ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet60d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY325266.1| Hordeum vulgare cytosolic heat shock protein 90 (... 321 5e-85
2emb|X98582.1|TAX98582 T.aestivum mRNA for HSP80-2 protein 313 1e-82
3dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 222 4e-55
4dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 222 4e-55
5dbj|AK101323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 4e-55
6dbj|AK064780.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 4e-55
7gb|BT018733.1| Zea mays clone EL01N0520C02.d mRNA sequence 214 9e-53
8dbj|AB111810.1| Oryza sativa (japonica cultivar-group) Hsp90 mRN... 214 9e-53
9ref|NM_124982.2| Arabidopsis thaliana ATP binding / unfolded pro... 212 4e-52
10emb|Y11828.1|ATHSP814 A.thaliana hsp81.4 gene 212 4e-52
11dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 212 4e-52
12ref|NM_124985.3| Arabidopsis thaliana HSP81-2; ATP binding / unf... 206 2e-50
13gb|BT000717.1| Arabidopsis thaliana clone RAFL09-76-I24 (R19621)... 206 2e-50
14gb|AY064070.2| Arabidopsis thaliana At5g56030 mRNA sequence 206 2e-50
15gb|AY128805.1| Arabidopsis thaliana heat shock protein 81-2 (At5... 206 2e-50
16gb|AY062750.1| Arabidopsis thaliana HEAT SHOCK PROTEIN 81-2 (HSP... 206 2e-50
17gb|BT002535.1| Arabidopsis thaliana Unknown protein mRNA, comple... 206 2e-50
18gb|BT024184.1| Zea mays clone EL01N0315D01 mRNA sequence 206 2e-50
19gb|BT001944.1| Arabidopsis thaliana clone C105057 putative heat-... 206 2e-50
20gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome... 198 5e-48
21dbj|AK061896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 198 5e-48
22dbj|AK119663.1| Oryza sativa (japonica cultivar-group) cDNA clon... 198 5e-48
23gb|AY368905.1| Nicotiana benthamiana molecular chaperone Hsp90-2... 192 3e-46
24gb|AY310776.1| Nicotiana benthamiana clone 8-240 unknown mRNA 192 3e-46
25ref|NM_124983.3| Arabidopsis thaliana HSP81-3; ATP binding / unf... 190 1e-45
26emb|Y11827.1|ATHSP812 A.thaliana hsp81.2 gene 190 1e-45
27gb|AY070031.1| Arabidopsis thaliana putative heat shock protein ... 190 1e-45
28gb|AY081302.1| Arabidopsis thaliana heat shock protein 90 (At5g5... 190 1e-45
29gb|AY062832.1| Arabidopsis thaliana heat shock protein 90 (At5g5... 190 1e-45
30gb|AY050349.1| Arabidopsis thaliana AT5g56010/MDA7_5 mRNA, parti... 190 1e-45
31gb|AY368904.1| Nicotiana benthamiana molecular chaperone Hsp90-1... 184 8e-44
32dbj|D29710.1|RICYK22 Oryza sativa mRNA, partial homologous to he... 182 3e-43
33gb|U55860.1|TAU55860 Triticum aestivum heat shock protein 90 mRN... 182 3e-43
34ref|XM_483191.1| Oryza sativa (japonica cultivar-group), mRNA 180 1e-42
35emb|Z11920.1|OSHSP82A O.sativa gene for heat shock protein 82 HSP82 180 1e-42
36dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 180 1e-42
37dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic D... 180 1e-42
38dbj|AP003873.2| Oryza sativa (japonica cultivar-group) genomic D... 180 1e-42
39dbj|AK102426.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 1e-42
40gb|AY368907.1| Lycopersicon esculentum molecular chaperone Hsp90... 176 2e-41
41gb|AY310781.1| Nicotiana benthamiana clone 9-037 unknown mRNA 176 2e-41
42gb|M96549.1|TOMHSC80P Tomato heat shock cognate protein 80 gene,... 176 2e-41
43gb|S77849.1| HSP81-3=heat-shock Protein [Arabidopsis thaliana=th... 174 8e-41
44dbj|D10428.1|RICAK108 Oryza sativa mRNA for heat shock protein 9... 174 8e-41
45gb|AY368906.1| Lycopersicon esculentum molecular chaperone Hsp90... 170 1e-39
46gb|AY310789.1| Nicotiana benthamiana clone 10-186 unknown mRNA 170 1e-39
47gb|AY103538.1| Zea mays PCO150589 mRNA sequence 167 2e-38
48emb|X63195.1|NTHSP82 N.tabacum mRNA for heat shock protein 82 161 1e-36
49gb|U55859.1|TAU55859 Triticum aestivum heat shock protein 80 mRN... 161 1e-36
50gb|DQ252488.1| Solanum tuberosum clone 054G03 Hsp90-2-like mRNA,... 161 1e-36
51gb|AY805121.1| Iris tectorum clone 3ItDoFw-Z3 putative heat shoc... 159 5e-36
52gb|AY519499.1| Nicotiana tabacum heat shock protein 90 (OINtHsp9... 155 7e-35
53ref|NM_124642.2| Arabidopsis thaliana HSP81-1 (HEAT SHOCK PROTEI... 151 1e-33
54gb|BT001091.1| Arabidopsis thaliana At5g52640/F6N7_13 mRNA, comp... 151 1e-33
55emb|Y07613.1|ATHSP90A A.thaliana hsp90A gene 151 1e-33
56gb|AY128296.1| Arabidopsis thaliana AT5g52640/F6N7_13 mRNA, comp... 151 1e-33
57dbj|AB025606.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 151 1e-33
58dbj|D00710.1|ATHHSP81 Arabidopsis thaliana HSP81-1 gene for 81kD... 151 1e-33
59gb|M62984.1|ATHHSP83 A.thaliana heat shock protein 83 mRNA, comp... 143 3e-31
60emb|CT573078.1| Medicago truncatula chromosome 5 clone mte1-4f8,... 139 4e-30
61dbj|D11138.1|RICGE2 Oryza sativa (japonica cultivar-group) mRNA ... 135 7e-29
62gb|S56878.1| gravity specific cDNA {clone GSC381} [Oryza sativa,... 135 7e-29
63gb|BC008189.1| Mus musculus, clone IMAGE:3584589, mRNA, partial cds 131 1e-27
64gb|M99431.1|PHNHSP83A Pharbitis nil heat shock protein 83 (Hsp83... 129 4e-27
65dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic D... 127 2e-26
66dbj|AK065528.1| Oryza sativa (japonica cultivar-group) cDNA clon... 127 2e-26
67dbj|AB236777.1| Trifolium pratense RNA for putative HEAT SHOCK P... 121 1e-24
