ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet61b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X53580.1|HVGLN2R Barley gln mRNA for glutamine synthetase 2 ... 351 4e-94
2emb|X16000.1|HVGLN2 Hordeum vulgare mRNA for glutamine synthetas... 351 4e-94
3gb|DQ124214.1| Triticum aestivum plastid glutamine synthetase is... 319 2e-84
4gb|DQ124213.1| Triticum aestivum plastid glutamine synthetase is... 311 4e-82
5gb|DQ124212.1| Triticum aestivum plastid glutamine synthetase is... 311 4e-82
6dbj|AB161716.1| Phragmites australis GS2 mRNA for plastidic glut... 256 2e-65
7emb|X65931.1|ZMGS2 Z.mays mRNA gs2 for glutamine synthatase 232 3e-58
8gb|AY110796.1| Zea mays CL2183_1 mRNA sequence 232 3e-58
9dbj|AB161715.1| Phragmites australis GS2 mRNA for plastidic glut... 210 1e-51
10dbj|AB161714.1| Phragmites australis GS2 mRNA for plastidic glut... 210 1e-51
11ref|XM_474199.1| Oryza sativa (japonica cultivar-group), predic... 188 4e-45
12emb|X14246.1|OSSIGS31 Oryza sativa shoot GS2 mRNA for chloroplas... 188 4e-45
13dbj|AK099252.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 4e-45
14dbj|AK065491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 4e-45
15dbj|AK063706.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 4e-45
16gb|AY835456.1| Saccharum officinarum chloroplast glutamine synth... 139 3e-30
17gb|AY920930.1| Glycine max clone pGNGS7-3 chloroplast glutamine ... 137 1e-29
18gb|AY919612.1| Glycine max clone pGRGS1-2 chloroplast glutamine ... 137 1e-29
19gb|AF353620.1|AF353620 Glycine max glutamine synthetase precurso... 135 5e-29
20gb|AY162465.1| Crataegus crus-galli putative plastidic glutamine... 127 1e-26
21gb|AY225150.1| Medicago truncatula glutamine synthetase (GS2) mR... 115 5e-23
22gb|AY187005.1| Lotus corniculatus var. japonicus glutamine synth... 111 7e-22
23emb|X12738.1|PVGSCH French Bean mRNA for plastid-located glutami... 111 7e-22
24gb|AY187004.2| Lotus corniculatus var. japonicus glutamine synth... 111 7e-22
25gb|AF124244.2| Medicago sativa glutamine synthetase precursor (g... 107 1e-20
26gb|AY187006.1| Lotus corniculatus var. japonicus glutamine synth... 103 2e-19
27gb|AF169795.1|AF169795 Juglans nigra glutamine synthetase precur... 103 2e-19
28emb|X71361.1|AOGLNS A.officinalis mRNA for glutamine synthetase 101 7e-19
29gb|AF459587.1|AF459587 Lotus japonicus glutamine synthetase prec... 100 3e-18
30gb|AY162466.1| Spiraea nipponica putative plastidic glutamine sy... 98 1e-17
31gb|AF145480.1|AF145480 Mesembryanthemum crystallinum glutamine s... 96 4e-17
32emb|X05514.1|PSGSR2 Pea leaf mRNA for glutamine synthetase (EC 6... 88 1e-14
33gb|M20664.1|PEACHGS2A Pisum sativum glutamine synthetase (chloro... 88 1e-14
34gb|AY026353.1| Beta vulgaris glutamine synthetase GS2 (gln2) mRN... 86 4e-14
35gb|AF173657.1|AF173657 Beta vulgaris clone GSRTUNI glutamine syn... 86 4e-14
36ref|NM_001036892.1| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETA... 82 6e-13
37ref|NM_122954.2| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETASE ... 82 6e-13
38gb|AY122977.1| Arabidopsis thaliana putative glutamate-ammonia l... 82 6e-13
39gb|AY091114.1| Arabidopsis thaliana putative glutamate-ammonia l... 82 6e-13
40gb|AY081252.1| Arabidopsis thaliana glutamate-ammonia ligase, ch... 82 6e-13
41gb|AF428319.1|AF428319 Arabidopsis thaliana AT5g35630/MJE4_9 mRN... 82 6e-13
42gb|AF428461.1|AF428461 Arabidopsis thaliana AT5g35630/MJE4_9 mRN... 82 6e-13
43dbj|AK220961.1| Arabidopsis thaliana mRNA for glutamate-ammonia ... 82 6e-13
44gb|S69727.1| light-regulated glutamine synthetase isoenzyme [Ara... 82 6e-13
45emb|BX833085.1|CNS0A1TO Arabidopsis thaliana Full-length cDNA Co... 82 6e-13
46gb|AY088222.1| Arabidopsis thaliana clone 4372 mRNA, complete se... 82 6e-13
47emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4,... 76 4e-11
48emb|AL606608.3|OSJN00056 Oryza sativa genomic DNA, chromosome 4,... 76 4e-11
49gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence 76 4e-11
50dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 76 4e-11
51gb|AY773090.1| Cucumis melo glutamine synthetase mRNA, complete cds 74 2e-10
52gb|AF031082.1|AF031082 Canavalia lineata glutamine synthetase (g... 74 2e-10
53gb|AF019561.1|AF019561 Daucus carota clone CGS201 glutamine synt... 72 6e-10
54emb|X72751.1|BNGLUS B.napus mRNA for plastidic glutamine synthet... 66 4e-08
55gb|AY261640.1| Passiflora rufostipulata Yockteng-111 (P) glutami... 64 2e-07
56gb|AY261611.1| Passiflora manicata Yockteng-86 (P) glutamine syn... 64 2e-07
57gb|AY189922.1| Teramnus labialis clone 2 glutamine synthetase ge... 64 2e-07
58gb|AY189916.1| Amphicarpaea edgeworthii glutamine synthetase gen... 64 2e-07
59emb|X76736.1|BNGLUTS B.napus mRNA for cytosolic glutamine synthe... 64 2e-07
60emb|Y12459.1|BNGSR12 Brassica napus mRNA for cytosolic glutamine... 64 2e-07
61gb|AY261547.1| Passiflora antioquiensis Vecchia-4 glutamine synt... 62 6e-07
62emb|Y08681.1|AGGLN1 A.glutinosa mRNA for glutamine synthetase 62 6e-07
63gb|AY261662.1| Passiflora tripartita var. mollissima Morse-Stude... 60 2e-06
64gb|AY261661.1| Passiflora tripartita var. mollissima glutamine s... 60 2e-06
65gb|AY261660.1| Passiflora tripartita var. mollissima Yockteng-13... 60 2e-06
66gb|AY261659.1| Passiflora tripartita var. mollissima Yockteng-15... 60 2e-06
67gb|AY261658.1| Passiflora tripartita var. mollissima Yockteng-13... 60 2e-06
68gb|AY261636.1| Passiflora racemosa Yockteng-106 (P) glutamine sy... 60 2e-06
69gb|AY261616.1| Passiflora mixta Houel-14 158 (P) glutamine synth... 60 2e-06
70gb|AY835455.1| Saccharum officinarum glutamine synthetase (GS1.c... 58 9e-06
71gb|AY261573.1| Passiflora crenata Yockteng-41 (P) glutamine synt... 58 9e-06
72gb|AY261572.1| Passiflora crenata Vecchia-18 glutamine synthetas... 58 9e-06
73gb|AY261534.1| Adenia sp. Gilbert 9135 glutamine synthetase GS2 ... 58 9e-06
74gb|DQ427814.1| Sorghum propinquum locus HHU39 genomic sequence 58 9e-06
75gb|DQ427813.1| Sorghum bicolor voucher PI585454 locus HHU39 geno... 58 9e-06
76gb|DQ427812.1| Sorghum bicolor voucher PI267539 locus HHU39 geno... 58 9e-06
77gb|DQ427810.1| Sorghum bicolor voucher PI221607 locus HHU39 geno... 58 9e-06
78gb|DQ427809.1| Sorghum bicolor voucher PI152702 locus HHU39 geno... 58 9e-06
79gb|DQ427808.1| Sorghum bicolor voucher NSL92371 locus HHU39 geno... 58 9e-06
80gb|DQ427807.1| Sorghum bicolor voucher NSL87902b locus HHU39 gen... 58 9e-06
81gb|DQ427805.1| Sorghum bicolor voucher NSL87666 locus HHU39 geno... 58 9e-06
82gb|DQ427804.1| Sorghum bicolor voucher NSL77217 locus HHU39 geno... 58 9e-06
83gb|DQ427801.1| Sorghum bicolor voucher NSL56003 locus HHU39 geno... 58 9e-06
84gb|DQ427800.1| Sorghum bicolor voucher NSL55243 locus HHU39 geno... 58 9e-06
85gb|DQ427799.1| Sorghum bicolor voucher NSL51365 locus HHU39 geno... 58 9e-06
86gb|DQ427798.1| Sorghum bicolor voucher NSL51030 locus HHU39 geno... 58 9e-06
87gb|DQ427797.1| Sorghum bicolor voucher NSL50875 locus HHU39 geno... 58 9e-06
88gb|DQ427796.1| Sorghum bicolor voucher BTx623 locus HHU39 genomi... 58 9e-06
89emb|Y12458.1|BNGSL2 Brassica napus mRNA for plastidic glutamine ... 58 9e-06
90gb|AY773089.1| Brassica rapa subsp. pekinensis glutamine synthet... 56 4e-05
91gb|AY261670.1| Passiflora vitifolia JBAVH-3320 glutamine synthet... 56 4e-05
92gb|AY261669.1| Passiflora vitifolia Morse-198700236 glutamine sy... 56 4e-05
93gb|AY261667.1| Passiflora variolata Houel-30 glutamine synthetas... 56 4e-05
94gb|AY261664.1| Passiflora tryphostemmatoides Yockteng-134 (P) gl... 56 4e-05
95gb|AY261656.1| Passiflora trialata Yockteng-129 (P) glutamine sy... 56 4e-05
96gb|AY261650.1| Passiflora sprucei Vecchia-60 glutamine synthetas... 56 4e-05
97gb|AY261638.1| Passiflora riparia Yockteng-108 (P) glutamine syn... 56 4e-05
98gb|AY261637.1| Passiflora reflexiflora Yockteng-107 (P) glutamin... 56 4e-05
99gb|AY261634.1| Passiflora quadrangularis Vecchia-54 glutamine sy... 56 4e-05
100gb|AY261633.1| Passiflora quadrangularis Yockteng-105 (P) glutam... 56 4e-05
101gb|AY261624.1| Passiflora oerstedii var. choconiana Yockteng-98 ... 56 4e-05
102gb|AY261622.1| Passiflora nephrodes Morse-199900602 glutamine sy... 56 4e-05
103gb|AY261619.1| Passiflora mooreana Yockteng-91 (P) glutamine syn... 56 4e-05
104gb|AY261618.1| Passiflora mooreana Yockteng-92 (P) glutamine syn... 56 4e-05
105gb|AY261615.1| Passiflora menispermifolia Yockteng-90 (P) glutam... 56 4e-05
106gb|AY261614.1| Passiflora menispermifolia Vecchia-38 glutamine s... 56 4e-05
107gb|AY261604.1| Passiflora laurifolia Yockteng-77 (P) glutamine s... 56 4e-05
108gb|AY261603.1| Passiflora laurifolia Morse-199900009 glutamine s... 56 4e-05
109gb|AY261590.1| Passiflora garckei glutamine synthetase GS2 (ncpG... 56 4e-05
110gb|AY261589.1| Passiflora garckei Yockteng-63 (P) glutamine synt... 56 4e-05
111gb|AY261581.1| Passiflora elegans Yockteng-51 (P) glutamine synt... 56 4e-05
112gb|AY261580.1| Passiflora edulis f. flavicarpa Yockteng-49 (P) g... 56 4e-05
113gb|AY261579.1| Passiflora edulis f. flavicarpa Yockteng-50 (P) g... 56 4e-05
114gb|AY261578.1| Passiflora edulis f. flavicarpa Yockteng-48 (P) g... 56 4e-05
115gb|AY261575.1| Passiflora edulis Yockteng-46 (P) glutamine synth... 56 4e-05
116gb|AY261571.1| Passiflora crassifolia Yockteng-40 (P) glutamine ... 56 4e-05
117gb|AY261566.1| Passiflora coccinea Vecchia-14 32 (P) glutamine s... 56 4e-05
118gb|AY261565.1| Passiflora coccinea Morse-200000042 glutamine syn... 56 4e-05
119gb|AY261560.1| Passiflora cincinnata Vecchia-10 26 (P) glutamine... 56 4e-05
120gb|AY261559.1| Passiflora cincinnata Yockteng-25 (P) glutamine s... 56 4e-05
121gb|AY261558.1| Passiflora cerasina Yockteng-24 (P) glutamine syn... 56 4e-05
122gb|AY261555.1| Passiflora caerulea Vecchia-8 152 (P) glutamine s... 56 4e-05
123gb|AY261548.1| Passiflora antioquiensis Yockteng-147 (P) glutami... 56 4e-05
124gb|AY261544.1| Passiflora amethystina glutamine synthetase GS2 (... 56 4e-05
125gb|AY261543.1| Passiflora amethystina Yockteng-9 (P) glutamine s... 56 4e-05
126gb|AY261542.1| Passiflora ambigua Yockteng-7 (P) glutamine synth... 56 4e-05
127gb|AY261541.1| Passiflora ambigua Vecchia-2 8 (P) glutamine synt... 56 4e-05
128gb|AY261538.1| Passiflora alata Yockteng-5 (P) glutamine synthet... 56 4e-05
129gb|AY261533.1| Adenia gummifera Yockteng-146 (P) glutamine synth... 56 4e-05
130gb|AY196000.1| Glycine latifolia clone pglat1137.6rc glutamine s... 56 4e-05
131gb|AY195999.1| Glycine argyrea clone arg1420.3.GScp glutamine sy... 56 4e-05
132gb|AY195998.1| Glycine tomentella clone tom1691.7.GScp glutamine... 56 4e-05
133gb|AY195997.1| Glycine tomentella clone tom1156.10.GScp glutamin... 56 4e-05
134gb|AY195996.1| Glycine arenaria clone are1305.7.GScp glutamine s... 56 4e-05
135gb|AY195995.1| Glycine lactovirens clone lacto2599.6.GScp glutam... 56 4e-05
136gb|AY195994.1| Glycine albicans clone alb2049.11.GScp glutamine ... 56 4e-05
137gb|AY195993.1| Glycine cyrtoloba clone cyrt1465.2.GScp glutamine... 56 4e-05
138gb|AY195992.1| Glycine latifolia clone pglat1137.10 glutamine sy... 56 4e-05
139gb|AY195991.1| Glycine argyrea clone arg1420.1.GScp glutamine sy... 56 4e-05
140gb|AY195990.1| Glycine tomentella clone tom1691.11.GScp glutamin... 56 4e-05
141gb|AY195989.1| Glycine tomentella clone tom1156.11.GScp glutamin... 56 4e-05
142gb|AY195988.1| Glycine arenaria clone are1305.11.GScp glutamine ... 56 4e-05
143gb|AY195987.1| Glycine lactovirens clone lacto2599.4.GScp glutam... 56 4e-05
144gb|AY195986.1| Glycine albicans clone alb2049.21.GScp glutamine ... 56 4e-05
145emb|X65929.1|ZMGS14 Z.mays mRNA gs1-4 for glutamine synthetase 56 4e-05
146emb|AJ271909.1|BNA271909 Brassica napus gln gene for plastid glu... 56 4e-05
147gb|AY189927.1| Nogra grahamii glutamine synthetase gene, partial... 56 4e-05
148gb|AY189926.1| Pueraria montana glutamine synthetase gene, parti... 56 4e-05
149gb|AY189925.1| Glycine soja glutamine synthetase gene, partial c... 56 4e-05
150gb|AY189924.1| Teramnus repens glutamine synthetase gene, partia... 56 4e-05
151dbj|AB013393.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 4e-05
152gb|AY103627.1| Zea mays PCO073484 mRNA sequence 56 4e-05
153gb|AF068877.1|AF068877 Glycine falcata glutamine synthetase gene... 56 4e-05
154gb|AF068876.1|AF068876 Glycine curvata glutamine synthetase gene... 56 4e-05
155gb|AF068875.1|AF068875 Glycine microphylla glutamine synthetase ... 56 4e-05
156gb|AF068874.1|AF068874 Glycine canescens glutamine synthetase ge... 56 4e-05
157gb|AF068872.1|AF068872 Glycine curvata glutamine synthetase gene... 56 4e-05
158gb|AF068871.1|AF068871 Glycine microphylla glutamine synthetase ... 56 4e-05
159gb|AF068869.1|AF068869 Glycine soja glutamine synthetase gene, n... 56 4e-05
160dbj|D25325.1|RADGS1BB Raphanus sativus gs1 beta mRNA for glutami... 56 4e-05
161dbj|D14576.1|MZEGS1A Zea mays mRNA for glutamine synthetase, com... 56 4e-05
162dbj|AB015045.1| Arabidopsis thaliana gene for Glutamine Syntheta... 56 4e-05
163gb|AY261641.1| Passiflora sandrae Yockteng-112 (P) glutamine syn... 54 1e-04
164gb|AY261623.1| Passiflora nitida Vecchia-45 96 (P) glutamine syn... 54 1e-04
165gb|AY261586.1| Passiflora foetida var. hastata Houel-Guy13 gluta... 54 1e-04
166gb|AY261584.1| Passiflora foetida Yockteng-55 (P) glutamine synt... 54 1e-04
167ref|XM_390440.1| Gibberella zeae PH-1 chromosome 1 GLNA_GIBFU Gl... 54 1e-04
168emb|X05515.1|PSGSR3 Pea nodule mRNA for glutamine synthetase (EC... 54 1e-04
169gb|M20663.1|PEAGSCY1A Pisum satiivum glutamine synthetase (cytos... 54 1e-04
170gb|AY261655.1| Passiflora tetrandra Yockteng-128 (P) glutamine s... 52 6e-04
171gb|AY261617.1| Passiflora mixta JBAVH-3317 glutamine synthetase ... 52 6e-04
172gb|AY261593.1| Passiflora helleri Yockteng-66 (P) glutamine synt... 52 6e-04
173gb|AY261587.1| Passiflora foetida var. hirsutissima Yockteng-58 ... 52 6e-04
174gb|AY261585.1| Passiflora foetida var. arizonica Morse-200000041... 52 6e-04
175gb|AY261583.1| Passiflora foetida glutamine synthetase GS2 (ncpG... 52 6e-04
176gb|AY261570.1| Passiflora coriacea JBAVH-3319 glutamine syntheta... 52 6e-04
177gb|AY261557.1| Passiflora capsularis Morse-199500133 glutamine s... 52 6e-04
178gb|AY261550.1| Passiflora aurantia Yockteng-13 (P) glutamine syn... 52 6e-04
179gb|AY261546.1| Passiflora amoena Yockteng-10 (P) glutamine synth... 52 6e-04
180gb|AY261545.1| Passiflora amoena Vecchia-3 glutamine synthetase ... 52 6e-04
181emb|X65927.1|ZMGS12 Z.mays mRNA gs1-2 for glutamine synthetase 52 6e-04
182gb|AY189923.1| Teramnus labialis clone 8 glutamine synthetase ge... 52 6e-04
183gb|AY104270.1| Zea mays PCO127708 mRNA sequence 52 6e-04
184dbj|D25324.1|RADGS1AA Raphanus sativus gs1 alpha mRNA for glutam... 52 6e-04
185gb|AY835454.1| Saccharum officinarum glutamine synthetase (GS1.b... 50 0.002
186gb|AY261588.1| Passiflora gabriellana Houel-Guy15 glutamine synt... 50 0.002
187gb|AY261582.1| Passiflora exura Yockteng-52 (P) glutamine synthe... 50 0.002
188gb|AY491968.1| Triticum aestivum glutamine synthetase isoform GS... 50 0.002
189gb|DQ427811.1| Sorghum bicolor voucher PI267408 locus HHU39 geno... 50 0.002
190gb|DQ427806.1| Sorghum bicolor voucher NSL87902a locus HHU39 gen... 50 0.002
191gb|DQ427803.1| Sorghum bicolor voucher NSL77034 locus HHU39 geno... 50 0.002
192gb|DQ427802.1| Sorghum bicolor voucher NSL56174 locus HHU39 geno... 50 0.002
193emb|X82997.1|BNGLN B.napus mRNA for cytosolic glutamine syntheta... 50 0.002
194ref|NM_103743.2| Arabidopsis thaliana GLN1;5; glutamate-ammonia ... 48 0.009
195gb|BT015449.1| Arabidopsis thaliana At1g48470 mRNA sequence 48 0.009
196ref|XM_955811.1| Neurospora crassa OR74A GLUTAMINE SYNTHETASE (G... 48 0.009
197ref|XM_327009.1| Neurospora crassa OR74A GLUTAMINE SYNTHETASE (G... 48 0.009
198gb|AY835453.1| Saccharum officinarum glutamine synthetase (GS1.a... 48 0.009
199gb|AY261666.1| Passiflora umbilicata Houel-27 157 (P) glutamine ... 48 0.009
200gb|AY261663.1| Passiflora trisecta Yockteng-133 (P) glutamine sy... 48 0.009
201gb|AY261654.1| Passiflora telesiphe Yockteng-127 (P) glutamine s... 48 0.009
202gb|AY261648.1| Passiflora serrulata Yockteng-119 (P) glutamine s... 48 0.009
203gb|AY261647.1| Passiflora serratodigitata Vecchia-58 glutamine s... 48 0.009
204gb|AY261646.1| Passiflora serratodigitata glutamine synthetase G... 48 0.009
205gb|AY261645.1| Passiflora serratodigitata Morse-199900027 glutam... 48 0.009
206gb|AY261644.1| Passiflora seemannii Yockteng-116 (P) glutamine s... 48 0.009
207gb|AY261643.1| Passiflora sanguinolenta Morse-199800014 glutamin... 48 0.009
208gb|AY261642.1| Passiflora morifolia Yockteng-93 (P) glutamine sy... 48 0.009
209gb|AY261635.1| Passiflora platyloba Vecchia-50 glutamine synthet... 48 0.009
210gb|AY261632.1| Passiflora quadrangularis Morse-19990006 glutamin... 48 0.009
211gb|AY261630.1| Passiflora platyloba Vecchia-51 glutamine synthet... 48 0.009
212gb|AY261620.1| Passiflora multiflora Yockteng-159 (P) glutamine ... 48 0.009
213gb|AY261613.1| Passiflora membranacea Yockteng-88 (P) glutamine ... 48 0.009
214gb|AY261612.1| Passiflora mathewsii Yockteng-87 (P) glutamine sy... 48 0.009
215gb|AY261610.1| Passiflora maliformis JBMedellin 85 (P) glutamine... 48 0.009
216gb|AY261608.1| Passiflora ligularis JBAVH-3318 glutamine synthet... 48 0.009
217gb|AY261607.1| Passiflora ligularis Yockteng-83 (P) glutamine sy... 48 0.009
218gb|AY261606.1| Passiflora ligularis Vecchia-67 glutamine synthet... 48 0.009
219gb|AY261605.1| Passiflora ligularis Yockteng-84 (P) glutamine sy... 48 0.009
220gb|AY261599.1| Passiflora karwinskii Yockteng-73 (P) glutamine s... 48 0.009
221gb|AY261598.1| Passiflora kalbreyeri Yockteng-72 (P) glutamine s... 48 0.009
222gb|AY261596.1| Passiflora indecora Yockteng-70 (P) glutamine syn... 48 0.009
223gb|AY261595.1| Passiflora hirtiflora Yockteng-67 (P) glutamine s... 48 0.009
224gb|AY261577.1| Passiflora edulis Yockteng-44 (P) glutamine synth... 48 0.009
225gb|AY261576.1| Passiflora edulis Yockteng-43 (P) glutamine synth... 48 0.009
226gb|AY261574.1| Passiflora edulis Morse glutamine synthetase GS2 ... 48 0.009
227gb|AY261561.1| Passiflora cinnabarina ANBG-66949 glutamine synth... 48 0.009
228gb|AY261540.1| Passiflora alnifolia Yockteng-6 (P) glutamine syn... 48 0.009
229gb|AY261536.1| Passiflora adenopoda Vecchia-1 glutamine syntheta... 48 0.009
230gb|AF424638.1| Phytophthora infestans clone MY-01-A-07 glutamine... 48 0.009
231emb|BX294092.1|NCB11H7 Neurospora crassa DNA linkage group V BAC... 48 0.009
232emb|AJ704831.1| Protea pruinosa partial ncpGS gene for glutamine... 48 0.009
233emb|AJ704830.1| Protea cryophila partial ncpGS gene for glutamin... 48 0.009
234emb|AJ699508.1| Protea revoluta partial ncpGS gene for glutamine... 48 0.009
235emb|AJ699506.1| Protea intonsa partial ncpGS gene for glutamine ... 48 0.009
236emb|AJ699505.1| Protea rupicola partial ncpGS gene for glutamine... 48 0.009
237emb|AJ699504.1| Protea enervis partial ncpGS gene for glutamine ... 48 0.009
238emb|AJ699502.1| Protea glabra partial ncpGS gene for glutamine s... 48 0.009
239emb|AJ699501.1| Protea scolymocephala partial ncpGS gene for glu... 48 0.009
240emb|AJ699500.1| Protea sulphurea partial ncpGS gene for glutamin... 48 0.009
241emb|AJ699499.1| Protea foliosa partial ncpGS gene for glutamine ... 48 0.009
242emb|AJ699498.1| Protea coronata partial ncpGS gene for glutamine... 48 0.009
243emb|AJ699494.1| Protea canaliculata partial ncpGS gene for gluta... 48 0.009
244emb|AJ699493.1| Protea pendula partial ncpGS gene for glutamine ... 48 0.009
245emb|AJ699492.1| Protea vogtsiae partial ncpGS gene for glutamine... 48 0.009
246emb|AJ699491.1| Protea pityphylla partial ncpGS gene for glutami... 48 0.009
