggagagccggtatcgccgagttcatcgccac 208



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 42  caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 101

                       
Query: 235 gtccttctaccg 246
           ||||||||||||
Sbjct: 102 gtccttctaccg 113



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Minus

                                                                         
Query: 175   caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
             |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 92083 caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 92024

                         
Query: 235   gtccttctaccg 246
             ||||||||||||
Sbjct: 92023 gtccttctaccg 92012



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 154/196 (78%)
 Strand = Plus / Plus

                                                                       
Query: 80  gcagcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcgg 139
           |||| ||||||||||||||||||||| ||    || || || ||||||| ||| ||| ||
Sbjct: 5   gcagagatggagggcaaggaggaggatgtcaaacttggagctaacaagttctcagagagg 64

                                                                       
Query: 140 cagcccatcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccg 199
           |||||||| ||||| || || |||     ||| |||| ||||||||||||||| || || 
Sbjct: 65  cagcccattggcacagcagcacagaccggcgatgacagggactacaaggagccgccccca 124

                                                                       
Query: 200 gcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgcc 259
           || || ||||  ||||| || |||||||  || |||||||||||| | || || || || 
Sbjct: 125 gctcctctgtatgagccaggagagctcatctcatggtccttctacagggctggtatagca 184

                           
Query: 260 gagttcatggccacct 275
           ||||||||||| ||||
Sbjct: 185 gagttcatggcgacct 200



to top

>gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mRNA, complete cds
          Length = 1136

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||||||||| || || || ||  |||| ||||| || |||||||| || 
Sbjct: 144 gacaaggactacaaggagccaccaccagctcctttgtttgagcctggtgagctcaaatca 203

                       
Query: 233 tggtccttctac 244
           ||||||||||||
Sbjct: 204 tggtccttctac 215



to top

>dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protein, complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||||| || || ||| | |||||||||||||| |||||||  || 
Sbjct: 122 gacaaggactacaaagagccacctcctgcgtcactgttcgagcccggtgagctcagctca 181

                       
Query: 233 tggtccttctac 244
           ||||| ||||||
Sbjct: 182 tggtctttctac 193



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 28  caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 87

                       
Query: 235 gtccttctaccg 246
           ||||||||||||
Sbjct: 88  gtccttctaccg 99



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 141 caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 200

                       
Query: 235 gtccttctaccg 246
           ||||||||||||
Sbjct: 201 gtccttctaccg 212



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 135 caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 194

                       
Query: 235 gtccttctaccg 246
           ||||||||||||
Sbjct: 195 gtccttctaccg 206



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||||||||   ||||||||||  |  |||
Sbjct: 129 caaggactacaccgacccgccgccggcgccgctgttcgacgtcggcgagctccggctgtg 188

                       
Query: 235 gtccttctaccg 246
           ||||||||||||
Sbjct: 189 gtccttctaccg 200



to top

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 130 gactacaaggagccaccaccagcgccgctgtttgagcccggagagct 176



to top

>gb|DQ451602.1| Salicornia bigelovii plasma membrane major intrinsic protein (PIP1)
           mRNA, complete cds
          Length = 1268

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| ||||||||||| ||||| || |||||
Sbjct: 170 gactacaaggagccaccgccagcgccgctgtttgagccaggggagct 216



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||||| ||| || ||||||||||||||  ||||  | |  |||||||    |||
Sbjct: 128 caaggactacacggaccctccgccggcgccgctcatcgacgcggatgagctcaccaagtg 187

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           |||| |||||||||| | ||||||||||||||| |||||
Sbjct: 188 gtccctctaccgcgcggtcatcgccgagttcatcgccac 226



to top

>gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete sequence
          Length = 1193

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 179 gactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 224 gactacaaagagccaccacctgcgccgttgttcgagcccggcgagct 270



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||||| ||| || |||||||| |||||| ||||  | | ||||||    || ||
Sbjct: 125 caaggactacacggacccgccgccggccccgctgatcgacgcggccgagctggcctcctg 184

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           |||  |||||||||||| ||||||||||||||| |||||
Sbjct: 185 gtcgctctaccgcgccgtcatcgccgagttcatcgccac 223



to top

>gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mip-1) mRNA, complete cds
          Length = 1213