68gb|AF521007.1| Hevea brasiliensis heat shock protein mRNA, compl... 117 2e-23
69gb|AF462213.1| Narcissus pseudonarcissus putative heat shock pro... 113 2e-22
70gb|AY226090.1| Nematostella vectensis 90-kDa heat-shock protein ... 111 1e-21
71gb|AY226088.1| Sycon sp. AR-2003 90-kDa heat-shock protein (hsp9... 111 1e-21
72gb|AY423488.1| Opistophthalmus carinatus Hsp90 (HSP90) mRNA, com... 107 2e-20
73gb|AY122634.1| Naegleria gruberi strain ATCC 30224 heat shock pr... 105 6e-20
74gb|AY167735.1| Populus alba HSP80 mRNA, partial cds 96 6e-17
75gb|AY389747.1| Hyacinthus orientalis heat shock protein 82 mRNA,... 94 2e-16
76gb|AY236717.1| Thaumatomonas sp. (SA) heat shock protein 90 (Hsp... 90 4e-15
77ref|NM_001030484.1| Xenopus tropicalis heat shock 90kDa protein ... 90 4e-15
78gb|BC090610.1| Xenopus tropicalis heat shock 90kDa protein beta,... 90 4e-15
79gb|DQ062089.1| Lamtostyla sp. LPJ-2005 heat shock protein 90 mRN... 90 4e-15
80gb|AY391258.1| Oxyrrhis marina heat shock protein 90 gene, parti... 86 6e-14
81gb|AY226087.1| Leucosolenia sp. 90-kDa heat-shock protein (hsp90... 86 6e-14
82gb|DQ206492.1| Platynereis dumerilii isolate TOA67 heat shock 90... 86 6e-14
83gb|AY214170.1| Paralichthys olivaceus heat shock protein 90 beta... 84 2e-13
84ref|XM_470993.1| Oryza sativa (japonica cultivar-group), predic... 82 9e-13
85ref|XM_323481.1| Neurospora crassa OR74A hypothetical protein ( ... 82 9e-13
86ref|XM_956205.1| Neurospora crassa OR74A hypothetical protein ( ... 82 9e-13
87emb|Y11528.1|ANSSPB Aspergillus niger partial sspB gene for heat... 82 9e-13
88emb|AL606642.3|OSJN00073 Oryza sativa genomic DNA, chromosome 4,... 82 9e-13
89emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmi... 82 9e-13
90gb|BC065359.1| Danio rerio heat shock protein 90kDa alpha (cytos... 82 9e-13
91ref|NM_131310.1| Danio rerio heat shock protein 90kDa alpha (cyt... 82 9e-13
92gb|AF212996.1|AF212996 Neurospora crassa heat shock protein 80 g... 82 9e-13
93dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 82 9e-13
94emb|AL606620.3|OSJN00065 Oryza sativa genomic DNA, chromosome 4,... 82 9e-13
95gb|AF068772.1|AF068772 Danio rerio heat shock protein hsp90beta ... 82 9e-13
96gb|AF042108.1|AF042108 Danio rerio heat shock protein 90-beta (h... 82 9e-13
97gb|AY190704.1| Pagrus major heat shock protein 90 beta mRNA, par... 80 3e-12
98gb|AY702458.1|AY702457S2 Oxyuranus scutellatus scutellatus clone... 80 3e-12
99dbj|AB196457.1| Oncorhynchus mykiss HSP90BA mRNA for heat shock ... 80 3e-12
100gb|AF457579.1| Bursaphelenchus xylophilus heat shock protein 90 ... 80 3e-12
101emb|AJ890081.1| Delia antiqua mRNA for Hsp90 protein 78 1e-11
102gb|L47285.1|MSQHSP82G Anopheles albimanus heat shock protein gen... 78 1e-11
103gb|AY729865.1| Prymnesium parvum heat shock protein 90 gene, par... 78 1e-11
104dbj|AK110411.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 5e-11
105gb|AF465639.1| Mus musculus strain C57BL/6 heat shock protein 84... 74 2e-10
106gb|BC054457.1| Mus musculus cDNA clone IMAGE:6493938, **** WARNI... 74 2e-10
107gb|BC088985.1| Mus musculus heat shock protein 90kDa alpha (cyto... 74 2e-10
108ref|NM_008302.2| Mus musculus heat shock protein 90kDa alpha (cy... 74 2e-10
109dbj|AK135366.1| Mus musculus 12 days embryo female mullerian duc... 74 2e-10
110dbj|AK146205.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 74 2e-10
111dbj|AK084097.1| Mus musculus 12 days embryo spinal ganglion cDNA... 74 2e-10
112ref|NM_074225.2| Caenorhabditis elegans abnormal DAuer Formation... 74 2e-10
113dbj|AK030768.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 74 2e-10
114ref|NM_213973.1| Sus scrofa 90-kDa heat shock protein (HSP90), mRNA 74 2e-10
115gb|U94395.1|SSU94395 Sus scrofa 90-kDa heat shock protein (hsp90... 74 2e-10
116gb|M36829.1|MUSHSP84B Mouse heat-shock protein hsp84 mRNA 74 2e-10
117gb|M18186.1|MUSHSP84A Mouse 84 kD heat shock protein mRNA, compl... 74 2e-10
118gb|AY395632.1| Dicentrarchus labrax HSP-90 mRNA, complete cds 72 8e-10
119gb|AY226081.1| Monosiga brevicollis 90-kDa heat-shock protein (h... 72 8e-10
120gb|AY236716.1| Prymnesium patelliferum heat shock protein 90 (Hs... 72 8e-10
121emb|X03811.1|DSHSP82 Drosophila simulans gene fragment for heat ... 72 8e-10
122dbj|AB196458.1| Oncorhynchus mykiss HSP90BB mRNA for heat shock ... 72 8e-10
123gb|AF135117.1|AF135117 Salmo salar heat shock protein hsp90 beta... 72 8e-10
124gb|U81165.1|PAU81165 Podospora anserina suppressor of vegetative... 72 8e-10
125gb|L32987.1|SMRHSC90R Pleurodeles waltlii 90kDa heat shock prote... 72 8e-10
126gb|AY724481.1| Rattus norvegicus clone UI-R-FJ0-cpu-m-19-0-UI un... 70 3e-09
127gb|BC082009.1| Rattus norvegicus cDNA clone MGC:94263 IMAGE:7131... 70 3e-09
128emb|CR729074.1|CNS0GPI0 Tetraodon nigroviridis full-length cDNA 70 3e-09
129emb|CR725456.2|CNS0GMPI Tetraodon nigroviridis full-length cDNA 70 3e-09
130emb|CR724678.2|CNS0GM3W Tetraodon nigroviridis full-length cDNA 70 3e-09
131emb|CR707681.2|CNS0G8ZX Tetraodon nigroviridis full-length cDNA 70 3e-09
132emb|CR682196.2|CNS0FPC0 Tetraodon nigroviridis full-length cDNA 70 3e-09
133emb|CR655460.2|CNS0F4Q2 Tetraodon nigroviridis full-length cDNA 70 3e-09
134emb|CR642933.2|CNS0EV23 Tetraodon nigroviridis full-length cDNA 70 3e-09
135emb|CR643737.2|CNS0EVOF Tetraodon nigroviridis full-length cDNA 70 3e-09