247emb|AJ699490.1| Protea simplex partial ncpGS gene for glutamine ... 48 0.009
248emb|AJ699489.1| Protea inopina partial ncpGS gene for glutamine ... 48 0.009
249emb|AJ699488.1| Protea caffra partial ncpGS gene for glutamine s... 48 0.009
250emb|AJ699487.1| Protea welwitschii partial ncpGS gene for glutam... 48 0.009
251emb|AJ699485.1| Protea restionifolia partial ncpGS gene for glut... 48 0.009
252emb|AJ699484.1| Protea obtusifolia partial ncpGS gene for glutam... 48 0.009
253emb|AJ699483.1| Protea roupelliae partial ncpGS gene for glutami... 48 0.009
254emb|AJ699482.1| Protea dracomontana partial ncpGS gene for gluta... 48 0.009
255emb|AJ699481.1| Protea parvula partial ncpGS gene for glutamine ... 48 0.009
256emb|AJ699480.1| Protea angustata partial ncpGS gene for glutamin... 48 0.009
257emb|AJ699479.1| Protea acuminata partial ncpGS gene for glutamin... 48 0.009
258emb|AJ699478.1| Protea witzenbergiana partial ncpGS gene for glu... 48 0.009
259emb|AJ699476.1| Protea laevis partial ncpGS gene for glutamine s... 48 0.009
260emb|AJ699475.1| Protea convexa partial ncpGS gene for glutamine ... 48 0.009
261emb|AJ699474.1| Faurea rubriflora partial ncpGS gene for glutami... 48 0.009
262emb|AJ699473.1| Faurea rochetiana partial ncpGS gene for glutami... 48 0.009
263emb|AJ699472.1| Faurea galpinii partial ncpGS gene for glutamine... 48 0.009
264emb|AJ699471.1| Faurea saligna partial ncpGS gene for glutamine ... 48 0.009
265emb|AJ699470.1| Faurea macnaughtonii partial ncpGS gene for glut... 48 0.009
266emb|AJ699469.1| Protea decurrens partial ncpGS gene for glutamin... 48 0.009
267emb|AJ699468.1| Protea humiflora partial ncpGS gene for glutamin... 48 0.009
268emb|AJ699467.1| Protea subulifolia partial ncpGS gene for glutam... 48 0.009
269emb|AJ699466.1| Protea amplexicaulis partial ncpGS gene for glut... 48 0.009
270emb|AJ699465.1| Protea scolopendriifolia partial ncpGS gene for ... 48 0.009
271emb|AJ699464.1| Protea lorea partial ncpGS gene for glutamine sy... 48 0.009
272emb|AJ699463.1| Protea cynaroides partial ncpGS gene for glutami... 48 0.009
273emb|AJ699462.1| Protea punctata partial ncpGS gene for glutamine... 48 0.009
274emb|AJ699460.1| Protea venusta partial ncpGS gene for glutamine ... 48 0.009
275emb|AJ699459.1| Protea subvestita partial ncpGS gene for glutami... 48 0.009
276emb|AJ699458.1| Protea scabra partial ncpGS gene for glutamine s... 48 0.009
277emb|AJ699457.1| Protea laetans partial ncpGS gene for glutamine ... 48 0.009
278emb|AJ699456.1| Protea inyanganiensis partial ncpGS gene for glu... 48 0.009
279emb|AJ699455.1| Protea angolensis var. angolensis partial ncpGS ... 48 0.009
280emb|AJ699454.1| Protea rubropilosa partial ncpGS gene for glutam... 48 0.009
281emb|AJ699453.1| Protea lanceolata partial ncpGS gene for glutami... 48 0.009
282emb|AJ699452.1| Protea caespitosa partial ncpGS gene for glutami... 48 0.009
283emb|AJ699450.1| Protea gaguedi partial ncpGS gene for glutamine ... 48 0.009
284emb|AJ699449.1| Protea nitida partial ncpGS gene for glutamine s... 48 0.009
285emb|AJ699448.1| Protea grandiceps partial ncpGS gene for glutami... 48 0.009
286emb|AJ699447.1| Protea comptonii partial ncpGS gene for glutamin... 48 0.009
287emb|AJ699446.1| Protea speciosa partial ncpGS gene for glutamine... 48 0.009
288emb|AJ699445.1| Protea lorifolia partial ncpGS gene for glutamin... 48 0.009
289emb|AJ699444.1| Protea neriifolia partial ncpGS gene for glutami... 48 0.009
290emb|AJ699443.1| Protea laurifolia partial ncpGS gene for glutami... 48 0.009
291emb|AJ699442.1| Protea montana partial ncpGS gene for glutamine ... 48 0.009
292emb|AJ699440.1| Protea repens partial ncpGS gene for glutamine s... 48 0.009
293emb|AJ699439.1| Protea pudens partial ncpGS gene for glutamine s... 48 0.009
294emb|AJ699438.1| Protea longifolia partial ncpGS gene for glutami... 48 0.009
295emb|AJ699436.1| Protea nana partial ncpGS gene for glutamine syn... 48 0.009
296emb|AJ699435.1| Protea namaquana partial ncpGS gene for glutamin... 48 0.009
297emb|AJ699434.1| Protea lepidocarpodendron partial ncpGS gene for... 48 0.009
298emb|AJ699433.1| Protea burchellii partial ncpGS gene for glutami... 48 0.009
299emb|AJ699432.1| Protea stokoei partial ncpGS gene for glutamine ... 48 0.009
300emb|AJ699431.1| Protea aristata partial ncpGS gene for glutamine... 48 0.009
301emb|AJ699430.1| Protea scorzonerifolia partial ncpGS gene for gl... 48 0.009
302emb|AJ699429.1| Protea holosericea partial ncpGS gene for glutam... 48 0.009
303emb|AJ699428.1| Protea effusa partial ncpGS gene for glutamine s... 48 0.009
304gb|BT006245.1| Arabidopsis thaliana At1g48470 mRNA, complete cds 48 0.009
305gb|DQ358904.1| Bouvardia glaberrima plastid glutamine synthetase... 48 0.009
306gb|AF306642.1|AF306642 Scyliorhinus torazame glutamine synthetas... 48 0.009
307gb|AY189921.1| Pueraria phaseoloides glutamine synthetase gene, ... 48 0.009
308gb|AY189920.1| Sinodolichos lagopus glutamine synthetase gene, p... 48 0.009
309gb|AY189919.2| Pseudovigna argentea glutamine synthetase gene, p... 48 0.009
310gb|AY189918.2| Pseudeminia comosa glutamine synthetase gene, par... 48 0.009
311gb|AY189917.1| Dumasia villosa glutamine synthetase gene, partia... 48 0.009
312gb|AY189915.1| Bituminaria bituminosa glutamine synthetase gene,... 48 0.009
313gb|AY189913.1| Calopogonium mucunoides glutamine synthetase gene... 48 0.009
314gb|AY189912.1| Calopogonium caeruleum glutamine synthetase gene,... 48 0.009
315gb|AY189909.1| Strongylodon macrobotrys glutamine synthetase gen... 48 0.009
316gb|AY189907.1| Phaseolus vulgaris glutamine synthetase gene, par... 48 0.009
317gb|AY085540.1| Arabidopsis thaliana clone 156550 mRNA, complete ... 48 0.009
318emb|AJ538970.1|NTA538970 Nicotiana tabacum cDNA-AFLP-fragment BT... 48 0.009
319dbj|AK118005.1| Arabidopsis thaliana At1g48470 mRNA for putative... 48 0.009
320gb|AF068873.1|AF068873 Glycine falcata glutamine synthetase gene... 48 0.009
321gb|AF068870.1|AF068870 Glycine canescens glutamine synthetase ge... 48 0.009
322gb|BT013265.1| Lycopersicon esculentum clone 134810R, mRNA sequence 46 0.036
323gb|AY491969.1| Triticum aestivum glutamine synthetase isoform GS... 46 0.036
324ref|XM_504822.1| Yarrowia lipolytica CLIB122, YALI0F00506g predi... 46 0.036
325emb|X03931.1|MSGLNAG Medicago sativa L. glutamine synthetase gene 46 0.036
326emb|X04001.1|PVGSR1 Phaseolus vulgaris mRNA (pR-1) for glutamine... 46 0.036
327gb|AF302113.1| Solanum tuberosum glutamine synthetase GS2 (gln) ... 46 0.036
328gb|AY189910.1| Neonotonia wightii glutamine synthetase gene, par... 46 0.036
329gb|AY189908.1| Cologania sp. JJD-2003 glutamine synthetase gene,... 46 0.036
330emb|Y10268.1|MTY10268 M.truncatula mRNA for glutamine synthetase... 46 0.036
331emb|Y10267.1|MTY10267 M.truncatula mRNA for glutamine synthetase... 46 0.036
332emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 46 0.036
333gb|U15059.1|LEU15059 Lycopersicon esculentum chloroplast glutami... 46 0.036
334gb|BT020432.1| Arabidopsis thaliana At3g17820 mRNA, complete cds 44 0.14
335ref|NM_112663.2| Arabidopsis thaliana ATGSKB6; glutamate-ammonia... 44 0.14
336gb|BT020327.1| Arabidopsis thaliana At3g17820 gene, complete cds 44 0.14
337ref|NM_187697.1| Oryza sativa (japonica cultivar-group), predic... 44 0.14
338gb|AY261665.1| Passiflora tulae Yockteng-136 (P) glutamine synth... 44 0.14
339gb|AY261657.1| Passiflora trifasciata Yockteng-130 (P) glutamine... 44 0.14
340gb|AY261653.1| Passiflora talamancensis Yockteng-125 (P) glutami... 44 0.14
341gb|AY261652.1| Passiflora tacsonioides Yockteng-124 (P) glutamin... 44 0.14
342gb|AY261651.1| Passiflora standleyi Yockteng-121 (P) glutamine s... 44 0.14
343gb|AY261639.1| Passiflora rubra Yockteng-109 (P) glutamine synth... 44 0.14
344gb|AY261631.1| Passiflora punctata Yockteng-104 (P) glutamine sy... 44 0.14
345gb|AY261629.1| Passiflora pittieri JBMedellin glutamine syntheta... 44 0.14
346gb|AY261628.1| Passiflora pittieri Vecchia-49 glutamine syntheta... 44 0.14
347gb|AY261627.1| Passiflora perfoliata Yockteng-101 (P) glutamine ... 44 0.14
348gb|AY261626.1| Passiflora penduliflora Yockteng-100 (P) glutamin... 44 0.14
349gb|AY261625.1| Passiflora ornithoura Yockteng-99 (P) glutamine s... 44 0.14
350gb|AY261621.1| Passiflora murucuja Yockteng-94 (P) glutamine syn... 44 0.14
351gb|AY261609.1| Passiflora macrophylla Vecchia-33 glutamine synth... 44 0.14
352gb|AY261602.1| Passiflora lancetillensis Yockteng-76 (P) glutami... 44 0.14
353gb|AY261601.1| Passiflora kawensis Yockteng-75 (P) glutamine syn... 44 0.14
354gb|AY261600.1| Passiflora kawensis Yockteng-74 (P) glutamine syn... 44 0.14
355gb|AY261597.1| Passiflora jorullensis Yockteng-71 (P) glutamine ... 44 0.14
356gb|AY261594.1| Passiflora herbertiana Houel-7 glutamine syntheta... 44 0.14
357gb|AY261592.1| Passiflora hahnii Vecchia-25 glutamine synthetase... 44 0.14
358gb|AY261591.1| Passiflora hahnii Yockteng-65 (P) glutamine synth... 44 0.14
359gb|AY261569.1| Passiflora coriacea Yockteng-37 (P) glutamine syn... 44 0.14
360gb|AY261568.1| Passiflora coriacea Yockteng-34 (P) glutamine syn... 44 0.14
361gb|AY261567.1| Passiflora coriacea Morse-199200361 glutamine syn... 44 0.14
362gb|AY261564.1| Passiflora citrifolia Yockteng-29 (P) glutamine s... 44 0.14
363gb|AY261563.1| Passiflora citrifolia Vecchia-12 glutamine synthe... 44 0.14
364gb|AY261562.1| Passiflora cirrhiflora Yockteng-28 (P) glutamine ... 44 0.14
365gb|AY261554.1| Passiflora biflora Yockteng-19 (P) glutamine synt... 44 0.14
366gb|AY261553.1| Passiflora biflora Morse-199800107 glutamine synt... 44 0.14
367gb|AY261549.1| Passiflora arborea Yockteng-148 (P) glutamine syn... 44 0.14
368gb|AY261535.1| Dilkea sp. Gilbert 9246 glutamine synthetase GS2 ... 44 0.14
369gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.14
370emb|BX069657.1|CNS09PWT Single read from an extremity of a full-... 44 0.14
371emb|BX069656.1|CNS09PWS Single read from an extremity of a full-... 44 0.14
372emb|X14244.1|OSRIGS8 Oryza sativa root GS1 mRNA for cytosolic gl... 44 0.14
373emb|X14605.1|PVGSG1 French bean mRNA for glutamine synthetase ga... 44 0.14
374gb|AC105364.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.14
375emb|AJ699477.1| Protea acaulos partial ncpGS gene for glutamine ... 44 0.14
376emb|AJ699461.1| Protea mundii partial ncpGS gene for glutamine s... 44 0.14
377emb|AJ704833.1| Protea recondita partial ncpGS gene for glutamin... 44 0.14
378emb|AJ704832.1| Protea tenax partial ncpGS gene for glutamine sy... 44 0.14
379dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.14
380emb|BX825803.1|CNS0A4SH Arabidopsis thaliana Full-length cDNA Co... 44 0.14
381gb|BT004249.1| Arabidopsis thaliana clone RAFL14-96-E19 (R20303)... 44 0.14
382gb|AY088312.1| Arabidopsis thaliana clone 5507 mRNA, complete se... 44 0.14
383dbj|AB180688.1| Oryza sativa (japonica cultivar-group) OsGS1;2 m... 44 0.14
384ref|XM_319738.2| Anopheles gambiae str. PEST ENSANGP00000019490 ... 44 0.14
385gb|AY918120.1| Vigna radiata clone N 7-2 glutamine synthetase (G... 44 0.14
386gb|AY918119.1| Vigna radiata clone R 32-1 glutamine synthetase (... 44 0.14
387gb|M94765.1|VIRGLUSYN Vigna aconitifolia nodulin-specific glutam... 44 0.14
388gb|M10159.1|PHVGS3E P.vulgaris L. glutamine synthetase (GS) mRNA... 44 0.14
389ref|NM_123119.2| Arabidopsis thaliana ATGSR1; glutamate-ammonia ... 42 0.56
390ref|XM_467663.1| Oryza sativa (japonica cultivar-group), mRNA 42 0.56
391ref|XM_507528.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 0.56
392ref|XM_506959.2| PREDICTED Oryza sativa (japonica cultivar-group... 42 0.56
393gb|BT015467.1| Arabidopsis thaliana At5g37600 mRNA sequence 42 0.56
394gb|BT014729.1| Arabidopsis thaliana At5g37600.1 mRNA sequence 42 0.56
395ref|XM_656671.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 0.56
396gb|BT000753.1| Arabidopsis thaliana putative glutamate-ammonia l... 42 0.56
397emb|CR702784.2|CNS0G57W Tetraodon nigroviridis full-length cDNA 42 0.56
398emb|CR700036.1|CNS0G33K Tetraodon nigroviridis full-length cDNA 42 0.56
399emb|CR685084.2|CNS0FRK8 Tetraodon nigroviridis full-length cDNA 42 0.56
400emb|CR662510.1|CNS0FA5W Tetraodon nigroviridis full-length cDNA 42 0.56
401emb|CR657385.2|CNS0F67J Tetraodon nigroviridis full-length cDNA 42 0.56
402emb|X94320.1|VVGS1 V.vinifera mRNA for cytosolic glutamine synth... 42 0.56
403emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine syn... 42 0.56
404emb|X14245.1|OSSIGS28 Oryza sativa shoot GS1 mRNA for cytosolic ... 42 0.56
405gb|DQ124211.1| Triticum aestivum glutamine synthetase isoform GS... 42 0.56
406gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS... 42 0.56
407emb|AJ699507.1| Protea odorata partial ncpGS gene for glutamine ... 42 0.56
408emb|AJ699486.1| Protea curvata partial ncpGS gene for glutamine ... 42 0.56
409emb|X15280.1|DSGS Dunaliella salina mRNA for gluatmine synthetase 42 0.56
410gb|AY857489.1| Paxillus involutus strain ATCC 200175 glutamine s... 42 0.56
411gb|AF175498.1| Nectria haematococca strain W-8 glutamine synthas... 42 0.56
412gb|AY079113.1| Arabidopsis thaliana AT5g37600/K12B20_50 mRNA, co... 42 0.56
413gb|AF419608.1|AF419608 Arabidopsis thaliana AT5g37600/K12B20_50 ... 42 0.56
414gb|AF428386.1|AF428386 Arabidopsis thaliana AT5g37600/K12B20_50 ... 42 0.56
415gb|AF065142.1|AF065142 Dunaliella tertiolecta glutamine syntheta... 42 0.56
416dbj|AK222005.1| Arabidopsis thaliana mRNA for glutamate--ammonia... 42 0.56
417gb|AF333968.1|AF333968 Aspergillus nidulans glutamine synthetase... 42 0.56
418gb|DQ358900.1| Gelsemium sempervirens plastid glutamine syntheta... 42 0.56
419gb|AF290454.1|AF290454 Lolium perenne clone LpGln2 unknown sequence 42 0.56
420dbj|AB037595.1| Oryza sativa (japonica cultivar-group) OsGS1;1 m... 42 0.56
421dbj|AK109397.2| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.56
422dbj|AK104987.2| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.56
423dbj|AB018107.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 42 0.56
424dbj|AK071969.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.56
425dbj|AK061157.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.56
426ref|NM_105291.2| Arabidopsis thaliana ATGSR2; glutamate-ammonia ... 40 2.2
427ref|NM_001036163.1| Arabidopsis thaliana ATGSR2; glutamate-ammon... 40 2.2
428gb|AY819644.1| Aspergillus niger glutamine synthetase (glnA) mRN... 40 2.2
429gb|AY426758.1| Nicotiana attenuata glutamine synthetase GS58 mRN... 40 2.2
430gb|AY422224.1| Datisca glomerata glutamine synthetase 1 (GS1-1) ... 40 2.2
431gb|AY261539.1| Passiflora allantophylla Houel-34 154 (P) glutami... 40 2.2
432ref|XM_754581.1| Ustilago maydis 521 hypothetical protein (UM035... 40 2.2
433ref|XM_746426.1| Aspergillus fumigatus Af293 glutamine synthetas... 40 2.2
434gb|AF503208.1| Oreochromis niloticus glutamine synthetase mRNA, ... 40 2.2
435emb|Y13833.1|SCY13833 Streptomyces coelicolor arsC (partial), gl... 40 2.2
436gb|AY122962.1| Arabidopsis thaliana putative glutamine synthetas... 40 2.2
437gb|AY091101.1| Arabidopsis thaliana putative glutamine synthetas... 40 2.2
438emb|X52842.1|SVGSII Streptomyces viridochromogenes glutamine syn... 40 2.2
439emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete ... 40 2.2
440emb|AJ699503.1| Protea mucronifolia partial ncpGS gene for gluta... 40 2.2
441emb|AJ699441.1| Protea compacta partial ncpGS gene for glutamine... 40 2.2
442emb|AJ558239.1|CGI558239 Crassostrea gigas mRNA for glutamine sy... 40 2.2
443gb|AY275956.1| Securigera parviflora cytosolic glutamine synthet... 40 2.2
444gb|AY275954.1| Securigera parviflora cytosolic glutamine synthet... 40 2.2
445emb|AJ809628.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
446emb|AJ809627.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
447emb|AJ809626.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
448emb|AJ809625.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
449emb|AJ809624.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
450emb|AJ809623.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
451emb|AJ809622.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
452emb|AJ809621.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
453emb|AJ809620.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
454emb|AJ809619.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
455emb|AJ809618.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
456emb|AJ809617.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
457emb|AJ809616.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
458emb|AJ809615.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
459emb|AJ809614.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
460emb|AJ809613.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
461emb|AJ809612.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
462emb|AJ809611.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
463emb|AJ809610.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
464emb|AJ809609.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
465emb|AJ809608.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
466emb|AJ809607.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
467emb|AJ809606.1| Ilex canariensis partial nepGS gene for glutamin... 40 2.2
468emb|AJ809605.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
469emb|AJ809604.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
470emb|AJ809603.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
471emb|AJ809602.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
472emb|AJ809601.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
473emb|AJ809600.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
474emb|AJ809599.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
475emb|AJ809598.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
476emb|AJ809597.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
477emb|AJ809596.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
478emb|AJ809595.1| Ilex perado partial nepGS gene for glutamine syn... 40 2.2
479gb|BC095274.1| Danio rerio similar to glutamine synthetase, mRNA... 40 2.2
480gb|AF470293.1| Oxalis tuberosa MHG913 glutamine synthase gene, p... 40 2.2
481dbj|AB226315.1| Aspergillus oryzae cDNA, contig sequence: AoEST3177 40 2.2
482dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 40 2.2
483ref|XM_689439.1| PREDICTED: Danio rerio similar to glutamine syn... 40 2.2
484gb|AF390021.1| Oncorhynchus mykiss glutamine synthetase (GS01) m... 40 2.2
485emb|BX815829.1|CNS0ADC0 Arabidopsis thaliana Full-length cDNA Co... 40 2.2
486gb|AC026480.6|AC026480 Arabidopsis thaliana chromosome 1 BAC F15... 40 2.2
487dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 2.2
488gb|AY086653.1| Arabidopsis thaliana clone 2662 mRNA, complete se... 40 2.2
489gb|AF411820.1| Hebeloma cylindrosporum glutamine synthetase mRNA... 40 2.2
490gb|AF118104.1|AF118104 Heterodontus francisci glutamine syntheta... 40 2.2
491emb|X66940.1|NSGS2AA N.sylvestris GS-2 mRNA encoding glutamine s... 40 2.2
492emb|Y12460.1|BNGSR22 Brassica napus mRNA for cytosolic glutamine... 40 2.2
493emb|BX247873.15| Zebrafish DNA sequence from clone CH211-198O12 ... 40 2.2
494emb|AJ310443.1|GFU310443 Gibberella fujikuroi gs gene for glutam... 40 2.2
495dbj|D25326.1|RADGS1GC Raphanus sativus gs1 gamma mRNA for glutam... 40 2.2
496gb|L32699.1|PALGLUSYN Paracentrotus lividus glutamine synthetase... 40 2.2
497gb|AY620818.1| Elaeagnus umbellata glutamine synthetase mRNA, co... 40 2.2
498gb|M33783.1|STMGLUSYN S.hygroscopicus glutamine synthetase (GLNB... 40 2.2
499gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 38 8.7
500gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome 38 8.7