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagccc 217
           |||||||||| ||| ||| ||||||||||||||||| ||||||
Sbjct: 124 caaggactaccaggcgccaccgccggcgccgctgtttgagccc 166



to top

>emb|AJ001292.1|CPPIPA2 Craterostigma plantagineum mRNA for major intrinsic protein PIPa2
          Length = 1189

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 149/190 (78%)
 Strand = Plus / Plus

                                                                       
Query: 84  cgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcagc 143
           ||||||||| ||| || || |||||  | ||||| || ||||||| ||||||| || | |
Sbjct: 64  cgatggaggccaaagaagaagacgttagactcggcgccaacaagttctcggagaggaacc 123

                                                                       
Query: 144 ccatcggcacggcggcgcaggggtccgaggacaaggactacaaggagcccccgccggcgc 203
           | || ||||||||||| |||     ||| |||||||||||||  ||||| ||||||||||
Sbjct: 124 caataggcacggcggctcagacccacgacgacaaggactacacagagccaccgccggcgc 183

                                                                       
Query: 204 cgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatcgccgagt 263
           |||| || ||||| || || || |  || |||||||| ||| | || || || || ||||
Sbjct: 184 cgctctttgagccaggggaactgagctcttggtccttttacagggctgggatagctgagt 243

                     
Query: 264 tcatggccac 273
           ||||||||||
Sbjct: 244 tcatggccac 253



to top

>gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic protein (PIP) mRNA,
           complete cds
          Length = 1254

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                       
Query: 176 aaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtgg 235
           ||||||||||||||||| || || || || ||||||||||||  ||||||||  || |||
Sbjct: 178 aaggactacaaggagccaccacctgcaccactgttcgagcccaacgagctcacctcttgg 237

                    
Query: 236 tccttctac 244
           || ||||||
Sbjct: 238 tctttctac 246



to top

>gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protein homolog (pip) mRNA,
           partial cds
          Length = 528

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 229 gtcgtggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||||| |||||| | ||||| |||||||||||| |||||||
Sbjct: 24  gtcgtggtcgttctacagagccggtatcgccgagttcgtggccac 68



to top

>dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquaporin (PAQ1),
           complete cds
          Length = 1113

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           |||||||||||||| ||||| || ||||| || ||||||||||| || |||||
Sbjct: 144 gacaaggactacaacgagccaccaccggctcctctgttcgagcctggtgagct 196



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 242 taccgcgccggcatcgccgagttcatggccac 273
           |||||||||| ||||||||||||| |||||||
Sbjct: 103 taccgcgccgtcatcgccgagttcgtggccac 134



to top

>gb|AF145708.1|AF145708 Lotus japonicus clone LJ-AQP2 plasma membrane intrinsic protein
           homolog (PIP) mRNA, partial cds
          Length = 578

 Score = 48.1 bits (24), Expect = 0.015
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 182 tacaaggagcccccgccggcgccgctgttcgagcccggcgagct 225
           ||||| ||||| || || |||||| |||||||||||||||||||
Sbjct: 1   tacaaagagccaccacctgcgccgttgttcgagcccggcgagct 44



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 80/99 (80%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           ||||||||||| ||| || || |||||||||||| ||||  | | ||||||   ||| ||
Sbjct: 107 caaggactacacggaccctcccccggcgccgctgatcgacgcggccgagctggggtcctg 166

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           |||  | ||||||||||  |||||||||||||| |||||
Sbjct: 167 gtcgctgtaccgcgccgtgatcgccgagttcatcgccac 205



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 80/99 (80%)
 Strand = Plus / Plus

                                                                       
Query: 175 caaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcgtg 234
           |||||||||||  || || ||||||||||||||| ||||  | |  |||||||    |||
Sbjct: 146 caaggactacaccgaccctccgccggcgccgctggtcgacgcggaggagctcacccagtg 205

                                                  
Query: 235 gtccttctaccgcgccggcatcgccgagttcatggccac 273
           |||| | |||||||| | ||||||||||||||| |||||
Sbjct: 206 gtccctgtaccgcgcggtcatcgccgagttcatcgccac 244



to top

>gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 178502

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 51    ccagcgaccaccggcctccggcg 73
             |||||||||||||||||||||||
Sbjct: 93695 ccagcgaccaccggcctccggcg 93717