136emb|CR634580.2|CNS0EOM2 Tetraodon nigroviridis full-length cDNA 70 3e-09
137ref|NM_001004082.2| Rattus norvegicus heat shock 90kDa protein 1... 70 3e-09
138gb|DQ022068.2| Rattus norvegicus 84 kDa heat shock protein (hsp8... 70 3e-09
139emb|X07265.1|GGHSPAA Chicken mRNA for 90kDa heat shock protein 70 3e-09
140emb|X03810.1|DMHSP82 Drosophila melanogaster gene for heat shock... 70 3e-09
141emb|X00065.1|DMHS83 Drosophila melanogaster 5'end of heat shock ... 70 3e-09
142gb|AY695393.1| Rattus norvegicus strain SS/JrHsdMcwi heat shock ... 70 3e-09
143gb|AY695392.1| Rattus norvegicus strain BN/NHsdMcwi heat shock p... 70 3e-09
144gb|AY122080.1| Drosophila melanogaster AT20544 full insert cDNA 70 3e-09
145gb|AC097725.2| Drosophila melanogaster 3L BAC RP98-48E19 (Roswel... 70 3e-09
146gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, comp... 70 3e-09
147ref|NM_079175.2| Drosophila melanogaster Heat shock protein 83 C... 70 3e-09
148gb|S45392.1| heat shock protein 90 [rats, brain, mRNA, 2524 nt] 70 3e-09
149gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, compl... 70 3e-09
150dbj|AB196477.1| Sarcophaga similis Hsp83 mRNA for heat-shock pro... 70 3e-09
151dbj|AK177162.1| Mus musculus cDNA, clone:Y0G0101N05, strand:plus... 70 3e-09
152gb|AY729862.1| Pythium graminicola heat shock protein 90 gene, p... 70 3e-09
153gb|AE003477.3| Drosophila melanogaster chromosome 3L, section 11... 70 3e-09
154gb|U57473.1|DMU57473 Drosophila melanogaster heat shock protein ... 70 3e-09
155gb|U57472.1|DMU57472 Drosophila melanogaster heat shock protein ... 70 3e-09
156gb|U57471.1|DMU57471 Drosophila melanogaster heat shock protein ... 70 3e-09
157gb|U57470.1|DMU57470 Drosophila melanogaster heat shock protein ... 70 3e-09
158gb|U57469.1|DMU57469 Drosophila melanogaster heat shock protein ... 70 3e-09
159gb|U57468.1|DMU57468 Drosophila melanogaster heat shock protein ... 70 3e-09
160gb|U57467.1|DMU57467 Drosophila melanogaster heat shock protein ... 70 3e-09
161gb|U57466.1|DMU57466 Drosophila melanogaster heat shock protein ... 70 3e-09
162gb|U57465.1|DMU57465 Drosophila melanogaster heat shock protein ... 70 3e-09
163gb|U57464.1|DMU57464 Drosophila melanogaster heat shock protein ... 70 3e-09
164gb|U57463.1|DMU57463 Drosophila melanogaster heat shock protein ... 70 3e-09
165gb|U57462.1|DMU57462 Drosophila melanogaster heat shock protein ... 70 3e-09
166gb|U57461.1|DMU57461 Drosophila melanogaster heat shock protein ... 70 3e-09
167gb|U57460.1|DMU57460 Drosophila melanogaster heat shock protein ... 70 3e-09
168gb|U57459.1|DMU57459 Drosophila melanogaster heat shock protein ... 70 3e-09
169gb|AY459430.1| Eimeria acervulina isolate 12 heat shock protein ... 68 1e-08
170gb|BC075757.1| Danio rerio heat shock protein 90-alpha, mRNA (cD... 68 1e-08
171ref|NM_131328.1| Danio rerio heat shock protein 90-alpha (hsp90a... 68 1e-08
172emb|CR651823.2|CNS0F1X1 Tetraodon nigroviridis full-length cDNA 68 1e-08
173emb|CR633567.2|CNS0ENTX Tetraodon nigroviridis full-length cDNA 68 1e-08
174ref|XM_682791.1| PREDICTED: Danio rerio similar to heat shock pr... 68 1e-08
175gb|AY459429.1| Eimeria acervulina clone 62 heat shock protein 90... 68 1e-08
176gb|AY335224.1| Drosophila saltans heat shock protein 83 (Hsp83) ... 68 1e-08
177gb|AF068773.1|AF068773 Danio rerio heat shock protein hsp90alpha... 68 1e-08
178dbj|AB043677.1| Equus caballus Hsp90 alpha mRNA for heat shock p... 68 1e-08
179gb|AY651252.1| Rhynchobodo ATCC50359 heat shock protein 90 gene,... 66 5e-08
180gb|AY785160.1| Xenopus laevis Hsp90beta mRNA, complete cds 66 5e-08
181gb|DQ198859.1| Sesamia nonagrioides 90 kDa heat shock protein 83... 66 5e-08
182gb|AY383484.1| Equus caballus heat shock protein 90 (Hsp90) mRNA... 66 5e-08
183gb|BC077195.1| Xenopus laevis heat shock 90kDa protein beta, mRN... 66 5e-08
184gb|BC073535.1| Xenopus laevis heat shock 90kDa protein beta, mRN... 66 5e-08
185ref|XM_777937.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 5e-08
186emb|AL110469.1|SPAC926 S.pombe chromosome I cosmid c926 66 5e-08
187emb|CR860313.1| Pongo pygmaeus mRNA; cDNA DKFZp459I055 (from clo... 66 5e-08
188dbj|AK146809.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 66 5e-08
189gb|DQ295223.1| Trimastix marina cytosolic heat shock protein 90 ... 66 5e-08
190ref|NM_001019786.1| Schizosaccharomyces pombe 972h- hypothetical... 66 5e-08
191gb|AF254880.1|AF254880 Spodoptera frugiperda 90-kDa heat shock p... 66 5e-08
192gb|L35550.1|YSPHSP90X Schizosaccharomyces pombe heat shock prote... 66 5e-08
193dbj|AB043676.1| Equus caballus Hsp90beta mRNA for heat shock pro... 66 5e-08
194gb|AF384807.1| Cryptococcus bacillisporus heat-shock protein 90 ... 64 2e-07
195emb|X70101.1|GGHSP90B G.gallus hsp 90 beta mRNA for heat shock p... 64 2e-07
196emb|X03813.1|DVHSP82 Drosophila virilis gene fragment for heat s... 64 2e-07
197gb|AY550117.1| Megachile rotundata 90 kDa heat shock protein (HS... 64 2e-07
198ref|NM_206959.1| Gallus gallus heat shock 90kDa protein 1, beta ... 64 2e-07
199dbj|AB226298.1| Aspergillus oryzae cDNA, contig sequence: AoEST3160 64 2e-07
200dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 64 2e-07
201gb|AF421541.1| Crypthecodinium cohnii Hsp90 mRNA, complete cds 64 2e-07