>emb|X53580.1|HVGLN2R Barley gln mRNA for glutamine synthetase 2 (EC 6.3.1.2)
          Length = 1600

 Score =  351 bits (177), Expect = 4e-94
 Identities = 177/177 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1033 aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 1092

                                                                        
Query: 61   tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1093 tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 1152

                                                                     
Query: 121  tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1153 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 1209



to top

>emb|X16000.1|HVGLN2 Hordeum vulgare mRNA for glutamine synthetase precursor (EC
           6.3.1.2)
          Length = 1549

 Score =  351 bits (177), Expect = 4e-94
 Identities = 177/177 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 731 aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 790

                                                                       
Query: 61  tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 791 tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 850

                                                                    
Query: 121 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 851 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 907



to top

>gb|DQ124214.1| Triticum aestivum plastid glutamine synthetase isoform GS2c (GS2)
            mRNA, complete cds; nuclear gene for plastid product
          Length = 1689

 Score =  319 bits (161), Expect = 2e-84
 Identities = 173/177 (97%)
 Strand = Plus / Plus

                                                                        
Query: 1    aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 871  aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 930

                                                                        
Query: 61   tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 931  tgcaggagatcacatatgggcttcaagatacattctcgagagaatcacggagcaagctgg 990

                                                                     
Query: 121  tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 991  tgtcgtgctcacccttgacccaaaaccaatccagggtgactggaatggagctggctg 1047



to top

>gb|DQ124213.1| Triticum aestivum plastid glutamine synthetase isoform GS2b (GS2)
            mRNA, complete cds; nuclear gene for plastid product
          Length = 1593

 Score =  311 bits (157), Expect = 4e-82
 Identities = 172/177 (97%)
 Strand = Plus / Plus