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 46.1 bits (23), Expect = 0.058
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 221 gagctcaagtcgtggtccttctaccgcgccggcatcgccgagttcat 267
           ||||||||||||||||| |||||| | ||   |||||||||||||||
Sbjct: 91  gagctcaagtcgtggtctttctacagagctctcatcgccgagttcat 137



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||| | ||||||||||  |||||||||||| |||||||
Sbjct: 195 gtggtccctgtaccgcgccgtgatcgccgagttcgtggccac 236



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 175 caaggactacaaggagcccccgccggcgccgctg 208
           ||||||||||| ||| || |||||||||||||||
Sbjct: 173 caaggactacacggacccgccgccggcgccgctg 206



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 232 gtggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||||| | ||||||||||  |||||||||||| |||||||
Sbjct: 885 gtggtccctgtaccgcgccgtgatcgccgagttcgtggccac 926



to top

>ref|XM_760098.1| Theileria parva strain Muguga chaperone protein DnaJ (TP02_0625)
           partial mRNA
          Length = 1089

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 10  caccaaagccgcccatctcgt 30
           |||||||||||||||||||||
Sbjct: 501 caccaaagccgcccatctcgt 481



to top

>emb|AL591985.1|RME591985 Sinorhizobium meliloti 1021 complete pSymB
          Length = 1683333

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 80     gcagcgatggagggcaaggag 100
              |||||||||||||||||||||
Sbjct: 296649 gcagcgatggagggcaaggag 296669



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           |||||||||||||| ||| | ||||| || ||  |||| ||||| || || |||||||| 
Sbjct: 157 gacaaggactacaaagaggcgccgccagctcctttgtttgagcctggtgaactcaagtca 216

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           |||||||| ||| | || || || || |||||||| |||||
Sbjct: 217 tggtccttttacagggctggtattgctgagttcatagccac 257



to top

>gb|AC007472.6|AC007472 Drosophila melanogaster, chromosome 2R, region 49E-49F, BAC clone
              BACR30D19, complete sequence
          Length = 163052

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 162    aggggtccgaggacaaggactacaa 186
              |||||||||||||| ||||||||||
Sbjct: 143678 aggggtccgaggacgaggactacaa 143654



to top

>gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1b) mRNA, complete cds
          Length = 1119

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 81/101 (80%)
 Strand = Plus / Plus

                                                                       
Query: 173 gacaaggactacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaagtcg 232
           ||||||||||||||||| |  || || || ||  |||| |||||||| ||| | ||||| 
Sbjct: 139 gacaaggactacaaggatctaccaccagcacccttgtttgagcccggggagttgaagtca 198

                                                    
Query: 233 tggtccttctaccgcgccggcatcgccgagttcatggccac 273
           ||||| || ||| | ||||| || || ||||||||||||||
Sbjct: 199 tggtctttttacagagccgggattgctgagttcatggccac 239



to top

>gb|AE003820.3| Drosophila melanogaster chromosome 2R, section 30 of 73 of the complete
              sequence
          Length = 263912

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 162    aggggtccgaggacaaggactacaa 186
              |||||||||||||| ||||||||||
Sbjct: 212890 aggggtccgaggacgaggactacaa 212866



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 ccgccggcgccgctgttcga 213
           ||||||||||||||||||||
Sbjct: 139 ccgccggcgccgctgttcga 158



to top

>ref|NM_193931.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 492

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 75  gggcagcagcgatggagggc 94
           ||||||||||||||||||||
Sbjct: 445 gggcagcagcgatggagggc 464



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 242 taccgcgccggcatcgccgagttcatggccac 273
           ||||||||||  |||||||||||||| |||||
Sbjct: 122 taccgcgccgtgatcgccgagttcatcgccac 153



to top

>ref|XM_541613.2| PREDICTED: Canis familiaris similar to Spectrin beta chain, brain 3
            (Spectrin, non-erythroid beta chain 3) (Beta-IV spectrin)
            (LOC484499), mRNA
          Length = 8696