202ref|XM_704119.1| PREDICTED: Danio rerio similar to Heat shock pr... 64 2e-07
203ref|XM_683871.1| PREDICTED: Danio rerio similar to Heat shock pr... 64 2e-07
204ref|XM_704118.1| PREDICTED: Danio rerio similar to Heat shock pr... 64 2e-07
205gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 64 2e-07
206gb|DQ340384.1| Oscheius myriophila heat shock protein 90 (Hsp90)... 64 2e-07
207gb|AY754522.1| Drosophila affinis heat shock protein 83 (Hsp83) ... 64 2e-07
208gb|AY928608.1| Paracoccidioides brasiliensis heat shock protein ... 64 2e-07
209ref|NM_210756.1| Eremothecium gossypii AFL148Cp (AFL148C), mRNA 64 2e-07
210gb|DQ206514.1| Priapulus caudatus isolate TOA67 heat shock 90 kD... 64 2e-07
211emb|X03812.1|DPHSP82 Drosophila pseudoobscura gene for heat shoc... 64 2e-07
212gb|AF431814.1| Eremothecium gossypii heat shock protein (HSP82) ... 64 2e-07
213gb|AY391259.1| Perkinsus marinus heat shock protein 90 gene, par... 62 8e-07
214ref|XM_742833.1| Aspergillus fumigatus Af293 molecular chaperone... 62 8e-07
215emb|CR731669.1| Tetraodon nigroviridis full-length cDNA 62 8e-07
216emb|CR646339.2|CNS0EXOP Tetraodon nigroviridis full-length cDNA 62 8e-07
217gb|U92465.1|AFU92465 Aspergillus fumigatus heat shock protein (H... 62 8e-07
218dbj|AB118970.1| Lucilia sericata Hsp90 mRNA for heat shock prote... 62 8e-07
219gb|AY603516.1| Zeldia punctata heat shock protein 90 gene, parti... 62 8e-07
220ref|NM_175761.2| Rattus norvegicus heat shock protein 1, alpha (... 60 3e-06
221gb|BC085120.1| Rattus norvegicus heat shock protein 1, alpha, mR... 60 3e-06
222gb|BC072489.1| Rattus norvegicus heat shock protein 1, alpha, mR... 60 3e-06
223gb|DQ459547.1| Belgica antarctica heat shock protein 90 (hsp90) ... 60 3e-06
224gb|AF461150.2| Heterodera glycines Hsp90 mRNA, complete cds 60 3e-06
225gb|AF548366.1| Capra hircus heat shock protein-90 mRNA, partial cds 60 3e-06
226emb|AJ428213.1|RNO428213 Rattus norvegicus hsp86 gene for heat s... 60 3e-06
227dbj|AB169853.1| Macaca fascicularis brain cDNA, clone: QtrA-1043... 60 3e-06
228gb|DQ295221.1| Reclinomonas americana cytosolic heat shock prote... 60 3e-06
229ref|NM_001012670.1| Bos taurus heat shock 90kD protein 1, alpha ... 60 3e-06
230gb|AF457464.1| Heterodera glycines strain TN7 heat shock protein... 60 3e-06
231gb|AF457463.1| Heterodera glycines strain OP25 heat shock protei... 60 3e-06
232gb|AF449489.1| Heterodera glycines strain TN8 heat shock protein... 60 3e-06
233gb|AF449488.1| Heterodera glycines strain TN6 heat shock protein... 60 3e-06
234gb|AF449487.1| Heterodera glycines strain TN5 heat shock protein... 60 3e-06
235gb|AF449486.1| Heterodera glycines strain NL1-RHp heat shock pro... 60 3e-06
236gb|AF449485.2| Heterodera glycines strain OP50 heat shock protei... 60 3e-06
237dbj|AK186456.1| Mus musculus cDNA, clone:Y0G0137G08, strand:plus... 60 3e-06
238gb|AY335223.1| Drosophila sucinea heat shock protein 83 (Hsp83) ... 60 3e-06
239gb|AY335222.1| Drosophila capricorni heat shock protein 83 (Hsp8... 60 3e-06
240dbj|AB072368.1| Bos taurus hsp90alpha mRNA for 90-kDa heat shock... 60 3e-06
241gb|AY729863.1| Guillardia theta heat shock protein 90 gene, part... 60 3e-06
242gb|AY729856.1| Isochrysis galbana heat shock protein 90 gene, pa... 60 3e-06
243gb|AY729854.1| Heterosigma akashiwo heat shock protein 90 gene, ... 60 3e-06
244gb|U89426.1|MMU89426 Mus musculus strain BALB/c heat shock prote... 60 3e-06
245ref|XM_518911.1| PREDICTED: Pan troglodytes similar to Hspcb pro... 58 1e-05
246gb|AY362761.1| Chlamys farreri heat shock protein 90 mRNA, compl... 58 1e-05
247gb|AY528900.1| Chiromantes haematocheir hsp-90 mRNA, complete cds 58 1e-05
248gb|AF402101.1| Achlya ambisexualis isolate JS855 heat shock prot... 58 1e-05
249gb|AF402100.1| Achlya ambisexualis isolate JS854 heat shock prot... 58 1e-05
250gb|AY288511.1| Euglena gracilis heat shock protein 90 mRNA, part... 58 1e-05
251gb|AY288510.1| Euglena gracilis heat shock protein 90 mRNA, part... 58 1e-05
252ref|XM_863495.1| PREDICTED: Canis familiaris similar to heat sho... 58 1e-05
253ref|XM_537557.2| PREDICTED: Canis familiaris similar to heat sho... 58 1e-05
254gb|DQ147989.1| Macaca mulatta clone dl2_k06_t7_121 heat shock 90... 58 1e-05
255gb|AY359878.1| Homo sapiens heat shock 90kDa protein 1 beta (HSP... 58 1e-05
256gb|BC007327.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
257gb|BC068474.1| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
258gb|BC012807.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
259gb|BC014485.1| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
260gb|BC009206.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
261gb|BC004928.1| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
262gb|BC016753.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 58 1e-05
263emb|AL365440.13| Human DNA sequence from clone RP11-144L1 on chr... 58 1e-05
264emb|AL136543.1|HSM801517 Homo sapiens mRNA; cDNA DKFZp761K0511 (... 58 1e-05
265ref|NM_007355.2| Homo sapiens heat shock protein 90kDa alpha (cy... 58 1e-05
266emb|CR612013.1| full-length cDNA clone CS0DG004YO05 of B cells (... 58 1e-05
267ref|NG_005218.1| Homo sapiens heat shock protein 90kDa alpha (cy... 58 1e-05
268dbj|AB169809.1| Macaca fascicularis brain cDNA, clone: QccE-2118... 58 1e-05