                                                                        
Query: 1    aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
            |||||||||||||||||||||||||||||||||||||||||| || || |||||||||||
Sbjct: 845  aaacggggaggtcatgcctggtcagtgggagtaccaggttgggcctagtgttggtattga 904

                                                                        
Query: 61   tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 905  tgcaggagaccacatatgggcttcaagatacattctcgagagaatcacggagcaagctgg 964

                                                                     
Query: 121  tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 965  tgtggtgctcacccttgacccaaaaccaatccagggtgactggaatggagctggctg 1021



to top

>gb|DQ124212.1| Triticum aestivum plastid glutamine synthetase isoform GS2a (GS2)
            mRNA, complete cds; nuclear gene for plastid product
          Length = 1713

 Score =  311 bits (157), Expect = 4e-82
 Identities = 172/177 (97%)
 Strand = Plus / Plus

                                                                        
Query: 1    aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 916  aaacggggaggtcatgcctggtcagtgggagtaccaggttggacctagcgttggtattga 975

                                                                        
Query: 61   tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            ||| ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||
Sbjct: 976  tgcgggagaccacatatgggcttcaggatacattctcgagagaatcacggagcaagctgg 1035

                                                                     
Query: 121  tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1036 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaatggagctggctg 1092



to top

>dbj|AB161716.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase,
           complete cds, clone:YGS2-4
          Length = 1290

 Score =  256 bits (129), Expect = 2e-65
 Identities = 165/177 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
           ||||||||||||||||||||||||||||||||| || |||||||| |||||||| |||||
Sbjct: 738 aaacggggaggtcatgcctggtcagtgggagtatcaagttggacctagcgttggaattga 797

                                                                       
Query: 61  tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            ||||||||||||||||||  ||| |||||||||||||||||||||||||||||||||||
Sbjct: 798 agcaggagaccacatatggatttcaagatacattctcgagagaatcacggagcaagctgg 857

                                                                    
Query: 121 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
           ||||||||| |||||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 858 tgtggtgcttacccttgatccaaaaccaattcagggtgactggaatggagctggctg 914



to top

>emb|X65931.1|ZMGS2 Z.mays mRNA gs2 for glutamine synthatase
          Length = 1483

 Score =  232 bits (117), Expect = 3e-58
 Identities = 162/177 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
           |||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||
Sbjct: 767 aaacggggaggtcatgcctggtcagtgggagtaccaagttggacctagtgttggtattga 826

                                                                       
Query: 61  tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            |||||||| |||||||||  ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 827 agcaggagatcacatatggatttcgagatacattctcgagagaatcacagagcaagctgg 886

                                                                    
Query: 121 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            || || || |||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 887 ggttgtccttacccttgatccaaaaccaattcagggtgactggaacggagctggctg 943



to top

>gb|AY110796.1| Zea mays CL2183_1 mRNA sequence
          Length = 1541

 Score =  232 bits (117), Expect = 3e-58
 Identities = 162/177 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattga 60
           |||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||
Sbjct: 767 aaacggggaggtcatgcctggtcagtgggagtaccaagttggacctagtgttggtattga 826

                                                                       
Query: 61  tgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctgg 120
            |||||||| |||||||||  ||| ||||||||||||||||||||||| |||||||||||
Sbjct: 827 agcaggagatcacatatggatttcgagatacattctcgagagaatcacagagcaagctgg 886

                                                                    
Query: 121 tgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggctg 177
            || || || |||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 887 ggttgtccttacccttgatccaaaaccaattcagggtgactggaacggagctggctg 943



to top

>dbj|AB161715.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase,
           complete cds, clone:YGS2-7
          Length = 1290

 Score =  210 bits (106), Expect = 1e-51
 Identities = 154/170 (90%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 742 ggggaggtcatgcctggtcagtgggagtatcaggttggacctagcgttggtattgaagca 801

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           ||||| |||||||||  ||| ||||||||||||||||| |||||||||||||||||  | 
Sbjct: 802 ggagatcacatatggatttcaagatacattctcgagaggatcacggagcaagctggcata 861

                                                             
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 862 gtgcttactcttgatccgaaaccaattcagggtgactggaacggagctgg 911



to top

>dbj|AB161714.1| Phragmites australis GS2 mRNA for plastidic glutamine synthetase,
           complete cds, clone:YGS2-16
          Length = 1290

 Score =  210 bits (106), Expect = 1e-51
 Identities = 154/170 (90%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 742 ggggaggtcatgcctggtcagtgggagtatcaggttggacctagcgttggtattgaagca 801

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           ||||| |||||||||  ||| ||||||||||||||||| |||||||||||||||||  | 
Sbjct: 802 ggagatcacatatggatttcaagatacattctcgagaggatcacggagcaagctggcata 861

                                                             
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 862 gtgcttactcttgatccgaaaccaattcagggtgactggaacggagctgg 911



to top

>ref|XM_474199.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1287

 Score =  188 bits (95), Expect = 4e-45
 Identities = 149/167 (89%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           |||||||||||||||||||||||||||||||||||||| || || |||||||| || |||
Sbjct: 742 gaggtcatgcctggtcagtgggagtaccaggttggacctagtgtcggtattgaagctgga 801

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           ||||||||||||  ||| ||||| ||||| |||||||| |||||||| |||||||| |||
Sbjct: 802 gaccacatatggatttcaagatatattcttgagagaataacggagcaggctggtgtagtg 861

                                                          
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           || ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 862 cttacccttgaccccaaaccaattcagggagactggaatggagctgg 908



to top

>emb|X14246.1|OSSIGS31 Oryza sativa shoot GS2 mRNA for chloroplastic glutamine synthetase
           (EC 6.3.1.2) (clone lambda-GS31)
          Length = 1649

 Score =  188 bits (95), Expect = 4e-45
 Identities = 149/167 (89%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           |||||||||||||||||||||||||||||||||||||| || || |||||||| || |||
Sbjct: 805 gaggtcatgcctggtcagtgggagtaccaggttggacctagtgtcggtattgaagctgga 864

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           ||||||||||||  ||| ||||| ||||| |||||||| |||||||| |||||||| |||
Sbjct: 865 gaccacatatggatttcaagatatattcttgagagaataacggagcaggctggtgtagtg 924

                                                          
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           || ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 925 cttacccttgaccccaaaccaattcagggagactggaatggagctgg 971



to top

>dbj|AK099252.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013156I04, full
           insert sequence
          Length = 1639

 Score =  188 bits (95), Expect = 4e-45
 Identities = 149/167 (89%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           |||||||||||||||||||||||||||||||||||||| || || |||||||| || |||
Sbjct: 795 gaggtcatgcctggtcagtgggagtaccaggttggacctagtgtcggtattgaagctgga 854

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           ||||||||||||  ||| ||||| ||||| |||||||| |||||||| |||||||| |||
Sbjct: 855 gaccacatatggatttcaagatatattcttgagagaataacggagcaggctggtgtagtg 914

                                                          
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           || ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 915 cttacccttgaccccaaaccaattcagggagactggaatggagctgg 961



to top

>dbj|AK065491.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022E13, full
           insert sequence
          Length = 1677

 Score =  188 bits (95), Expect = 4e-45
 Identities = 149/167 (89%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           |||||||||||||||||||||||||||||||||||||| || || |||||||| || |||
Sbjct: 823 gaggtcatgcctggtcagtgggagtaccaggttggacctagtgtcggtattgaagctgga 882

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           ||||||||||||  ||| ||||| ||||| |||||||| |||||||| |||||||| |||
Sbjct: 883 gaccacatatggatttcaagatatattcttgagagaataacggagcaggctggtgtagtg 942

                                                          
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           || ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 943 cttacccttgaccccaaaccaattcagggagactggaatggagctgg 989



to top

>dbj|AK063706.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-H04, full
           insert sequence
          Length = 1425

 Score =  188 bits (95), Expect = 4e-45
 Identities = 149/167 (89%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           |||||||||||||||||||||||||||||||||||||| || || |||||||| || |||
Sbjct: 823 gaggtcatgcctggtcagtgggagtaccaggttggacctagtgtcggtattgaagctgga 882

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           ||||||||||||  ||| ||||| ||||| |||||||| |||||||| |||||||| |||
Sbjct: 883 gaccacatatggatttcaagatatattcttgagagaataacggagcaggctggtgtagtg 942

                                                          
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           || ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 943 cttacccttgaccccaaaccaattcagggagactggaatggagctgg 989



to top

>gb|AY835456.1| Saccharum officinarum chloroplast glutamine synthetase (GS2) mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 756

 Score =  139 bits (70), Expect = 3e-30
 Identities = 109/122 (89%)
 Strand = Plus / Plus

                                                                       
Query: 56  attgatgcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaa 115
           ||||| |||||||| |||||||||  ||| ||||||||||||||||||||||| ||||||
Sbjct: 1   attgaagcaggagatcacatatggatttcgagatacattctcgagagaatcacagagcaa 60

                                                                       
Query: 116 gctggtgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctggc 175
           ||||| || || || || ||||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 61  gctggggttgtccttactcttgatccaaaaccaattcagggtgactggaacggagctggc 120

             
Query: 176 tg 177
           ||
Sbjct: 121 tg 122



to top

>gb|AY920930.1| Glycine max clone pGNGS7-3 chloroplast glutamine synthetase (GS)
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 843

 Score =  137 bits (69), Expect = 1e-29
 Identities = 138/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagac 70
           |||||||||||||||||||||||||| ||||| || || || |||||||| || || || 
Sbjct: 409 gtcatgcctggtcagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgat 468

                                                                       
Query: 71  cacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctc 130
           || || |||||||| || ||||| ||||||||||| || |||||||||||||| ||||||
Sbjct: 469 catatctgggcttcaaggtacatcctcgagagaattaccgagcaagctggtgttgtgctc 528

                                                    
Query: 131 acccttgacccaaaaccaatccagggtgactggaacggagc 171
            | ||||| |||||||||||  ||||||||||||| |||||
Sbjct: 529 tctcttgatccaaaaccaatagagggtgactggaatggagc 569



to top

>gb|AY919612.1| Glycine max clone pGRGS1-2 chloroplast glutamine synthetase (GS)
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 843

 Score =  137 bits (69), Expect = 1e-29
 Identities = 138/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagac 70
           |||||||||||||||||||||||||| ||||| || || || |||||||| || || || 
Sbjct: 409 gtcatgcctggtcagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgat 468

                                                                       
Query: 71  cacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctc 130
           || || |||||||| || ||||| ||||||||||| || |||||||||||||| ||||||
Sbjct: 469 catatctgggcttcaaggtacatcctcgagagaattaccgagcaagctggtgttgtgctc 528

                                                    
Query: 131 acccttgacccaaaaccaatccagggtgactggaacggagc 171
            | ||||| |||||||||||  ||||||||||||| |||||
Sbjct: 529 tctcttgatccaaaaccaatagagggtgactggaatggagc 569



to top

>gb|AF353620.1|AF353620 Glycine max glutamine synthetase precursor, mRNA, complete cds;
           nuclear gene for chloroplast product
          Length = 1541

 Score =  135 bits (68), Expect = 5e-29
 Identities = 140/164 (85%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           ||||| ||||||||||||||||||||||| ||||| || || || |||||||| || || 
Sbjct: 783 gaggtgatgcctggtcagtgggagtaccaagttggtcctagtgtaggtattgaggctggt 842

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           || || || |||||||| || ||||| ||||||||||| || |||||||||||||| |||
Sbjct: 843 gatcatatctgggcttcaaggtacatcctcgagagaattactgagcaagctggtgttgtg 902

                                                       
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaacggagc 171
           ||| | ||||| |||||||||||  ||||||||||||| |||||
Sbjct: 903 ctctctcttgatccaaaaccaatagagggtgactggaatggagc 946



to top

>gb|AY162465.1| Crataegus crus-galli putative plastidic glutamine synthetase (GS2)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1640

 Score =  127 bits (64), Expect = 1e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||| || ||||| || || || || ||||| || 
Sbjct: 835 ggggaggttatgcctggccagtgggagtatcaagttggtccgagtgtgggaattgaagct 894

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           ||||| || || |||||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 895 ggagatcatatctgggcttcaagatacattcttgagagaatcactgaacaagctggtgtt 954

                                                       
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||||| ||||| |||||||| ||  ||||||||||||||||
Sbjct: 955 gttctcacacttgatccaaaaccgatagagggtgactggaacgg 998



to top

>gb|AY225150.1| Medicago truncatula glutamine synthetase (GS2) mRNA, complete cds;
           nuclear gene for plastid product
          Length = 1552

 Score =  115 bits (58), Expect = 5e-23
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           ||||| |||||||| ||||||||||| || ||||| || ||||| |||||||| || || 
Sbjct: 782 gaggttatgcctgggcagtgggagtatcaagttggtcctagcgtaggtattgaagctggt 841

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           || || || |||||||| || ||||| || |||||||| || || ||||||||||| |||
Sbjct: 842 gatcatatctgggcttcaaggtacatccttgagagaattactgaacaagctggtgttgtg 901

                                                 
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaa 165
           ||||||||||| |||||||||||  ||||||| |||||
Sbjct: 902 ctcacccttgatccaaaaccaattgagggtgattggaa 939



to top

>gb|AY187005.1| Lotus corniculatus var. japonicus glutamine synthetase PR1 mutant
           mRNA, complete cds
          Length = 1293

 Score =  111 bits (56), Expect = 7e-22
 Identities = 137/164 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||| || ||||| || || || |||||||| || 
Sbjct: 745 ggggaggttatgcctgggcagtgggagtatcaagttggtcctagtgtaggtattgaagct 804

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           || || || || |||||||| || ||| | || ||||||||||| || ||||||||||| 
Sbjct: 805 ggtgatcatatctgggcttcaaggtacctccttgagagaatcactgaacaagctggtgtt 864

                                                       
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||||| ||||| |||||||||||  ||||||||||||||||
Sbjct: 865 gtcctcactcttgatccaaaaccaattgagggtgactggaacgg 908



to top

>emb|X12738.1|PVGSCH French Bean mRNA for plastid-located glutamine synthetase (EC
           6.3.1.2)
          Length = 1510

 Score =  111 bits (56), Expect = 7e-22
 Identities = 137/164 (83%)
 Strand = Plus / Plus

                                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgat 61
           ||||||||||| |||||||| ||||||||||| || ||||| || || || |||||||| 
Sbjct: 802 aacggggaggttatgcctgggcagtgggagtatcaagttggtcctagtgtaggtattgag 861

                                                                       
Query: 62  gcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggt 121
           || || || || || ||||| || || ||||| ||||||||||| || || |||||||||
Sbjct: 862 gctggtgatcatatctgggcatcaaggtacatcctcgagagaattactgaacaagctggt 921

                                                       
Query: 122 gtggtgctcacccttgacccaaaaccaatccagggtgactggaa 165
           || |||||| | ||||| |||||||||||  |||||||||||||
Sbjct: 922 gttgtgctctctcttgatccaaaaccaatagagggtgactggaa 965



to top

>gb|AY187004.2| Lotus corniculatus var. japonicus glutamine synthetase mRNA,
           complete cds
          Length = 1436

 Score =  111 bits (56), Expect = 7e-22
 Identities = 137/164 (83%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||| || ||||| || || || |||||||| || 
Sbjct: 745 ggggaggttatgcctgggcagtgggagtatcaagttggtcctagtgtaggtattgaagct 804

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           || || || || |||||||| || ||| | || ||||||||||| || ||||||||||| 
Sbjct: 805 ggtgatcatatctgggcttcaaggtacctccttgagagaatcactgaacaagctggtgtt 864

                                                       
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||||| ||||| |||||||||||  ||||||||||||||||
Sbjct: 865 gtcctcactcttgatccaaaaccaattgagggtgactggaacgg 908



to top

>gb|AF124244.2| Medicago sativa glutamine synthetase precursor (gln) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 1595

 Score =  107 bits (54), Expect = 1e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                       
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcagga 67
           ||||| |||||||| ||||||||||| || ||||| || || || |||||||| || || 
Sbjct: 829 gaggttatgcctggccagtgggagtatcaagttggtcctagtgtaggtattgaagctggt 888

                                                                       
Query: 68  gaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtg 127
           || || || |||||||| || ||||| || |||||||| || || ||||||||||| |||
Sbjct: 889 gatcatatctgggcttcaaggtacatccttgagagaattactgaacaagctggtgttgtg 948

                                                 
Query: 128 ctcacccttgacccaaaaccaatccagggtgactggaa 165
           ||||||||||| |||||||||||  ||||||| |||||
Sbjct: 949 ctcacccttgatccaaaaccaattgagggtgattggaa 986



to top

>gb|AY187006.1| Lotus corniculatus var. japonicus glutamine synthetase PR2 mutant
           mRNA, complete cds
          Length = 1293

 Score =  103 bits (52), Expect = 2e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||| || ||||| || || || |||||||| || 
Sbjct: 745 ggggaggttatgcctgggcagtgggagtatcaagttggtcctagtgtaggtattgaagct 804