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 39   agctcaggcgagccagcgaccacc 62
            ||||||||||||||||| ||||||
Sbjct: 5362 agctcaggcgagccagccaccacc 5339



to top

>emb|BX072361.1|CNS09RZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 141 ggagggcaaggaggaggacg 122



to top

>emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 387 ggagggcaaggaggaggacg 406



to top

>emb|BX068379.1|CNS09OXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX068378.1|CNS09OXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 497 ggagggcaaggaggaggacg 516



to top

>emb|BX067609.1|CNS09OBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 291 ggagggcaaggaggaggacg 272



to top

>emb|BX067608.1|CNS09OBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 489 ggagggcaaggaggaggacg 508



to top

>emb|BX061944.1|CNS09JYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 299 ggagggcaaggaggaggacg 280



to top

>emb|BX056299.1|CNS09FLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 302 ggagggcaaggaggaggacg 283



to top

>emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 239 ggagggcaaggaggaggacg 220



to top

>emb|BX055253.1|CNS09ESP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 484 ggagggcaaggaggaggacg 503



to top

>emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 203 ggagggcaaggaggaggacg 184



to top

>emb|BX049557.1|CNS09AEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 251 ggagggcaaggaggaggacg 232



to top

>emb|BX049556.1|CNS09AEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 468 ggagggcaaggaggaggacg 487



to top

>emb|BX049060.1|CNS09A0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX046605.1|CNS0984H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX046604.1|CNS0984G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 926 ggagggcaaggaggaggacg 945



to top

>emb|BX041706.1|CNS094CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 253 ggagggcaaggaggaggacg 234



to top

>emb|BX041977.1|CNS094JX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 464 ggagggcaaggaggaggacg 483



to top

>emb|BX041661.1|CNS094B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 483 ggagggcaaggaggaggacg 502



to top

>emb|BX041260.1|CNS09400 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 510 ggagggcaaggaggaggacg 529



to top

>emb|BX039117.1|CNS092CH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 345 ggagggcaaggaggaggacg 326



to top

>emb|BX039116.1|CNS092CG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 513 ggagggcaaggaggaggacg 532



to top

>emb|BX038773.1|CNS0922X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 329 ggagggcaaggaggaggacg 310



to top

>emb|BX038772.1|CNS0922W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 512 ggagggcaaggaggaggacg 531



to top

>emb|BX038693.1|CNS0920P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX038692.1|CNS0920O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 521 ggagggcaaggaggaggacg 540



to top

>emb|BX038208.1|CNS091N8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 341 ggagggcaaggaggaggacg 322



to top

>emb|BX038207.1|CNS091N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 467 ggagggcaaggaggaggacg 486



to top

>emb|BX038039.1|CNS091IJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 323 ggagggcaaggaggaggacg 304



to top

>emb|BX038038.1|CNS091II Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX037613.1|CNS0916P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 340 ggagggcaaggaggaggacg 321



to top

>emb|BX037612.1|CNS0916O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 514 ggagggcaaggaggaggacg 533



to top

>emb|BX037577.1|CNS0915P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 318 ggagggcaaggaggaggacg 299



to top

>emb|BX037488.1|CNS09138 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 270 ggagggcaaggaggaggacg 251



to top

>emb|BX037487.1|CNS09137 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 477 ggagggcaaggaggaggacg 496



to top

>emb|BX036984.1|CNS090P8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 366

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 277 ggagggcaaggaggaggacg 258



to top

>emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>emb|BX028080.1|CNS08TTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 388 ggagggcaaggaggaggacg 407



to top

>emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 292 ggagggcaaggaggaggacg 273



to top

>emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 498 ggagggcaaggaggaggacg 517



to top

>emb|BX024766.1|CNS08R9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 233 ggagggcaaggaggaggacg 214



to top

>emb|BX019545.1|CNS08N8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 248 ggagggcaaggaggaggacg 229



to top

>emb|BX019544.1|CNS08N8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 507 ggagggcaaggaggaggacg 526



to top

>emb|BX021590.1|CNS08OTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 280 ggagggcaaggaggaggacg 261



to top

>emb|BX021589.1|CNS08OTL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 350 ggagggcaaggaggaggacg 369



to top

>emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 304 ggagggcaaggaggaggacg 285