269gb|BC049863.1| Mus musculus, clone IMAGE:4973251, mRNA 58 1e-05
270ref|XM_576983.1| PREDICTED: Rattus norvegicus similar to heat sh... 58 1e-05
271gb|AF275719.1|AF275719 Homo sapiens isolate Liv chaperone protei... 58 1e-05
272emb|BX649079.1|HSM809230 Homo sapiens mRNA; cDNA DKFZp779L0656 (... 58 1e-05
273gb|AY729857.1| Mallomonas rasilis heat shock protein 90 gene, pa... 58 1e-05
274gb|U39048.1|AAU39048 Achlya ambisexualis heat shock protein 90-2... 58 1e-05
275gb|U39047.1|AAU39047 Achlya ambisexualis heat shock protein 90-1... 58 1e-05
276gb|M16660.1|HUMHSP90 Human 90-kDa heat-shock protein gene, cDNA,... 58 1e-05
277dbj|AP002533.1| Homo sapiens genomic DNA, chromosome 1q22-q23, C... 58 1e-05
278dbj|AB045359.1| Homo sapiens genomic DNA, chromosome 1q22-q23, c... 58 1e-05
279ref|XM_458918.1| Debaryomyces hansenii CBS767 hypothetical prote... 56 5e-05
280gb|BT025368.1| Bos taurus heat shock 90kDa protein 1, beta (HSPC... 56 5e-05
281ref|XM_676446.1| Aspergillus nidulans FGSC A4 heat shock protein... 56 5e-05
282gb|AY226083.1| Halichondria sp. AR-2003 90-kDa heat-shock protei... 56 5e-05
283ref|XM_849828.1| PREDICTED: Canis familiaris similar to heat sho... 56 5e-05
284ref|XM_849826.1| PREDICTED: Canis familiaris similar to Heat sho... 56 5e-05
285gb|AF384808.1| Cryptococcus neoformans var. grubii heat-shock pr... 56 5e-05
286ref|XM_845197.1| PREDICTED: Canis familiaris similar to heat sho... 56 5e-05
287ref|XM_532154.2| PREDICTED: Canis familiaris similar to heat sho... 56 5e-05
288ref|XM_860938.1| PREDICTED: Canis familiaris similar to heat sho... 56 5e-05
289ref|XM_860921.1| PREDICTED: Canis familiaris similar to heat sho... 56 5e-05
290emb|CR633606.2|CNS0ENV0 Tetraodon nigroviridis full-length cDNA 56 5e-05
291emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 56 5e-05
292emb|AJ308989.1|BTA308989 Bos taurus partial mRNA for heat shock ... 56 5e-05
293gb|DQ400687.1| Scophthalmus maximus heat shock protein 90 mRNA, ... 56 5e-05
294emb|AL114722.1|CNS01BUY Botrytis cinerea strain T4 cDNA library 56 5e-05
295emb|AL113583.1|CNS01AZB Botrytis cinerea strain T4 cDNA library 56 5e-05
296emb|AL111751.1|CNS019KF Botrytis cinerea strain T4 cDNA library 56 5e-05
297gb|DQ340378.1| Cephalobus cubaensis heat shock protein 90 (Hsp90... 56 5e-05
298gb|AY335221.1| Drosophila nebulosa heat shock protein 83 (Hsp83)... 56 5e-05
299dbj|AB072369.1| Bos taurus hsp90beta mRNA for 90-kDa heat shock ... 56 5e-05
300dbj|AK110745.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 5e-05
301gb|U89945.1|OTU89945 Oncorhynchus tshawytscha heat shock protein... 56 5e-05
302gb|U75687.1|DAU75687 Drosophila auraria heat shock protein 83 (h... 56 5e-05
303emb|Z75530.1|CEC47E8 Caenorhabditis elegans Cosmid C47E8, comple... 54 2e-04
304gb|AY236714.1| Ochromonas sp. Woods Hole heat shock protein 90 (... 54 2e-04
305ref|XM_759717.1| Theileria parva strain Muguga heat shock protei... 54 2e-04
306ref|XM_501578.1| Yarrowia lipolytica CLIB122, YALI0C07953g predi... 54 2e-04
307dbj|AB214972.1| Plutella xylostella hsp90 mRNA for heat shock pr... 54 2e-04
308gb|AY603514.1| Meloidogyne floridae heat shock protein 90 gene, ... 54 2e-04
309gb|AF201338.1|AF201338 Meloidogyne javanica heat shock protein 9... 54 2e-04
310gb|AF457581.1| Meloidogyne sasseri heat shock protein 90 gene, p... 54 2e-04
311gb|AF459026.1| Meloidogyne incognita hsp-90 (hsp-90) gene, parti... 54 2e-04
312gb|AY335225.1| Drosophila sturtevanti heat shock protein 83 (Hsp... 54 2e-04
313gb|AF042329.1|AF042329 Eimeria tenella heat shock protein 90 (hs... 54 2e-04
314emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 54 2e-04
315gb|M57386.1|THEHSP90 T.parva heat shock protein 90 (hsp90) mRNA,... 54 2e-04
316ref|XM_510172.1| PREDICTED: Pan troglodytes similar to 90-kDa he... 52 8e-04
317gb|BC072998.1| Xenopus laevis MGC82579 protein, mRNA (cDNA clone... 52 8e-04
318ref|NM_005348.2| Homo sapiens heat shock protein 90kDa alpha (cy... 52 8e-04
319ref|XM_614707.2| PREDICTED: Bos taurus similar to Heat shock pro... 52 8e-04
320ref|NM_001017963.1| Homo sapiens heat shock protein 90kDa alpha ... 52 8e-04
321gb|AY391253.1| Halteria grandinella heat shock protein 90 gene, ... 52 8e-04
322ref|XM_852000.1| PREDICTED: Canis familiaris similar to Heat sho... 52 8e-04
323ref|XM_843690.1| PREDICTED: Canis familiaris similar to Heat sho... 52 8e-04
324ref|XM_863492.1| PREDICTED: Canis familiaris similar to heat sho... 52 8e-04
325ref|XM_544195.2| PREDICTED: Canis familiaris similar to heat sho... 52 8e-04
326gb|BC007989.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 52 8e-04
327gb|BC023006.1| Homo sapiens heat shock protein 90kDa alpha (cyto... 52 8e-04
328gb|BC000987.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 52 8e-04
329gb|BC108695.1| Homo sapiens heat shock protein 90kDa alpha (cyto... 52 8e-04
330emb|BX247955.1|CNSLT1I6M human full-length cDNA clone CS0CAP007Y... 52 8e-04
331emb|AJ890082.1| Homo sapiens mRNA for Heat shock protein HSP 90-... 52 8e-04
332emb|AJ890083.1| Homo sapiens mRNA for Heat shock protein HSP 90-... 52 8e-04
333emb|CR859986.1| Pongo pygmaeus mRNA; cDNA DKFZp459N168 (from clo... 52 8e-04
334gb|BC099366.1| Xenopus laevis cDNA clone IMAGE:6879933, containi... 52 8e-04
335emb|CR611873.1| full-length cDNA clone CS0DF029YE05 of Fetal bra... 52 8e-04