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           || || || || |||||||| || |||   || ||||||||||| || ||||||||||| 
Sbjct: 805 ggtgatcatatctgggcttcaaggtaccaccttgagagaatcactgaacaagctggtgtt 864

                                                       
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||||| ||||| |||||||||||  ||||||||||||||||
Sbjct: 865 gtcctcactcttgatccaaaaccaattgagggtgactggaacgg 908



to top

>gb|AF169795.1|AF169795 Juglans nigra glutamine synthetase precursor (plGS) mRNA, complete
            cds; nuclear gene for chloroplast product
          Length = 1666

 Score =  103 bits (52), Expect = 2e-19
 Identities = 136/164 (82%)
 Strand = Plus / Plus

                                                                        
Query: 5    ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
            |||||||| |||||||| ||||||||||| || |||||||| || || || ||||| || 
Sbjct: 846  ggggaggttatgcctggccagtgggagtatcaagttggacctagtgtgggaattgaagct 905

                                                                        
Query: 65   ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
            ||||| || ||||||  ||||||||||||||| |||||||| || || ||||||||||| 
Sbjct: 906  ggagatcatatatggtgttccagatacattcttgagagaattactgaacaagctggtgtt 965

                                                        
Query: 125  gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
            || ||| | || || |||||||||||  |||||||  |||||||
Sbjct: 966  gttctctcactcgatccaaaaccaatagagggtgatcggaacgg 1009



to top

>emb|X71361.1|AOGLNS A.officinalis mRNA for glutamine synthetase
          Length = 1651

 Score =  101 bits (51), Expect = 7e-19
 Identities = 135/163 (82%)
 Strand = Plus / Plus

                                                                        
Query: 5    ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
            |||||||| ||||| ||||||||||| || || |||||||| || || ||||||||||||
Sbjct: 851  ggggaggttatgcccggtcagtgggaatatcaagttggacctagtgtaggtattgatgca 910

                                                                        
Query: 65   ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
            |  || || ||||||  ||| |||||||| || ||||||||||| |||||||| || || 
Sbjct: 911  gcggatcatatatggtgttctagatacatccttgagagaatcactgagcaagcgggcgtc 970

                                                       
Query: 125  gtgctcacccttgacccaaaaccaatccagggtgactggaacg 167
            |||||  | ||||| |||||||||||  ||||||| |||||||
Sbjct: 971  gtgctgtctcttgatccaaaaccaatagagggtgattggaacg 1013



to top

>gb|AF459587.1|AF459587 Lotus japonicus glutamine synthetase precursor, mRNA, complete cds;
            nuclear gene for chloroplast product
          Length = 1696

 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                        
Query: 5    ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
            |||||||| |||||||| ||||||||||| || ||||| || |  || |||||||| || 
Sbjct: 891  ggggaggttatgcctgggcagtgggagtatcaagttggtcctantgtaggtattgaagct 950

                                                                        
Query: 65   ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
            || || || || |||||||| || ||| | || ||||||||||| |  ||||||||||| 
Sbjct: 951  ggtgatcatatctgggcttcaaggtacctccttgagagaatcactgnacaagctggtgtt 1010

                                                        
Query: 125  gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
            || ||||| ||||| |||||||||||  ||||||||||||||||
Sbjct: 1011 gtcctcactcttgatccaaaaccaattgagggtgactggaacgg 1054



to top

>gb|AY162466.1| Spiraea nipponica putative plastidic glutamine synthetase (GS2)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1665

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 133/161 (82%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||| || || || || || || || ||||| || 
Sbjct: 836 ggggaggttatgcctggccagtgggagtatcaagtaggtcctagtgtgggaattgaagct 895

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           || || || || |||||||| |||||||| || ||||||||||| || ||||||||||| 
Sbjct: 896 ggcgatcatatttgggcttcaagatacatccttgagagaatcactgaacaagctggtgtt 955

                                                    
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaa 165
           || ||||| ||||| |||||||| ||  |||||||||||||
Sbjct: 956 gttctcacacttgatccaaaaccgatagagggtgactggaa 996



to top

>gb|AF145480.1|AF145480 Mesembryanthemum crystallinum glutamine synthetase leaf isozyme
            precursor, mRNA, complete cds
          Length = 1579

 Score = 95.6 bits (48), Expect = 4e-17
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                        
Query: 5    ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
            |||||||| |||||||| |||||||| | ||| || || || || || || ||||| || 
Sbjct: 841  ggggaggttatgcctggccagtgggaattccaagtgggtccaagtgtcggaattgaagct 900

                                                                        
Query: 65   ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
            ||||| ||| | |||  | ||||||| ||||| ||||||||||| ||||||| |||||| 
Sbjct: 901  ggagatcacgtctggtgtgccagatatattcttgagagaatcactgagcaagttggtgta 960

                                                        
Query: 125  gtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
            || ||||||||||| |||||||||||  ||||||| ||||||||
Sbjct: 961  gttctcacccttgatccaaaaccaattgagggtgattggaacgg 1004



to top

>emb|X05514.1|PSGSR2 Pea leaf mRNA for glutamine synthetase (EC 6.3.1.2)
          Length = 1304

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| ||||||||||| || ||||| || || || |||||||| || || || || 
Sbjct: 585 atgcctggacagtgggagtatcaagttggtcctagtgtaggtattgaagctggtgatcat 644

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
           || ||||||||  | ||||| || |||||||| || || ||||||||||| |||||||| 
Sbjct: 645 atctgggcttcacggtacatccttgagagaattactgaacaagctggtgttgtgctcact 704

                                           
Query: 134 cttgacccaaaaccaatccagggtgactggaa 165
           ||||| |||||||||||  ||||||| |||||
Sbjct: 705 cttgatccaaaaccaatagagggtgattggaa 736



to top

>gb|M20664.1|PEACHGS2A Pisum sativum glutamine synthetase (chloroplast GS2) mRNA, complete
           cds
          Length = 1540

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| ||||||||||| || ||||| || || || |||||||| || || || || 
Sbjct: 821 atgcctggacagtgggagtatcaagttggtcctagtgtaggtattgaagctggtgatcat 880

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
           || ||||||||  | ||||| || |||||||| || || ||||||||||| |||||||| 
Sbjct: 881 atctgggcttcacggtacatccttgagagaattactgaacaagctggtgttgtgctcact 940

                                           
Query: 134 cttgacccaaaaccaatccagggtgactggaa 165
           ||||| |||||||||||  ||||||| |||||
Sbjct: 941 cttgatccaaaaccaatagagggtgattggaa 972



to top

>gb|AY026353.1| Beta vulgaris glutamine synthetase GS2 (gln2) mRNA, complete cds;
           nuclear gene for plastid product
          Length = 1296

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 136/167 (81%)
 Strand = Plus / Plus

                                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgat 61
           |||||||||||||||||||| |||||||| |  |||||||| || || ||||| ||||| 
Sbjct: 745 aacggggaggtcatgcctggccagtgggaatttcaggttggtcctagtgttgggattgaa 804

                                                                       
Query: 62  gcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggt 121
           || ||||| || || |||  | |||||||  |||| ||||||||||| ||||||||||||
Sbjct: 805 gctggagatcatatctggtgtgccagatatcttcttgagagaatcactgagcaagctggt 864

                                                          
Query: 122 gtggtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||  | || ||||| || || |||||  ||||||| ||||||||
Sbjct: 865 gtagttttgacacttgatccgaagccaattgagggtgattggaacgg 911



to top

>gb|AF173657.1|AF173657 Beta vulgaris clone GSRTUNI glutamine synthetase mRNA, partial cds
          Length = 704

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 136/167 (81%)
 Strand = Plus / Plus

                                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgat 61
           |||||||||||||||||||| |||||||| |  |||||||| || || ||||| ||||| 
Sbjct: 406 aacggggaggtcatgcctggccagtgggaatttcaggttggtcctagtgttgggattgaa 465

                                                                       
Query: 62  gcaggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggt 121
           || ||||| || || |||  | |||||||  |||| ||||||||||| ||||||||||||
Sbjct: 466 gctggagatcatatctggtgtgccagatatcttcttgagagaatcactgagcaagctggt 525

                                                          
Query: 122 gtggtgctcacccttgacccaaaaccaatccagggtgactggaacgg 168
           || ||  | || ||||| || || |||||  ||||||| ||||||||
Sbjct: 526 gtagttttgacacttgatccgaagccaattgagggtgattggaacgg 572



to top

>ref|NM_001036892.1| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETASE 2); glutamate-ammonia
            ligase AT5G35630 (GS2) transcript variant AT5G35630.2
            mRNA, complete cds
          Length = 1706

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 864  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 923

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 924  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 983

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 984  cttgatcccaaaccgatagagggtgactggaacggtgctgg 1024



to top

>ref|NM_122954.2| Arabidopsis thaliana GS2 (GLUTAMINE SYNTHETASE 2); glutamate-ammonia
            ligase AT5G35630 (GS2) transcript variant AT5G35630.1
            mRNA, complete cds
          Length = 1642

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 891  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 950

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 951  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 1010

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 1011 cttgatcccaaaccgatagagggtgactggaacggtgctgg 1051



to top

>gb|AY122977.1| Arabidopsis thaliana putative glutamate-ammonia ligase precursor,
           chloroplast (At5g35630) mRNA, complete cds
          Length = 1324

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 754 atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 813

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
            | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 814 gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 873

                                                    
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 874 cttgatcccaaaccgatagagggtgactggaacggtgctgg 914



to top

>gb|AY091114.1| Arabidopsis thaliana putative glutamate-ammonia ligase precursor,
            chloroplast (At5g35630) mRNA, complete cds
          Length = 1580

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 860  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 919

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 920  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 979

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 980  cttgatcccaaaccgatagagggtgactggaacggtgctgg 1020



to top

>gb|AY081252.1| Arabidopsis thaliana glutamate-ammonia ligase, chloroplast
           (At5g35630) mRNA, complete cds
          Length = 1519

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 812 atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 871

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
            | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 872 gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 931

                                                    
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 932 cttgatcccaaaccgatagagggtgactggaacggtgctgg 972



to top

>gb|AF428319.1|AF428319 Arabidopsis thaliana AT5g35630/MJE4_9 mRNA, complete cds
          Length = 1570

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 858  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 917

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 918  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 977

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 978  cttgatcccaaaccgatagagggtgactggaacggtgctgg 1018



to top

>gb|AF428461.1|AF428461 Arabidopsis thaliana AT5g35630/MJE4_9 mRNA, complete cds
          Length = 1473

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 858  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 917

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 918  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 977

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 978  cttgatcccaaaccgatagagggtgactggaacggtgctgg 1018



to top

>dbj|AK220961.1| Arabidopsis thaliana mRNA for glutamate-ammonia ligase  precursor,
           complete cds, clone: RAFL22-55-E01
          Length = 765

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 48  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 107

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
            | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 108 gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 167

                                                    
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 168 cttgatcccaaaccgatagagggtgactggaacggtgctgg 208



to top

>gb|S69727.1| light-regulated glutamine synthetase isoenzyme [Arabidopsis
           thaliana, mRNA, 1548 nt]
          Length = 1548

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 825 atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 884

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
            | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 885 gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 944

                                                    
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 945 cttgatcccaaaccgatagagggtgactggaacggtgctgg 985



to top

>emb|BX833085.1|CNS0A1TO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZE08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 771

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 52  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 111

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
            | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 112 gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 171

                                                    
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 172 cttgatcccaaaccgatagagggtgactggaacggtgctgg 212



to top

>gb|AY088222.1| Arabidopsis thaliana clone 4372 mRNA, complete sequence
          Length = 1598

 Score = 81.8 bits (41), Expect = 6e-13
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 14   atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
            |||||||| |||||||||| ||| ||||| || ||||| || ||||||||||| || || 
Sbjct: 891  atgcctggacagtgggagttccaagttggcccgagcgtaggaattgatgcaggtgatcat 950

                                                                        
Query: 74   atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
             | |||  | | |||||| |||| ||||||||||| || ||||||||||| || || || 
Sbjct: 951  gtttggtgtgctagataccttcttgagagaatcacagaacaagctggtgttgtcctaaca 1010

                                                     
Query: 134  cttgacccaaaaccaatccagggtgactggaacggagctgg 174
            ||||| || ||||| ||  |||||||||||||||| |||||
Sbjct: 1011 cttgatcccaaaccgatagagggtgactggaacggtgctgg 1051



to top

>emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011F23,
             complete sequence
          Length = 149353

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                         
Query: 23    cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
             ||||||||||||||||||||||| || || |||||||| || |||||||||||||||  |
Sbjct: 93767 cagtgggagtaccaggttggacctagtgtcggtattgaagctggagaccacatatggatt 93708

                           
Query: 83    tccagatacattct 96
             || ||||| |||||
Sbjct: 93707 tcaagatatattct 93694



 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                      
Query: 99    agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
             ||||||| |||||||| |||||||| ||||| ||||||||||| |||||||| ||||
Sbjct: 93352 agagaataacggagcaggctggtgtagtgcttacccttgaccccaaaccaattcagg 93296



to top

>emb|AL606608.3|OSJN00056 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0015K02,
             complete sequence
          Length = 153623

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                         
Query: 23    cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
             ||||||||||||||||||||||| || || |||||||| || |||||||||||||||  |
Sbjct: 13150 cagtgggagtaccaggttggacctagtgtcggtattgaagctggagaccacatatggatt 13091

                           
Query: 83    tccagatacattct 96
             || ||||| |||||
Sbjct: 13090 tcaagatatattct 13077



 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                      
Query: 99    agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
             ||||||| |||||||| |||||||| ||||| ||||||||||| |||||||| ||||
Sbjct: 12735 agagaataacggagcaggctggtgtagtgcttacccttgaccccaaaccaattcagg 12679



to top

>gb|AF480497.1| Oryza sativa clone BAC 24K23, complete sequence
          Length = 181577

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                         
Query: 23    cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
             ||||||||||||||||||||||| || || |||||||| || |||||||||||||||  |
Sbjct: 93867 cagtgggagtaccaggttggacctagtgtcggtattgaagctggagaccacatatggatt 93808

                           
Query: 83    tccagatacattct 96
             || ||||| |||||
Sbjct: 93807 tcaagatatattct 93794



 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                      
Query: 99    agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
             ||||||| |||||||| |||||||| ||||| ||||||||||| |||||||| ||||
Sbjct: 93452 agagaataacggagcaggctggtgtagtgcttacccttgaccccaaaccaattcagg 93396



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 23       cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
                ||||||||||||||||||||||| || || |||||||| || |||||||||||||||  |
Sbjct: 33662707 cagtgggagtaccaggttggacctagtgtcggtattgaagctggagaccacatatggatt 33662648

                              
Query: 83       tccagatacattct 96
                || ||||| |||||
Sbjct: 33662647 tcaagatatattct 33662634



 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                         
Query: 99       agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
                ||||||| |||||||| |||||||| ||||| ||||||||||| |||||||| ||||
Sbjct: 33662292 agagaataacggagcaggctggtgtagtgcttacccttgaccccaaaccaattcagg 33662236



to top

>gb|AY773090.1| Cucumis melo glutamine synthetase mRNA, complete cds
          Length = 1807

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 86   agatacattctcgagagaatcacggagcaagctggtgtggtgctcacccttgacccaaaa 145
            ||||||||||| ||||| ||||| ||||||||||| || || ||| | || || ||||||
Sbjct: 1002 agatacattcttgagaggatcaccgagcaagctggagtagttctctcactggatccaaaa 1061

                                         
Query: 146  ccaatccagggtgactggaacggagctgg 174
            |||||  ||||||||||||| ||||||||
Sbjct: 1062 ccaattgagggtgactggaatggagctgg 1090



to top

>gb|AF031082.1|AF031082 Canavalia lineata glutamine synthetase (gln) mRNA, nuclear gene
           encoding chloroplast protein, complete cds
          Length = 1577

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 130/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 5   ggggaggtcatgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgca 64
           |||||||| |||||||| ||||||||||  || ||||| || || || || ||||| || 
Sbjct: 835 ggggaggttatgcctgggcagtgggagtttcaagttggtcctagtgtaggcattgaagct 894

                                                                       
Query: 65  ggagaccacatatgggcttccagatacattctcgagagaatcacggagcaagctggtgtg 124
           || || || || |||||| | || |||||||| |||||||| || || |||||||| || 
Sbjct: 895 ggtgatcatatctgggctgcgaggtacattcttgagagaattactgaacaagctggcgtt 954

                                                    
Query: 125 gtgctcacccttgacccaaaaccaatccagggtgactggaa 165
           |||||| | || || ||||||||||| |||||||| |||||
Sbjct: 955 gtgctctcactcgatccaaaaccaattcagggtgattggaa 995



to top

>gb|AF019561.1|AF019561 Daucus carota clone CGS201 glutamine synthetase (GS2) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 1537

 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 132/164 (80%)
 Strand = Plus / Plus