to top

>emb|BX020809.1|CNS08O7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 243 ggagggcaaggaggaggacg 262



to top

>emb|BX012334.1|CNS08HOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 319 ggagggcaaggaggaggacg 300



to top

>emb|BX008016.1|CNS08ECK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 287 ggagggcaaggaggaggacg 268



to top

>emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 194 ccgccggcgccgctgttcga 213
           ||||||||||||||||||||
Sbjct: 135 ccgccggcgccgctgttcga 154



to top

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 195    cgccggcgccgctgttcgag 214
              ||||||||||||||||||||
Sbjct: 268258 cgccggcgccgctgttcgag 268277



to top

>gb|AY974145.1| Pinus resinosa p-166-5 (p-166-5) mRNA, partial cds
          Length = 718

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 113 ctcggggcgaacaagtactcggagcggcagcc 144
           ||||||||||||||||| || ||| |||||||
Sbjct: 99  ctcggggcgaacaagtattccgagaggcagcc 130



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 75       gggcagcagcgatggagggc 94
                ||||||||||||||||||||
Sbjct: 15974734 gggcagcagcgatggagggc 15974715



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 242 taccgcgccggcatcgccgagttcatggccac 273
           |||||||| | ||||||||||||||| |||||
Sbjct: 205 taccgcgcggtcatcgccgagttcatcgccac 236



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 242 taccgcgccggcatcgccgagttcatggccac 273
           ||||||||||  |||||||||||||| |||||
Sbjct: 193 taccgcgccgtgatcgccgagttcatcgccac 224



to top

>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 242     taccgcgccggcatcgccgagttc 265
               ||||||||||| ||||||||||||
Sbjct: 2227876 taccgcgccggaatcgccgagttc 2227853



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccgccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggc 253
           |||||||||||||| |||||  |||  |||||||    ||||||| | |||||||| |  
Sbjct: 140 ccgccggcgccgctcttcgacgccgaggagctcaccaagtggtccctgtaccgcgcggtg 199

                               
Query: 254 atcgccgagttcatggccac 273
           |||||||||||| |||||||
Sbjct: 200 atcgccgagttcgtggccac 219



to top

>dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane intrinsic protein
           1;1, complete cds
          Length = 1096

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 116 ggggcgaacaagtactcggagcggcagcccatcggcacggcggc 159
           ||||| ||||||| | | ||| |||||||||| |||||||||||
Sbjct: 104 ggggccaacaagttcccagagaggcagcccataggcacggcggc 147



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 250     cggcatcgccgagttcatgg 269
               ||||||||||||||||||||
Sbjct: 4604007 cggcatcgccgagttcatgg 4603988



to top

>dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0091E23
          Length = 155939

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    gggcagcagcgatggagggc 94
             ||||||||||||||||||||
Sbjct: 66319 gggcagcagcgatggagggc 66300



to top

>ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913
           (ENSANGG00000014424), mRNA
          Length = 817

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 88  ggagggcaaggaggaggacg 107
           ||||||||||||||||||||
Sbjct: 504 ggagggcaaggaggaggacg 523



to top

>ref|NM_211499.1| Eremothecium gossypii AGL230Cp (AGL230C), mRNA
          Length = 678

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 195 cgccggcgccgctgttcgag 214
           ||||||||||||||||||||
Sbjct: 451 cgccggcgccgctgttcgag 432



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 134    gagcggcagcccatcggcac 153
              ||||||||||||||||||||
Sbjct: 108359 gagcggcagcccatcggcac 108340



to top

>dbj|AB028938.1| Roseateles depolymerans DNA for puf operon, complete cds
          Length = 8087

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 246  gcgccggcatcgccgagttc 265
            ||||||||||||||||||||
Sbjct: 1413 gcgccggcatcgccgagttc 1394


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,726,784
Number of Sequences: 3902068
Number of extensions: 1726784
Number of successful extensions: 40383
Number of sequences better than 10.0: 219
Number of HSP's better than 10.0 without gapping: 219
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 39681
Number of HSP's gapped (non-prelim): 678
length of query: 275
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 253
effective length of database: 17,147,199,772
effective search space: 4338241542316
effective search space used: 4338241542316
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top