336emb|CR611827.1| full-length cDNA clone CS0DA010YN16 of Neuroblas... 52 8e-04
337emb|CR610614.1| full-length cDNA clone CS0DG003YD15 of B cells (... 52 8e-04
338emb|CR604052.1| full-length cDNA clone CS0DE012YK03 of Placenta ... 52 8e-04
339emb|CR599002.1| full-length cDNA clone CS0DG007YM17 of B cells (... 52 8e-04
340dbj|AK056446.1| Homo sapiens cDNA FLJ31884 fis, clone NT2RP70029... 52 8e-04
341emb|CR596117.1| full-length cDNA clone CS0DF028YH21 of Fetal bra... 52 8e-04
342emb|CR593964.1| full-length cDNA clone CS0DA008YP21 of Neuroblas... 52 8e-04
343emb|CR594716.1| full-length cDNA clone CL0BB003ZA10 of Neuroblas... 52 8e-04
344emb|CR589993.1| full-length cDNA clone CS0DJ002YF10 of T cells (... 52 8e-04
345gb|BC017233.2| Homo sapiens heat shock protein 90kDa alpha (cyto... 52 8e-04
346ref|XM_945641.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
347ref|XM_945638.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
348ref|XM_942030.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
349ref|XM_945636.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
350ref|XM_945635.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
351ref|XM_945634.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
352ref|XM_945629.1| PREDICTED: Homo sapiens similar to heat shock p... 52 8e-04
353gb|AF261773.1|AF261773 Sarcophaga crassipalpis heat shock protei... 52 8e-04
354ref|XM_216334.3| PREDICTED: Rattus norvegicus heat shock 90kDa p... 52 8e-04
355gb|AY122629.1| Cryptobia salmositica heat shock protein 90 (HSP-... 52 8e-04
356dbj|AK129557.1| Homo sapiens cDNA FLJ26046 fis, clone PRS02194, ... 52 8e-04
357gb|AF028832.1|AF028832 Homo sapiens Hsp89-alpha-delta-N mRNA, co... 52 8e-04
358emb|X15183.1|HSHSP90R Human mRNA for 90-kDa heat-shock protein 52 8e-04
359gb|L33676.1|CRUHSP90A Cricetulus griseus (clone 33A) heat shock ... 52 8e-04
360gb|AY851302.1| Homarus americanus heat shock protein 90 (hsp90) ... 50 0.003
361gb|AF457580.1| Meloidogyne arenaria heat shock protein 90 gene, ... 50 0.003
362gb|AY815927.1| Schistosoma japonicum SJCHGC00820 protein mRNA, c... 50 0.003
363gb|AY391256.1| Lessardia elongata heat shock protein 90 gene, pa... 50 0.003
364gb|AY226084.1| Haliclona rubens 90-kDa heat-shock protein (hsp90... 50 0.003
365gb|AY223382.1| Schistosoma japonicum clone ZZZ255 mRNA sequence 50 0.003
366emb|CR652634.1|CNS0F2JK Tetraodon nigroviridis full-length cDNA 50 0.003
367emb|AJ297736.1|RNO297736 Rattus norvegicus hsp86 gene for heat s... 50 0.003
368emb|CR616772.1| full-length cDNA clone CS0DA001YA12 of Neuroblas... 50 0.003
369gb|AC096571.1| Homo sapiens BAC clone RP11-395B18 from 4, comple... 50 0.003
370gb|AC093768.3| Homo sapiens BAC clone RP11-113G13 from 4, comple... 50 0.003
371ref|XM_926042.1| PREDICTED: Homo sapiens heat shock protein 90Af... 50 0.003
372ref|XM_939584.1| PREDICTED: Homo sapiens similar to heat shock p... 50 0.003
373ref|XM_932458.1| PREDICTED: Homo sapiens similar to heat shock p... 50 0.003
374ref|NG_003015.1| Homo sapiens heat shock protein 90kDa alpha (cy... 50 0.003
375gb|AY956764.1| Homo sapiens heat shock protein 90Bc (HSP90Bc) mR... 50 0.003
376dbj|AK025370.1| Homo sapiens cDNA: FLJ21717 fis, clone COL10322 50 0.003
377emb|CR381646.8| Zebrafish DNA sequence from clone DKEY-241L7 in ... 50 0.003
378gb|DQ314871.1| Homo sapiens heat shock 90kDa protein 1, alpha (H... 50 0.003
379gb|M27024.1|HUMHSP89KD Homo sapiens heat shock protein (HSP89-al... 50 0.003
380emb|AL133223.5|CNS01DU8 Human chromosome 14 DNA sequence BAC R-1... 50 0.003
381gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.012
382ref|XM_568451.1| Cryptococcus neoformans var. neoformans JEC21 c... 48 0.012
383ref|XM_845020.1| PREDICTED: Canis familiaris similar to heat sho... 48 0.012
384gb|AY236712.1| Corallochytrium limacisporum heat shock protein 9... 48 0.012
385emb|BX009540.1|CNS08FIW Single read from an extremity of a full-... 48 0.012
386emb|CR857857.1| Pongo pygmaeus mRNA; cDNA DKFZp469E1629 (from cl... 48 0.012
387gb|AC163677.2| Mus musculus BAC clone RP24-86D16 from chromosome... 48 0.012
388emb|AL112936.1|CNS01AHC Botrytis cinerea strain T4 cDNA library 48 0.012
389emb|AL112634.1|CNS01A8Y Botrytis cinerea strain T4 cDNA library 48 0.012
390gb|AY603513.1| Pratylenchus penetrans heat shock protein 90 gene... 48 0.012
391gb|AF457582.1| Pratylenchus crenatus heat shock protein 90 gene,... 48 0.012
392emb|X83230.1|GGHSP90 G.gallus hsp90beta gene 48 0.012
393ref|XM_308800.2| Anopheles gambiae str. PEST ENSANGP00000021793 ... 48 0.012
394ref|XM_593742.2| PREDICTED: Bos taurus similar to serologically ... 46 0.048
395ref|XM_448795.1| Candida glabrata CBS138, CAGL0L00495g partial mRNA 46 0.048
396emb|CR645485.1|CNS0EX0Z Tetraodon nigroviridis full-length cDNA 46 0.048
397emb|CR639872.2|CNS0ESP2 Tetraodon nigroviridis full-length cDNA 46 0.048
398emb|AL353581.14| Human DNA sequence from clone RP11-65L19 on chr... 46 0.048
399emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 46 0.048
400gb|AY851367.2| Liriomyza huidobrensis heat shock protein 90 mRNA... 46 0.048
401gb|AC131235.4| Homo sapiens 3 BAC RP11-778D9 (Roswell Park Cance... 46 0.048
402gb|AY122628.1| Trypanoplasma borreli strain Tt-JH heat shock pro... 46 0.048