                                                                       
Query: 14  atgcctggtcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccac 73
           |||||||| |||||||| |  || || || ||||| || |||||||| || || || |||
Sbjct: 776 atgcctggccagtgggaatttcaagtgggtcccagtgtcggtattgaagctggcgatcac 835

                                                                       
Query: 74  atatgggcttccagatacattctcgagagaatcacggagcaagctggtgtggtgctcacc 133
           || |||  | |||||||| | || |||||||| || ||||||||||| || || ||||| 
Sbjct: 836 atctggtgtgccagatacctcctggagagaattactgagcaagctggggtcgttctcaca 895

                                                       
Query: 134 cttgacccaaaaccaatccagggtgactggaacggagctggctg 177
           |||||||| ||||||||  | ||||||||||| ||||| |||||
Sbjct: 896 cttgacccgaaaccaattgatggtgactggaatggagcaggctg 939



to top

>emb|X72751.1|BNGLUS B.napus mRNA for plastidic glutamine synthetase isoform (BnGSR1-1)
            related to the A-genome type of Brassica campestris
          Length = 1575

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                        
Query: 86   agatacattctcgagagaatcacggagcaagctggtgtggtgctcacccttgacccaaaa 145
            |||||| |||| ||||||||||| || ||||||||||| || || || ||||| || |||
Sbjct: 914  agataccttcttgagagaatcacagaacaagctggtgttgtcctaacacttgatcccaaa 973

                                         
Query: 146  ccaatccagggtgactggaacggagctgg 174
            || ||  |||||||||||||||| |||||
Sbjct: 974  ccgattgagggtgactggaacggtgctgg 1002



to top

>gb|AY261640.1| Passiflora rufostipulata Yockteng-111 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 639

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| ||||| || ||||||  |
Sbjct: 104 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatcatatatggtgt 163

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 164 tcaagatacatt 175



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 353 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 404



to top

>gb|AY261611.1| Passiflora manicata Yockteng-86 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 593

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 77  cagtgggagtaccaagttggacctagcgtgggcattgaygctggagatcatatatggtgt 136

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 137 tcaagatacattct 150



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 289 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 340



to top

>gb|AY189922.1| Teramnus labialis clone 2 glutamine synthetase gene, partial cds;
           nuclear gene for chloroplast product
          Length = 1072

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| ||||||| |||||||||||
Sbjct: 775 agagaattactgagcaagctggtgttgtgctctcccttgatccaaaaccaat 826



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY189916.1| Amphicarpaea edgeworthii glutamine synthetase gene, partial cds;
           nuclear gene for chloroplast product
          Length = 1066

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| || ||||| |||||||||||||||||
Sbjct: 757 agagaattactgagcaagctggtgttgttctcactcttgacccaaaaccaat 808



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 128 cagtgggagtaccaagttggtcctagtgtaggtattgaggccggtgatcatatttgggct 187

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 188 tcaaggtacatcctcgag 205



to top

>emb|X76736.1|BNGLUTS B.napus mRNA for cytosolic glutamine synthetase isoform (BnGSR1-1)
           related to the A-genome type of Brassica campestris
          Length = 1400

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 135 ttgacccaaaaccaatccagggtgactggaacggagctgg 174
           |||||||||||||||| | |||||||||||||||||||||
Sbjct: 768 ttgacccaaaaccaattccgggtgactggaacggagctgg 807



 Score = 46.1 bits (23), Expect = 0.036
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacc 45
           |||||||||||||||||||||| ||| || |||||
Sbjct: 644 gtcatgcctggtcagtgggagttccaagtcggacc 678



to top

>emb|Y12459.1|BNGSR12 Brassica napus mRNA for cytosolic glutamine synthetase isoform
           (BnGSR1-2)
          Length = 1344

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 135 ttgacccaaaaccaatccagggtgactggaacggagctgg 174
           |||||||||||||||| | |||||||||||||||||||||
Sbjct: 732 ttgacccaaaaccaattccgggtgactggaacggagctgg 771



 Score = 46.1 bits (23), Expect = 0.036
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacc 45
           |||||||||||||||||||||| ||| || |||||
Sbjct: 608 gtcatgcctggtcagtgggagttccaagtcggacc 642



to top

>gb|AY261547.1| Passiflora antioquiensis Vecchia-4 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 591

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 79  cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatcatatatggtgt 138

                             
Query: 83  tccagatacattctcgag 100
           || ||||||||||| |||
Sbjct: 139 tcaagatacattctngag 156



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 291 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 342



to top

>emb|Y08681.1|AGGLN1 A.glutinosa mRNA for glutamine synthetase
          Length = 1346

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 116 gctggtgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||| |||||||||| |||||| || || |||||||||||||| ||||| ||||||||
Sbjct: 731 gctggggtggtgctcagccttgatcccaagccaatccagggtgattggaatggagctgg 789



to top

>gb|AY261662.1| Passiflora tripartita var. mollissima Morse-Student glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 567

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 52  cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 111

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 112 tcaagatacattct 125



to top

>gb|AY261661.1| Passiflora tripartita var. mollissima glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 598

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 79  cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 138

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 139 tcaagatacattct 152



to top

>gb|AY261660.1| Passiflora tripartita var. mollissima Yockteng-131 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 561

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 44  cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 103

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 104 tcaagatacattct 117



to top

>gb|AY261659.1| Passiflora tripartita var. mollissima Yockteng-153 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 567

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 96  cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 155

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 156 tcaagatacattct 169



to top

>gb|AY261658.1| Passiflora tripartita var. mollissima Yockteng-132 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 630

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 173

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 174 tcaagatacattct 187



to top

>gb|AY261636.1| Passiflora racemosa Yockteng-106 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 627

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 173

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 174 tcaagatacattct 187



to top

>gb|AY261616.1| Passiflora mixta Houel-14 158 (P) glutamine synthetase GS2
          (ncpGS) gene, partial cds; nuclear gene for chloroplast
          product
          Length = 282

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                      
Query: 23 cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
          |||||||||||||| |||||||| ||||| || |||||||| |||||  | ||||||  |
Sbjct: 14 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatgatatatggtgt 73

                        
Query: 83 tccagatacattct 96
          || |||||||||||
Sbjct: 74 tcaagatacattct 87



to top

>gb|AY835455.1| Saccharum officinarum glutamine synthetase (GS1.c) mRNA, complete
           cds
          Length = 1477

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttgg 42
           ||||||||||||||||| || |||||||||| |||||||||
Sbjct: 653 aacggggaggtcatgccagggcagtgggagttccaggttgg 693



to top

>gb|AY261573.1| Passiflora crenata Yockteng-41 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 649

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgg 79
           |||||||||||||| |||||||| ||||| || |||||||| ||||| || ||||||
Sbjct: 113 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatcatatatgg 169



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 325 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 376



to top

>gb|AY261572.1| Passiflora crenata Vecchia-18 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 649

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgg 79
           |||||||||||||| |||||||| ||||| || |||||||| ||||| || ||||||
Sbjct: 113 cagtgggagtaccaagttggacctagcgtgggcattgatgctggagatcatatatgg 169



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 325 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 376



to top

>gb|AY261534.1| Adenia sp. Gilbert 9135 glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 523

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaacc 147
           |||||||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 308 agagaatcactgaacaagctggtgttgtcctcacccttgatccaaaacc 356



to top

>gb|DQ427814.1| Sorghum propinquum locus HHU39 genomic sequence
          Length = 816

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 472 cagggtgactggaatggagctggctg 497



to top

>gb|DQ427813.1| Sorghum bicolor voucher PI585454 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427812.1| Sorghum bicolor voucher PI267539 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427810.1| Sorghum bicolor voucher PI221607 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427809.1| Sorghum bicolor voucher PI152702 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427808.1| Sorghum bicolor voucher NSL92371 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427807.1| Sorghum bicolor voucher NSL87902b locus HHU39 genomic sequence
          Length = 829

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 485 cagggtgactggaatggagctggctg 510



to top

>gb|DQ427805.1| Sorghum bicolor voucher NSL87666 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427804.1| Sorghum bicolor voucher NSL77217 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427801.1| Sorghum bicolor voucher NSL56003 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427800.1| Sorghum bicolor voucher NSL55243 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427799.1| Sorghum bicolor voucher NSL51365 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427798.1| Sorghum bicolor voucher NSL51030 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427797.1| Sorghum bicolor voucher NSL50875 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427796.1| Sorghum bicolor voucher BTx623 locus HHU39 genomic sequence
          Length = 837

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| ||||||||||| || || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctggggttgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>emb|Y12458.1|BNGSL2 Brassica napus mRNA for plastidic glutamine synthetase isoform
            (BnGSL2)
          Length = 1597

 Score = 58.0 bits (29), Expect = 9e-06
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                        
Query: 86   agatacattctcgagagaatcacggagcaagctggtgtggtgctcacccttgacccaaaa 145
            |||||| |||| ||||||||||| || ||||||||||| ||  | || ||||| || |||
Sbjct: 916  agataccttcttgagagaatcacagaacaagctggtgttgtcttaacacttgatcccaaa 975

                                         
Query: 146  ccaatccagggtgactggaacggagctgg 174
            || ||  |||||||||||||||| |||||
Sbjct: 976  cccatagagggtgactggaacggtgctgg 1004



to top

>gb|AY773089.1| Brassica rapa subsp. pekinensis glutamine synthetase mRNA, complete
           cds
          Length = 1426

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 135 ttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||||| |||||||| | |||||||||||||||||||||
Sbjct: 789 ttgacccgaaaccaattccgggtgactggaacggagctgg 828



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacc 45
           |||||||||||||||||||||| |||||| |||||
Sbjct: 665 gtcatgcctggtcagtgggagttccaggtcggacc 699



to top

>gb|AY261670.1| Passiflora vitifolia JBAVH-3320 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 601

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 104 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 163

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 164 tcaagatacatt 175



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 316 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 367



to top

>gb|AY261669.1| Passiflora vitifolia Morse-198700236 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 324

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 80  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 139

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 140 tcaagatacatt 151



to top

>gb|AY261667.1| Passiflora variolata Houel-30 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 570

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 48  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 107

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 108 tcaagatacatt 119



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 263 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 314



to top

>gb|AY261664.1| Passiflora tryphostemmatoides Yockteng-134 (P) glutamine synthetase
           GS2 (ncpGS) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 476

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || ||||||||||| || ||||| ||||| |||||||||||
Sbjct: 273 agagaatcactgaacaagctggtgttgttctcactcttgatccaaaaccaat 324



to top

>gb|AY261656.1| Passiflora trialata Yockteng-129 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 451

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 40  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 99

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 100 tcaagatacatt 111



to top

>gb|AY261650.1| Passiflora sprucei Vecchia-60 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 624

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgaagctggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



to top

>gb|AY261638.1| Passiflora riparia Yockteng-108 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 645

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 109 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 168

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 169 tcaagatacatt 180



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 321 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 372



to top

>gb|AY261637.1| Passiflora reflexiflora Yockteng-107 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 550

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 50  cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatcatatatggtgt 109

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 110 tcaagatacatt 121



to top

>gb|AY261634.1| Passiflora quadrangularis Vecchia-54 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 651

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 327 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 378



to top

>gb|AY261633.1| Passiflora quadrangularis Yockteng-105 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 651

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 327 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 378



to top

>gb|AY261624.1| Passiflora oerstedii var. choconiana Yockteng-98 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 577

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 104 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 163

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 164 tcaagatacatt 175



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 254 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 305



to top

>gb|AY261622.1| Passiflora nephrodes Morse-199900602 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 550

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 44  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 103

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 104 tcgagatacatt 115



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 240 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 291



to top

>gb|AY261619.1| Passiflora mooreana Yockteng-91 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 544

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 52  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 111

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 112 tcaagatacatt 123



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 248 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 299



to top

>gb|AY261618.1| Passiflora mooreana Yockteng-92 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 625

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261615.1| Passiflora menispermifolia Yockteng-90 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 551

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 50  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 109

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 110 tcaagatacatt 121



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 246 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 297



to top

>gb|AY261614.1| Passiflora menispermifolia Vecchia-38 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 602

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261604.1| Passiflora laurifolia Yockteng-77 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 609

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 324 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 375



to top

>gb|AY261603.1| Passiflora laurifolia Morse-199900009 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 648

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 324 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 375



to top

>gb|AY261590.1| Passiflora garckei glutamine synthetase GS2 (ncpGS) gene, partial
           cds; nuclear gene for chloroplast product
          Length = 362

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 50  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 109

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 110 tcaagatacatt 121



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 246 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 297



to top

>gb|AY261589.1| Passiflora garckei Yockteng-63 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 508

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 43  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 102

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 103 tcaagatacatt 114



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||| | ||||| |||||||||||
Sbjct: 228 agagaatcactgaacaagctggcgttgttctctctcttgatccaaaaccaat 279



to top

>gb|AY261581.1| Passiflora elegans Yockteng-51 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 597

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261580.1| Passiflora edulis f. flavicarpa Yockteng-49 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 576

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || ||  ||||||| ||||| |||||||||  |
Sbjct: 60  cagtgggagtaccaagttggacctagtgtgggcgttgatgctggagatcacatatggtgt 119

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 120 tcaagatacatt 131



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 272 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 323



to top

>gb|AY261579.1| Passiflora edulis f. flavicarpa Yockteng-50 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 572

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || ||  ||||||| ||||| |||||||||  |
Sbjct: 61  cagtgggagtaccaagttggacctagtgtgggcgttgatgctggagatcacatatggtgt 120

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 121 tcaagatacatt 132



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 273 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 324



to top

>gb|AY261578.1| Passiflora edulis f. flavicarpa Yockteng-48 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 659

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || ||  ||||||| ||||| |||||||||  |
Sbjct: 123 cagtgggagtaccaagttggacctagtgtgggcgttgatgctggagatcacatatggtgt 182

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 183 tcaagatacatt 194



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 335 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 386



to top

>gb|AY261575.1| Passiflora edulis Yockteng-46 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 563

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || ||  ||||||| ||||| |||||||||  |
Sbjct: 59  cagtgggagtaccaagttggacctagtgtgggcgttgatgctggagatcacatatggtgt 118

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 119 tcaagatacatt 130



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 271 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 322



to top

>gb|AY261571.1| Passiflora crassifolia Yockteng-40 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 581

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 108 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 167

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 168 tcaagatacatt 179



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 258 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 309



to top

>gb|AY261566.1| Passiflora coccinea Vecchia-14 32 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 591

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 72  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 131

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 132 tcaagatacatt 143



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 287 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 338



to top

>gb|AY261565.1| Passiflora coccinea Morse-200000042 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 503

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 73  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 132

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 133 tcaagatacatt 144



to top

>gb|AY261560.1| Passiflora cincinnata Vecchia-10 26 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 523

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || |||   |||||||||||||||||
Sbjct: 325 agagaatcactgaacaagctggcgttgttctctttcttgacccaaaaccaat 376



to top

>gb|AY261559.1| Passiflora cincinnata Yockteng-25 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 648

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 325 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 376



to top

>gb|AY261558.1| Passiflora cerasina Yockteng-24 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 568

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 55  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 114

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 115 tcaagatacatt 126



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 267 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 318



to top

>gb|AY261555.1| Passiflora caerulea Vecchia-8 152 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 634

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261548.1| Passiflora antioquiensis Yockteng-147 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 591

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 77  cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatcatatatggtgt 136

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 137 tcaagatacatt 148



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 290 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 341



to top

>gb|AY261544.1| Passiflora amethystina glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 634

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261543.1| Passiflora amethystina Yockteng-9 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 601

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || ||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 310 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 361



to top

>gb|AY261542.1| Passiflora ambigua Yockteng-7 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 581

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 98  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 157

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 158 tcaagatacatt 169



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 298 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 349



to top

>gb|AY261541.1| Passiflora ambigua Vecchia-2 8 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 567

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||||||| || ||||||  |
Sbjct: 98  cagtgggagtaccaagttggacctagtgtgggcattgacgcaggagatcatatatggtgt 157

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 158 tcaagatacatt 169



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 298 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 349



to top

>gb|AY261538.1| Passiflora alata Yockteng-5 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 649

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 113 cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 172

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 173 tcaagatacatt 184



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 325 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 376



to top

>gb|AY261533.1| Adenia gummifera Yockteng-146 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 582

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || ||||| ||||| || ||||||||||| |||||||||||
Sbjct: 293 agagaatcactgaacaagccggtgttgtcctcacccttgatccaaaaccaat 344



 Score = 46.1 bits (23), Expect = 0.036
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 88  cagtgggagtaccaagttggtcctagtgtggggattgaggctggagatcatatatggtgt 147

                             
Query: 83  tccagatacattctcgag 100
           || ||||||||||| |||
Sbjct: 148 tcaagatacattctngag 165



to top

>gb|AY196000.1| Glycine latifolia clone pglat1137.6rc glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1050

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 752 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 803



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY195999.1| Glycine argyrea clone arg1420.3.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1044

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 746 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 797



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY195998.1| Glycine tomentella clone tom1691.7.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1049

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 753 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 804



to top

>gb|AY195997.1| Glycine tomentella clone tom1156.10.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1045

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 749 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 800



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY195996.1| Glycine arenaria clone are1305.7.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 746 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 797



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>gb|AY195995.1| Glycine lactovirens clone lacto2599.6.GScp glutamine synthetase
           gene, partial cds; nuclear gene for chloroplast product
          Length = 1043

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 747 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 798



 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || ||||| || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgaccatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY195994.1| Glycine albicans clone alb2049.11.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1062

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 764 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 815



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggggatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 181 tcaaggtacatcctcgag 198



to top

>gb|AY195993.1| Glycine cyrtoloba clone cyrt1465.2.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1026

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 730 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 781



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 127 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 186

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 187 tcaaggtacatcctcgag 204



to top

>gb|AY195992.1| Glycine latifolia clone pglat1137.10 glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1041

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 750 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 801



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>gb|AY195991.1| Glycine argyrea clone arg1420.1.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1048

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 751 agagaattactgagcaagctggtgtcgtgctctctcttgatccaaaaccaat 802



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 122 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 181

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 182 tcaaggtacatcctcgag 199



to top

>gb|AY195990.1| Glycine tomentella clone tom1691.11.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1048

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 751 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 802



 Score = 38.2 bits (19), Expect = 8.7
 Identities = 58/71 (81%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                      
Query: 83  tccagatacat 93
           || || |||||
Sbjct: 180 tcaaggtacat 190



to top

>gb|AY195989.1| Glycine tomentella clone tom1156.11.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1048

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 751 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 802



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>gb|AY195988.1| Glycine arenaria clone are1305.11.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1047

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 750 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 801



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 119 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 178

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 179 tcaaggtacatcctcgag 196



to top

>gb|AY195987.1| Glycine lactovirens clone lacto2599.4.GScp glutamine synthetase
           gene, partial cds; nuclear gene for chloroplast product
          Length = 1047

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 750 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 801



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>gb|AY195986.1| Glycine albicans clone alb2049.21.GScp glutamine synthetase gene,
           partial cds; nuclear gene for chloroplast product
          Length = 1046

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 748 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 799



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>emb|X65929.1|ZMGS14 Z.mays mRNA gs1-4 for glutamine synthetase
          Length = 1490

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacc 45
           ||||||||||||||||| || |||||||||| |||||| |||||
Sbjct: 652 aacggggaggtcatgccggggcagtgggagttccaggtcggacc 695



to top

>emb|AJ271909.1|BNA271909 Brassica napus gln gene for plastid glutamine synthetase, exons 1-12
          Length = 5232

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                        
Query: 99   agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagggtg 158
            |||||||||| || ||||||||||| || || || ||||| || ||||| ||  ||||||
Sbjct: 3628 agagaatcacagaacaagctggtgttgtcctaacacttgatcccaaaccgattgagggtg 3687

                            
Query: 159  actggaacggagctgg 174
            |||||||||| |||||
Sbjct: 3688 actggaacggtgctgg 3703



to top

>gb|AY189927.1| Nogra grahamii glutamine synthetase gene, partial cds; nuclear gene
           for chloroplast product
          Length = 1118

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 821 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 872



to top

>gb|AY189926.1| Pueraria montana glutamine synthetase gene, partial cds; nuclear
           gene for chloroplast product
          Length = 1084

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 783 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 834



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           ||||||||||| || ||||| || || || |||||||| || || || || || ||||||
Sbjct: 121 cagtgggagtatcaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 180

                             
Query: 83  tccagatacattctcgag 100
           || |||||||| ||||||
Sbjct: 181 tcaagatacatcctcgag 198



to top

>gb|AY189925.1| Glycine soja glutamine synthetase gene, partial cds; nuclear gene
           for chloroplast product
          Length = 1043

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 747 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 798



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 122 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 181

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 182 tcaaggtacatcctcgag 199



to top

>gb|AY189924.1| Teramnus repens glutamine synthetase gene, partial cds; nuclear
           gene for chloroplast product
          Length = 1078

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| | |||| ||||||| |||||||||||
Sbjct: 780 agagaattactgagcaagctggtgttgcgctctcccttgatccaaaaccaat 831



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 120 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 179

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 180 tcaaggtacatcctcgag 197



to top

>dbj|AB013393.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE4
          Length = 63989

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                         
Query: 99    agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagggtg 158
             |||||||||| || ||||||||||| || || || ||||| || ||||| ||  ||||||
Sbjct: 42511 agagaatcacagaacaagctggtgttgtcctaacacttgatcccaaaccgatagagggtg 42570

                             
Query: 159   actggaacggagctgg 174
             |||||||||| |||||
Sbjct: 42571 actggaacggtgctgg 42586



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 23    cagtgggagtaccaggttggacccagcgttggtattgatgcagg 66
             |||||||||| ||| ||||| || ||||| || |||||||||||
Sbjct: 42362 cagtgggagttccaagttggcccgagcgtaggaattgatgcagg 42405



to top

>gb|AY103627.1| Zea mays PCO073484 mRNA sequence
          Length = 1571

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacc 45
           ||||||||||||||||| || |||||||||| |||||| |||||
Sbjct: 654 aacggggaggtcatgccggggcagtgggagttccaggtcggacc 697



to top

>gb|AF068877.1|AF068877 Glycine falcata glutamine synthetase gene, paralog 2, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 1067

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 763 agagaattaccgagcaagctggtgttgtgctctctcttgatccaaaaccaat 814



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 133 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatttgggct 192

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 193 tcaaggtacatcctcgag 210



to top

>gb|AF068876.1|AF068876 Glycine curvata glutamine synthetase gene, paralog 2, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 1084

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 773 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 824



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 139 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 198

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 199 tcaaggtacatcctcgag 216



to top

>gb|AF068875.1|AF068875 Glycine microphylla glutamine synthetase gene, paralog 2, nuclear
           gene encoding chloroplast protein, partial cds
          Length = 1075

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 763 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 814



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 133 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 192

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 193 tcaaggtacatcctcgag 210



to top

>gb|AF068874.1|AF068874 Glycine canescens glutamine synthetase gene, paralog 2, nuclear
           gene encoding chloroplast protein, partial cds
          Length = 1076

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 764 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 815



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 133 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 192

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 193 tcaaggtacatcctcgag 210



to top

>gb|AF068872.1|AF068872 Glycine curvata glutamine synthetase gene, paralog 1, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 1257

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 942 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 993



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 132 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 191

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 192 tcaaggtacatcctcgag 209



to top

>gb|AF068871.1|AF068871 Glycine microphylla glutamine synthetase gene, paralog 1, nuclear
           gene encoding chloroplast protein, partial cds
          Length = 1068

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 763 agagaattactgagcaagctggtgttgtgctctctcttgatccaaaaccaat 814



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 132 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 191

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 192 tcaaggtacatcctcgag 209



to top

>gb|AF068869.1|AF068869 Glycine soja glutamine synthetase gene, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 1066

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |||||| | ||||| |||||||||||
Sbjct: 758 agagaattaccgagcaagctggtgttgtgctctctcttgatccaaaaccaat 809



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || |||||||| || || || || || ||||||
Sbjct: 124 cagtgggagtaccaagttggtcctagtgtaggtattgaggctggtgatcatatctgggct 183

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 184 tcaaggtacatcctcgag 201



to top

>dbj|D25325.1|RADGS1BB Raphanus sativus gs1 beta mRNA for glutamine synthetase, complete
           cds
          Length = 1484

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 135 ttgacccaaaaccaatccagggtgactggaacggagctgg 174
           |||||||||||||||| |  ||||||||||||||||||||
Sbjct: 870 ttgacccaaaaccaattcctggtgactggaacggagctgg 909



 Score = 46.1 bits (23), Expect = 0.036
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 11  gtcatgcctggtcagtgggagtaccaggttggacc 45
           |||||||||||||||||||||| ||| || |||||
Sbjct: 746 gtcatgcctggtcagtgggagttccaagtcggacc 780



to top

>dbj|D14576.1|MZEGS1A Zea mays mRNA for glutamine synthetase, complete cds
          Length = 1422

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacc 45
           ||||||||||||||||| || |||||||||| |||||| |||||
Sbjct: 642 aacggggaggtcatgccggggcagtgggagttccaggtcggacc 685



to top

>dbj|AB015045.1| Arabidopsis thaliana gene for Glutamine Synthetase, complete cds
          Length = 7498

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                        
Query: 99   agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagggtg 158
            |||||||||| || ||||||||||| || || || ||||| || ||||| ||  ||||||
Sbjct: 3190 agagaatcacagaacaagctggtgttgtcctaacacttgatcccaaaccgatagagggtg 3249

                            
Query: 159  actggaacggagctgg 174
            |||||||||| |||||
Sbjct: 3250 actggaacggtgctgg 3265



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 23   cagtgggagtaccaggttggacccagcgttggtattgatgcagg 66
            |||||||||| ||| ||||| || ||||| || |||||||||||
Sbjct: 3041 cagtgggagttccaagttggcccgagcgtaggaattgatgcagg 3084



to top

>gb|AY261641.1| Passiflora sandrae Yockteng-112 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 425

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||| |
Sbjct: 24  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggggt 83

                                  
Query: 83  tccagatacattctcgagagaat 105
           || ||||||||||| ||| ||||
Sbjct: 84  tcaagatacattcttgagggaat 106



to top

>gb|AY261623.1| Passiflora nitida Vecchia-45 96 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 564

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||  |
Sbjct: 64  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatggtgt 123

                      
Query: 83  tccagatacat 93
           || ||||||||
Sbjct: 124 tcaagatacat 134



to top

>gb|AY261586.1| Passiflora foetida var. hastata Houel-Guy13 glutamine synthetase
           GS2 (ncpGS) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 642

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 22  tcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggc 81
           ||||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  
Sbjct: 102 tcagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtg 161

                          
Query: 82  ttccagatacattct 96
           ||| |||||||||||
Sbjct: 162 ttcaagatacattct 176



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || || || ||||| |||||||||||
Sbjct: 315 agagaatcactgaacaagctggcgttgttctgactcttgatccaaaaccaat 366



to top

>gb|AY261584.1| Passiflora foetida Yockteng-55 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 541

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 22  tcagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggc 81
           ||||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  
Sbjct: 40  tcagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtg 99

                          
Query: 82  ttccagatacattct 96
           ||| |||||||||||
Sbjct: 100 ttcaagatacattct 114



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || || || ||||| |||||||||||
Sbjct: 253 agagaatcactgaacaagctggcgttgttctgactcttgatccaaaaccaat 304



to top

>ref|XM_390440.1| Gibberella zeae PH-1 chromosome 1 GLNA_GIBFU Glutamine synthetase
           (Glutamate--ammonia ligase) (GS) (FG10264.1) partial
           mRNA
          Length = 1065

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 8   gaggtcatgcctggtcagtgggagtaccaggttgg 42
           |||||||||||||  ||||||||||||||||||||
Sbjct: 577 gaggtcatgcctgcccagtgggagtaccaggttgg 611



to top

>emb|X05515.1|PSGSR3 Pea nodule mRNA for glutamine synthetase (EC 6.3.1.2)
          Length = 1065

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 116 gctggtgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||||||||| || ||| ||||||| ||||||||  ||||||||||||| || |||||
Sbjct: 392 gctggtgtggttcttacctttgaccctaaaccaattaagggtgactggaatggtgctgg 450



to top

>gb|M20663.1|PEAGSCY1A Pisum satiivum glutamine synthetase (cytosolic GS1) mRNA, complete
           cds
          Length = 1434

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 116 gctggtgtggtgctcacccttgacccaaaaccaatccagggtgactggaacggagctgg 174
           ||||||||||| || ||| ||||||| ||||||||  ||||||||||||| || |||||
Sbjct: 761 gctggtgtggttcttacctttgaccctaaaccaattaagggtgactggaatggtgctgg 819



to top

>gb|AY261655.1| Passiflora tetrandra Yockteng-128 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 618

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||| |
Sbjct: 76  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggggt 135

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 136 tcaagatacattct 149



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  |||||||||||||||||
Sbjct: 279 agagaatcaccgaacaagctggcgttgttctcagtcttgacccaaaaccaat 330



to top

>gb|AY261617.1| Passiflora mixta JBAVH-3317 glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 420

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || |||||  | ||||||  |
Sbjct: 29  cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatgatatatggtgt 88

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 89  tcaagatacattct 102



to top

>gb|AY261593.1| Passiflora helleri Yockteng-66 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 497

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||| |
Sbjct: 63  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggggt 122

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 123 tcaagatacattct 136



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||| ||| || || ||||| ||||| |||||||||||
Sbjct: 210 agagaatcactgaacaagttggcgttgttctcactcttgatccaaaaccaat 261



to top

>gb|AY261587.1| Passiflora foetida var. hirsutissima Yockteng-58 (P) glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 566

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 73  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 132

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 133 tcaagatacattct 146



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || || || ||||| |||||||||||
Sbjct: 262 agagaatcactgaacaagctggcgttgttctgactcttgatccaaaaccaat 313



to top

>gb|AY261585.1| Passiflora foetida var. arizonica Morse-200000041 glutamine
           synthetase GS2 (ncpGS) gene, partial cds; nuclear gene
           for chloroplast product
          Length = 560

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 44  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 103

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 104 tcaagatacattct 117



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || || || ||||| |||||||||||
Sbjct: 256 agagaatcactgaacaagctggcgttgttctgactcttgatccaaaaccaat 307



to top

>gb|AY261583.1| Passiflora foetida glutamine synthetase GS2 (ncpGS) gene, partial
          cds; nuclear gene for chloroplast product
          Length = 497

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                      
Query: 23 cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
          |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 1  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 60

                        
Query: 83 tccagatacattct 96
          || |||||||||||
Sbjct: 61 tcaagatacattct 74



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || || || ||||| |||||||||||
Sbjct: 213 agagaatcactgaacaagctggcgttgttctgactcttgatccaaaaccaat 264



to top

>gb|AY261570.1| Passiflora coriacea JBAVH-3319 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 512

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| ||||| || || ||||| || ||||| || ||||||  |
Sbjct: 73  cagtgggagtaccaagttggtcccagtgtgggcattgacgctggagatcatatatggtgt 132

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 133 tcaagatacattct 146



to top

>gb|AY261557.1| Passiflora capsularis Morse-199500133 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 490

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| |||||||| || ||||||  |
Sbjct: 46  cagtgggagtaccaagttggtcctagtgtgggcattgacgcaggagatcatatatggtgt 105

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 106 tcaagatacattct 119



to top

>gb|AY261550.1| Passiflora aurantia Yockteng-13 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 504

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| |||||||||  |
Sbjct: 86  cagtgggagtaccaagttggtcctagtgtgggcattgacgccggagatcacatatggtgt 145

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 146 tcaagatacattct 159



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 236 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 287



to top

>gb|AY261546.1| Passiflora amoena Yockteng-10 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 577

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || || || |||||||| || ||||||  |
Sbjct: 78  cagtgggagtaccaagttggtcctagtgtgggcatcgaagcaggagatcatatatggtgt 137

                             
Query: 83  tccagatacattctcgag 100
           || |||||||||||||||
Sbjct: 138 tcaagatacattctcgag 155



to top

>gb|AY261545.1| Passiflora amoena Vecchia-3 glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 569

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || || || |||||||| || ||||||  |
Sbjct: 79  cagtgggagtaccaagttggtcctagtgtgggcatcgaagcaggagatcatatatggtgt 138

                             
Query: 83  tccagatacattctcgag 100
           || |||||||||||||||
Sbjct: 139 tcaagatacattctcgag 156



to top

>emb|X65927.1|ZMGS12 Z.mays mRNA gs1-2 for glutamine synthetase
          Length = 1369

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggt 39
           ||||||||||||||||| || |||||||||| ||||||
Sbjct: 667 aacggggaggtcatgccggggcagtgggagttccaggt 704



to top

>gb|AY189923.1| Teramnus labialis clone 8 glutamine synthetase gene, partial cds;
           nuclear gene for chloroplast product
          Length = 1036

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| ||||| || |||||||| || || || || || ||||||
Sbjct: 119 cagtgggagtaccaagttggtcccagtgtaggtattgaggctggtgatcatatctgggct 178

                             
Query: 83  tccagatacattctcgag 100
           || || ||||| ||||||
Sbjct: 179 tcaaggtacatcctcgag 196



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || |||||||||||||| |  ||| | ||||| |||||||||||
Sbjct: 740 agagaattactgagcaagctggtgttgccctctctcttgatccaaaaccaat 791



to top

>gb|AY104270.1| Zea mays PCO127708 mRNA sequence
          Length = 1538

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggt 39
           ||||||||||||||||| || |||||||||| ||||||
Sbjct: 667 aacggggaggtcatgccggggcagtgggagttccaggt 704



to top

>dbj|D25324.1|RADGS1AA Raphanus sativus gs1 alpha mRNA for glutamine synthetase, complete
           cds
          Length = 1333