403gb|AY122625.1| Rhynchomonas nasuta strain CBR1 heat shock protei... 46 0.048
404gb|AY956767.1| Homo sapiens heat shock protein 90Bf (HSP90Bf) mR... 46 0.048
405gb|AY956761.1| Homo sapiens heat shock protein 90Ae (HSP90Ae) mR... 46 0.048
406gb|AY335220.1| Drosophila willistoni heat shock protein 83 (Hsp8... 46 0.048
407gb|AY929159.1| Acanthopagrus schlegelii heat shock protein 90 mR... 46 0.048
408gb|AY729864.1| Thraustotheca clavata heat shock protein 90 gene,... 46 0.048
409gb|AY729852.1| Apodachlya brachynema heat shock protein 90 gene,... 46 0.048
410gb|AC100500.10| Mus musculus chromosome 3, clone RP23-143I10, co... 44 0.19
411gb|AC124976.9| Mus musculus chromosome 3, clone RP24-84E6, compl... 44 0.19
412ref|XR_002827.1| PREDICTED: Mus musculus similar to heat shock p... 44 0.19
413emb|AM084221.1| Ceratitis capitata mRNA for heat shock protein 8... 44 0.19
414ref|NM_001040141.1| Homo sapiens heat shock protein 90kDa alpha ... 44 0.19
415gb|AC103796.3| Homo sapiens chromosome 11, clone RP11-1033A18, c... 44 0.19
416ref|XM_934550.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
417ref|XM_934548.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
418ref|XM_930268.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
419ref|XM_934545.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
420ref|XM_934542.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
421ref|XM_934539.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
422ref|XM_934527.1| PREDICTED: Homo sapiens similar to Heat shock p... 44 0.19
423dbj|AB206477.1| Chilo suppressalis hsp90 mRNA for heat shock pro... 44 0.19
424gb|AF136649.1|AF136649 Babesia bovis heat shock protein 90 (HSP9... 44 0.19
425gb|AY528417.1| Meloidogyne hapla heat shock protein 90 gene, par... 44 0.19
426gb|AY528416.1| Meloidogyne hapla heat shock protein 90 gene, par... 44 0.19
427gb|AY391257.1| Tetrahymena bergeri heat shock protein 90 gene, p... 42 0.75
428gb|AY226089.1| Aphrocallistes vastus 90-kDa heat-shock protein (... 42 0.75
429gb|AY226085.1| Suberites fuscus 90-kDa heat-shock protein (hsp90... 42 0.75
430gb|BT001095.1| Arabidopsis thaliana clone C104855 (D) putative h... 42 0.75
431gb|AY236711.1| Amastigomonas marina heat shock protein 90 (Hsp90... 42 0.75
432gb|AC119806.6| Mus musculus chromosome 7, clone RP23-211A9, comp... 42 0.75
433emb|BX927111.8| Zebrafish DNA sequence from clone DKEY-54K13 in ... 42 0.75
434gb|AY851368.2| Liriomyza sativae heat shock protein 90 mRNA, com... 42 0.75
435gb|AF287229.1| Tetrahymena pyriformis heat shock protein 90 (HSP... 42 0.75
436gb|DQ393580.1| Metarhizium anisopliae heat shock protein 90 (HSP... 42 0.75
437gb|DQ295220.1| Malawimonas jakobiformis cytosolic heat shock pro... 42 0.75
438gb|DQ062086.1| Pseudourostyla cristata heat shock protein 90 mRN... 42 0.75
439gb|AC138624.4| Mus musculus BAC clone RP23-187N1 from chromosome... 42 0.75
440gb|S59780.1|S59780 Zea mays heat shock protein HSP82 (hsp82) gen... 42 0.75
441emb|CT009542.22| Pig DNA sequence from clone CH242-272H8 on chro... 42 0.75
442gb|AY104718.1| Zea mays PCO153543 mRNA sequence 42 0.75
443gb|BT001104.1| Arabidopsis thaliana clone C104855 (D) putative h... 42 0.75
444ref|XM_715747.1| Candida albicans SC5314 hypothetical protein (C... 40 3.0
445gb|AY391262.1| Monocystis agilis heat shock protein 90 gene, par... 40 3.0
446gb|AC147707.5| Canis Familiaris, clone XX-10C7, complete sequence 40 3.0
447ref|XM_716260.1| Candida albicans SC5314 hypothetical protein (H... 40 3.0
448gb|AY236713.1| Goniomonas sp. ATCC 50108 heat shock protein 90 (... 40 3.0
449ref|XM_883730.1| Candida albicans SC5314 hypothetical protein (C... 40 3.0
450emb|AL356962.8| Human DNA sequence from clone RP11-453C2 on chro... 40 3.0
451emb|AL139392.10| Human DNA sequence from clone RP1-302G2 on chro... 40 3.0
452emb|BX053478.1|CNS09DFE Single read from an extremity of a full-... 40 3.0
453emb|X81025.1|CAHSP90 C.albicans hsp90 gene 40 3.0
454ref|NM_001016282.2| Xenopus tropicalis heat shock 90kDa protein ... 40 3.0
455gb|DQ093382.1| Bemisia tabaci clone 90(1) 90 kDa heat shock prot... 40 3.0
456gb|DQ093381.1| Bemisia tabaci clone 904 90 kDa heat shock protei... 40 3.0
457gb|DQ093380.1| Bemisia tabaci clone 901 90 kDa heat shock protei... 40 3.0
458gb|DQ295219.1| Carpediemonas membranifera cytosolic heat shock p... 40 3.0
459gb|DQ062088.1| Oxytricha sp. LPJ-2005 heat shock protein 90 mRNA... 40 3.0
460gb|AC091046.2|AC091046 Homo sapiens chromosome 15 clone RP11-123... 40 3.0
461dbj|AK109111.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.0
462gb|AY222612.1| Astyanax mexicanus heat shock protein 90 alpha (H... 40 3.0
463gb|AY729869.1| Rhodomonas salina heat shock protein 90-like gene... 40 3.0
464gb|AY729861.1| Plectospira myriandra heat shock protein 90 gene,... 40 3.0
465gb|AF127082.1|AF127082 Myxococcus xanthus ATP-dependent protease... 40 3.0
466gb|AF123259.1|AF123259 Lycopersicon esculentum heat shock protei... 40 3.0
467emb|CR761606.2| Xenopus tropicalis finished cDNA, clone TGas033n20 40 3.0
468gb|DQ314872.1| Homo sapiens heat shock 90kDa protein 1, beta (HS... 40 3.0
469dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, comp... 40 3.0
470gb|J04988.1|HUMHSP90B Human 90 kD heat shock protein gene, compl... 40 3.0