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 137 gacccaaaaccaatccagggtgactggaacggagctgg 174
           |||||||||||| ||| ||||||||||||||| |||||
Sbjct: 739 gacccaaaaccagtcccgggtgactggaacggggctgg 776



to top

>gb|AY835454.1| Saccharum officinarum glutamine synthetase (GS1.b) mRNA, complete
           cds
          Length = 1422

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 132 cccttgacccaaaaccaatccagggtgactggaacgg 168
           |||| |||||||| || ||||||||||||||||||||
Sbjct: 764 ccctcgacccaaagccgatccagggtgactggaacgg 800



 Score = 38.2 bits (19), Expect = 8.7
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                          
Query: 2   aacggggaggtcatgcctggtcagtgggagt 32
           ||||| || ||||||||||| ||||||||||
Sbjct: 634 aacggcgaagtcatgcctggccagtgggagt 664



to top

>gb|AY261588.1| Passiflora gabriellana Houel-Guy15 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 590

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgg 79
           |||||||||||||| |||||||| || || || |||||||| ||||| || ||||||
Sbjct: 97  cagtgggagtaccaagttggacctagtgtgggcattgatgctggagatcatatatgg 153



to top

>gb|AY261582.1| Passiflora exura Yockteng-52 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 525

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| |||| ||| || ||||||  |
Sbjct: 36  cagtgggagtaccaagttggacctagtgtgggcattgacgcagnagatcatatatggtgt 95

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 96  tcaagatacatt 107



to top

>gb|AY491968.1| Triticum aestivum glutamine synthetase isoform GSr1 (GS) gene,
           complete cds
          Length = 1397

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttgg 42
           ||||||||||||||||| || |||||||||| ||| |||||
Sbjct: 645 aacggggaggtcatgcccggccagtgggagttccaagttgg 685



to top

>gb|DQ427811.1| Sorghum bicolor voucher PI267408 locus HHU39 genomic sequence
          Length = 826

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| |||||||||||  | || || |||||||| ||||||||||| ||||
Sbjct: 341 agagaatcacagagcaagctgggattgtccttacccttgatccaaaaccaattcagg 397



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 482 cagggtgactggaatggagctggctg 507



to top

>gb|DQ427806.1| Sorghum bicolor voucher NSL87902a locus HHU39 genomic sequence
          Length = 837

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| |||||||||||  | || || |||||||| ||||||||||| ||||
Sbjct: 344 agagaatcacagagcaagctgggattgtccttacccttgatccaaaaccaattcagg 400



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 493 cagggtgactggaatggagctggctg 518



to top

>gb|DQ427803.1| Sorghum bicolor voucher NSL77034 locus HHU39 genomic sequence
          Length = 826

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| |||||||||||  | || || |||||||| ||||||||||| ||||
Sbjct: 341 agagaatcacagagcaagctgggattgtccttacccttgatccaaaaccaattcagg 397



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 482 cagggtgactggaatggagctggctg 507



to top

>gb|DQ427802.1| Sorghum bicolor voucher NSL56174 locus HHU39 genomic sequence
          Length = 826

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaatccagg 155
           |||||||||| |||||||||||  | || || |||||||| ||||||||||| ||||
Sbjct: 341 agagaatcacagagcaagctgggattgtccttacccttgatccaaaaccaattcagg 397



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 152 cagggtgactggaacggagctggctg 177
           |||||||||||||| |||||||||||
Sbjct: 482 cagggtgactggaatggagctggctg 507



to top

>emb|X82997.1|BNGLN B.napus mRNA for cytosolic glutamine synthetase isoform (BnGSR2-1)
           related to the A-genome type of Brassica campestris
          Length = 1354

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttgg 42
           ||||| || |||||||||||||||||||||| ||| |||||
Sbjct: 629 aacggagaagtcatgcctggtcagtgggagttccaagttgg 669



to top

>ref|NM_103743.2| Arabidopsis thaliana GLN1;5; glutamate-ammonia ligase AT1G48470
           (GLN1;5) mRNA, complete cds
          Length = 1307

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 140 ccaaaaccaatccagggtgactggaacggagc 171
           |||||||||||||||||||| ||||| |||||
Sbjct: 779 ccaaaaccaatccagggtgattggaatggagc 810



to top

>gb|BT015449.1| Arabidopsis thaliana At1g48470 mRNA sequence
          Length = 1059

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 140 ccaaaaccaatccagggtgactggaacggagc 171
           |||||||||||||||||||| ||||| |||||
Sbjct: 703 ccaaaaccaatccagggtgattggaatggagc 734



to top

>ref|XM_955811.1| Neurospora crassa OR74A GLUTAMINE SYNTHETASE (GLUTAMATE--AMMONIA
           LIGASE) (NCU06724.1) partial mRNA
          Length = 1038

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 8   gaggtcatgcctggtcagtgggagtaccaggt 39
           ||||||||||||| ||||||||||| ||||||
Sbjct: 538 gaggtcatgcctgctcagtgggagttccaggt 569



to top

>ref|XM_327009.1| Neurospora crassa OR74A GLUTAMINE SYNTHETASE (GLUTAMATE--AMMONIA
           LIGASE) (NCU06724.1) partial mRNA
          Length = 1038

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 8   gaggtcatgcctggtcagtgggagtaccaggt 39
           ||||||||||||| ||||||||||| ||||||
Sbjct: 538 gaggtcatgcctgctcagtgggagttccaggt 569



to top

>gb|AY835453.1| Saccharum officinarum glutamine synthetase (GS1.a) mRNA, complete
           cds
          Length = 1596

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 2   aacggggaggtcatgcctggtcagtgggagtaccaggttggacc 45
           ||||| ||||||||||| || |||||||||| ||| ||||||||
Sbjct: 650 aacggagaggtcatgccagggcagtgggagttccaagttggacc 693



to top

>gb|AY261666.1| Passiflora umbilicata Houel-27 157 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 631

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 326 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 377



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagtgtgggcattgaggctggagatcatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



to top

>gb|AY261663.1| Passiflora trisecta Yockteng-133 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 610

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| ||||| || ||||| || |||||  | ||||||  |
Sbjct: 114 cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatgatatatggtgt 173

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 174 tcaagatacatt 185



to top

>gb|AY261654.1| Passiflora telesiphe Yockteng-127 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 468

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 195 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 246



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 45  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 104

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 105 tcaagatacattct 118



to top

>gb|AY261648.1| Passiflora serrulata Yockteng-119 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 562

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || ||||||||||| || ||||  ||||| |||||||||||
Sbjct: 264 agagaatcactgaacaagctggtgttgttctcagtcttgatccaaaaccaat 315



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 52  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 111

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 112 tcaagatacatt 123



to top

>gb|AY261647.1| Passiflora serratodigitata Vecchia-58 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 642

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 106 cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 165

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 166 tcaagatacatt 177



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 318 agagaatcactgaacaagctggcgttgttctcattcttgatccaaaaccaat 369



to top

>gb|AY261646.1| Passiflora serratodigitata glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 651

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 115 cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 174

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 175 tcaagatacatt 186



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 327 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 378



to top

>gb|AY261645.1| Passiflora serratodigitata Morse-199900027 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 651

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 115 cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 174

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 175 tcaagatacatt 186



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 327 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 378



to top

>gb|AY261644.1| Passiflora seemannii Yockteng-116 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 569

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 52  cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 111

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 112 tcaagatacatt 123



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 265 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 316



to top

>gb|AY261643.1| Passiflora sanguinolenta Morse-199800014 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 568

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 102 cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 161

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 162 tcaagatacatt 173



to top

>gb|AY261642.1| Passiflora morifolia Yockteng-93 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 471

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 199 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 250



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 49  cagtgggagtaccaagttggtcctagtgtgggcattgacgccggagatcatatatggtgt 108

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 109 tcaagatacattct 122



to top

>gb|AY261635.1| Passiflora platyloba Vecchia-50 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 615

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 116 cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 175

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 176 tcaagatacatt 187



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 328 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 379



to top

>gb|AY261632.1| Passiflora quadrangularis Morse-19990006 glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 650

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || |||||||| ||||| || ||||||  |
Sbjct: 109 cagtgggagtaccaagttggtcctagtgtgggcattgatgctggagatcatatatggtgt 168

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 169 tcaagatacatt 180



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 321 agagaatcaccgaacaagctggcgttgttctcagtcttgatccaaaaccaat 372



to top

>gb|AY261630.1| Passiflora platyloba Vecchia-51 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 615

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 115 cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 174

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 175 tcaagatacatt 186



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 327 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 378



to top

>gb|AY261620.1| Passiflora multiflora Yockteng-159 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 492

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || ||||||||||| || ||||| ||||| || ||||||||
Sbjct: 208 agagaatcactgaacaagctggtgttgttctcactcttgatcctaaaccaat 259



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 58  cagtgggagtaccaagttggtcctagtgtgggcattgacgccggagatcatatatggtgt 117

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 118 tcaagatacattct 131



to top

>gb|AY261613.1| Passiflora membranacea Yockteng-88 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 445

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 200 agagaatcactgaacaagctggagttgttctcactcttgatccaaaaccaat 251



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 50  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 109

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 110 tcaagatacattct 123



to top

>gb|AY261612.1| Passiflora mathewsii Yockteng-87 (P) glutamine synthetase GS2
          (ncpGS) gene, partial cds; nuclear gene for chloroplast
          product
          Length = 505

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                      
Query: 23 cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
          |||||||||||||| |||||||| ||||| || ||||| || |||||  | ||||||  |
Sbjct: 9  cagtgggagtaccaagttggacctagcgtgggcattgacgctggagatgatatatggtgt 68

                      
Query: 83 tccagatacatt 94
          || |||||||||
Sbjct: 69 tcaagatacatt 80



to top

>gb|AY261610.1| Passiflora maliformis JBMedellin 85 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 539

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 43  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 102

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 103 tcaagatacatt 114



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 255 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 306



to top

>gb|AY261608.1| Passiflora ligularis JBAVH-3318 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 572

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 52  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 111

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 112 tcaagatacatt 123



to top

>gb|AY261607.1| Passiflora ligularis Yockteng-83 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 490

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 66  cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 125

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 126 tcaagatacatt 137



to top

>gb|AY261606.1| Passiflora ligularis Vecchia-67 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 616

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 115 cagtgggagtaccaagttggacctagtgtgggcattgacgctggagatcatatatggtgt 174

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 175 tcaagatacatt 186



to top

>gb|AY261605.1| Passiflora ligularis Yockteng-84 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 614

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || || ||||| || ||||| || ||||||  |
Sbjct: 115 cagtgggagtaccaagttggaccaagtgtgggcattgacgctggagatcatatatggtgt 174

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 175 tcaagatacatt 186



to top

>gb|AY261599.1| Passiflora karwinskii Yockteng-73 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 500

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 193 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 244



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 43  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 102

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 103 tcaagatacattct 116



to top

>gb|AY261598.1| Passiflora kalbreyeri Yockteng-72 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 486

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 194 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 245



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 44  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 103

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 104 tcaagatacattct 117



to top

>gb|AY261596.1| Passiflora indecora Yockteng-70 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 401

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 195 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 246



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 45  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 104

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 105 tcaagatacattct 118



to top

>gb|AY261595.1| Passiflora hirtiflora Yockteng-67 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 463

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 191 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 242



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 41  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 100

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 101 tcaagatacattct 114



to top

>gb|AY261577.1| Passiflora edulis Yockteng-44 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 542

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || |  |||||||| ||||| || ||||||  |
Sbjct: 48  cagtgggagtaccaagttggacctagtgtggccattgatgctggagatcatatatggtgt 107

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 108 tcaagatacatt 119



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 260 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 311



to top

>gb|AY261576.1| Passiflora edulis Yockteng-43 (P) glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 562

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || |  |||||||| ||||| || ||||||  |
Sbjct: 46  cagtgggagtaccaagttggacctagtgtggccattgatgctggagatcatatatggtgt 105

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 106 tcaagatacatt 117



 Score = 40.1 bits (20), Expect = 2.2
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||  ||||| |||||||||||
Sbjct: 258 agagaatcactgaacaagctggcgttgttctcagtcttgatccaaaaccaat 309



to top

>gb|AY261574.1| Passiflora edulis Morse glutamine synthetase GS2 (ncpGS) gene,
           partial cds; nuclear gene for chloroplast product
          Length = 547

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| |||||||| || || |  |||||||| ||||| || ||||||  |
Sbjct: 98  cagtgggagtaccaagttggacctagtgtggccattgatgctggagatcatatatggtgt 157

                       
Query: 83  tccagatacatt 94
           || |||||||||
Sbjct: 158 tcaagatacatt 169



to top

>gb|AY261561.1| Passiflora cinnabarina ANBG-66949 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 490

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 205 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 256



to top

>gb|AY261540.1| Passiflora alnifolia Yockteng-6 (P) glutamine synthetase GS2
           (ncpGS) gene, partial cds; nuclear gene for chloroplast
           product
          Length = 500

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 193 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 244



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 43  cagtgggagtaccaagttggtcctagtgtgggcattgacgctggagatcatatatggtgt 102

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 103 tcaagatacattct 116



to top

>gb|AY261536.1| Passiflora adenopoda Vecchia-1 glutamine synthetase GS2 (ncpGS)
           gene, partial cds; nuclear gene for chloroplast product
          Length = 517

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           |||||||||| || |||||||| || || ||||| ||||| |||||||||||
Sbjct: 214 agagaatcactgaacaagctggcgttgttctcactcttgatccaaaaccaat 265



 Score = 44.1 bits (22), Expect = 0.14
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 23  cagtgggagtaccaggttggacccagcgttggtattgatgcaggagaccacatatgggct 82
           |||||||||||||| ||||| || || || || ||||| || ||||| || ||||||  |
Sbjct: 64  cagtgggagtaccaagttggtcctagtgtgggcattgacgccggagatcatatatggtgt 123

                         
Query: 83  tccagatacattct 96
           || |||||||||||
Sbjct: 124 tcaagatacattct 137



to top

>gb|AF424638.1| Phytophthora infestans clone MY-01-A-07 glutamine synthetase mRNA,
           complete cds
          Length = 1340

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 8   gaggtcatgcctggtcagtgggagtaccaggt 39
           ||||| |||||||| |||||||||||||||||
Sbjct: 632 gaggtgatgcctggccagtgggagtaccaggt 663



to top

>emb|BX294092.1|NCB11H7 Neurospora crassa DNA linkage group V BAC clone B11H7
          Length = 74977

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 8     gaggtcatgcctggtcagtgggagtaccaggt 39
             ||||||||||||| ||||||||||| ||||||
Sbjct: 39824 gaggtcatgcctgctcagtgggagttccaggt 39793



to top

>emb|AJ704831.1| Protea pruinosa partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 813

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 408 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 459



to top

>emb|AJ704830.1| Protea cryophila partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 813

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 408 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 459



to top

>emb|AJ699508.1| Protea revoluta partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 805

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 396 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 447



to top

>emb|AJ699506.1| Protea intonsa partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 834

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 421 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 472



to top

>emb|AJ699505.1| Protea rupicola partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 427 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 478



to top

>emb|AJ699504.1| Protea enervis partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 428 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 479



to top

>emb|AJ699502.1| Protea glabra partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 835

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 427 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 478



to top

>emb|AJ699501.1| Protea scolymocephala partial ncpGS gene for glutamine synthase,
           exons 1-5
          Length = 830

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 427 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 478



to top

>emb|AJ699500.1| Protea sulphurea partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 829

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 424 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 475



to top

>emb|AJ699499.1| Protea foliosa partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 827

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 422 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 473



to top

>emb|AJ699498.1| Protea coronata partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 830

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 427 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 478



to top

>emb|AJ699494.1| Protea canaliculata partial ncpGS gene for glutamine synthase,
           exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699493.1| Protea pendula partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699492.1| Protea vogtsiae partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699491.1| Protea pityphylla partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699490.1| Protea simplex partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699489.1| Protea inopina partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699488.1| Protea caffra partial ncpGS gene for glutamine synthase, exons 1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477



to top

>emb|AJ699487.1| Protea welwitschii partial ncpGS gene for glutamine synthase, exons
           1-5
          Length = 839

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 99  agagaatcacggagcaagctggtgtggtgctcacccttgacccaaaaccaat 150
           ||||||| || || |||||||| || || ||||||||||| |||||||||||
Sbjct: 426 agagaattaccgaacaagctggcgttgtcctcacccttgatccaaaaccaat 477


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,097,232
Number of Sequences: 3902068
Number of extensions: 1097232
Number of successful extensions: 70498
Number of sequences better than 10.0: 535
Number of HSP's better than 10.0 without gapping: 534
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 69463
Number of HSP's gapped (non-prelim): 1035
length of query: 177
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 155
effective length of database: 17,147,199,772
effective search space: 2657815964660
effective search space used: 2657815964660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top