>gb|AY325266.1| Hordeum vulgare cytosolic heat shock protein 90 (HSP90) mRNA,
           complete cds
          Length = 2553

 Score =  321 bits (162), Expect = 5e-85
 Identities = 162/162 (100%)
 Strand = Plus / Plus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 834 tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 893

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 894 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 953

                                                     
Query: 191 atttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 954 atttggctgtcaagcacttctctgttgagggtcagcttgagt 995



 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||||||||||||||||||||||||||
Sbjct: 764 gagggcaaggttgaggatgttgatgagg 791



to top

>emb|X98582.1|TAX98582 T.aestivum mRNA for HSP80-2 protein
          Length = 2378

 Score =  313 bits (158), Expect = 1e-82
 Identities = 161/162 (99%)
 Strand = Plus / Plus

                                                                        
Query: 71   tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 846  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 905

                                                                        
Query: 131  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 965

                                                      
Query: 191  atttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 966  atttggctgtcaagcacttctctgttgagggccagcttgagt 1007



 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||||||||||||||||||||||||||
Sbjct: 776 gagggcaaggttgaggatgttgatgagg 803



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  222 bits (112), Expect = 4e-55
 Identities = 148/160 (92%)
 Strand = Plus / Minus

                                                                            
Query: 71       tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
                ||||||||||||||||| || | ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 18461642 tctctcatgagtggaacgtgatgaacaagcagaaacctatttggttgaggaagccagagg 18461583

                                                                            
Query: 131      agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
                |||||| |||||||||||||||||||||||||||||||||||| || ||||||||||| |
Sbjct: 18461582 agatcaccaaggaagagtatgctgctttctacaagagcttgacaaacgactgggaggaac 18461523

                                                        
Query: 191      atttggctgtcaagcacttctctgttgagggtcagcttga 230
                || |||||||||||||||||||||| ||||||||||||||
Sbjct: 18461522 atctggctgtcaagcacttctctgtggagggtcagcttga 18461483



 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                            
Query: 71       tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
                ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 18483947 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 18483888

                                                                            
Query: 131      agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
                |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 18483887 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 18483828

                                                        
Query: 191      atttggctgtcaagcacttctctgttgagggtcagcttga 230
                || |||||||||||||||||||||| ||||||||||||||
Sbjct: 18483827 atctggctgtcaagcacttctctgtggagggtcagcttga 18483788



 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                            
Query: 71       tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
                ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 18472488 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 18472429

                                                                            
Query: 131      agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
                |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 18472428 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 18472369

                                                        
Query: 191      atttggctgtcaagcacttctctgttgagggtcagcttga 230
                || |||||||||||||||||||||| ||||||||||||||
Sbjct: 18472368 atctggctgtcaagcacttctctgtggagggtcagcttga 18472329



 Score =  127 bits (64), Expect = 2e-26
 Identities = 137/159 (86%), Gaps = 8/159 (5%)
 Strand = Plus / Plus

                                                                            
Query: 75       tcatgagtggaacttggtcaacaagcag-aagcctatctggatgaggaagccagaggaga 133
                ||||||||| |||||| ||||||||||| ||||| ||||||||||||||  |||||| ||
Sbjct: 20714225 tcatgagtgcaacttgatcaacaagcaggaagcc-atctggatgaggaaatcagaggtga 20714283

                                                                            
Query: 134      tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
                ||| ||||||||      | || ||||| ||||||||||| || ||||||||||| ||| 
Sbjct: 20714284 tcaccaaggaag------cagccttctaaaagagcttgacaaacgactgggaggaacatc 20714337

                                                       
Query: 194      tggctgtcaagcacttctctgttgagggtcagcttgagt 232
                |||||||||||||||||||||| ||||||||||||||||
Sbjct: 20714338 tggctgtcaagcacttctctgtggagggtcagcttgagt 20714376



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 1        gagggcaaggttgaggatgttgatgagg 28
                ||||| ||||||||||||||||||||||
Sbjct: 20714151 gagggaaaggttgaggatgttgatgagg 20714178



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 1        gagggcaaggttgaggatgttgatgagg 28
                ||||| ||||||||||||||||||||||
Sbjct: 20714007 gagggaaaggttgaggatgttgatgagg 20714034



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 1        gagggcaaggttgaggatgttgatgagg 28
                ||||| ||||||||||||||||||||||
Sbjct: 18472558 gagggaaaggttgaggatgttgatgagg 18472531



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 1        gagggcaaggttgaggatgttgatgagg 28
                ||||| ||||||||||||||||||||||
Sbjct: 18461712 gagggaaaggttgaggatgttgatgagg 18461685



to top

>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463D04
          Length = 145828

 Score =  222 bits (112), Expect = 4e-55
 Identities = 148/160 (92%)
 Strand = Plus / Minus

                                                                          
Query: 71     tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
              ||||||||||||||||| || | ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 123516 tctctcatgagtggaacgtgatgaacaagcagaaacctatttggttgaggaagccagagg 123457

                                                                          
Query: 131    agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
              |||||| |||||||||||||||||||||||||||||||||||| || ||||||||||| |
Sbjct: 123456 agatcaccaaggaagagtatgctgctttctacaagagcttgacaaacgactgggaggaac 123397

                                                      
Query: 191    atttggctgtcaagcacttctctgttgagggtcagcttga 230
              || |||||||||||||||||||||| ||||||||||||||
Sbjct: 123396 atctggctgtcaagcacttctctgtggagggtcagcttga 123357



 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                          
Query: 71     tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
              ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 145821 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 145762

                                                                          
Query: 131    agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
              |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 145761 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 145702

                                                      
Query: 191    atttggctgtcaagcacttctctgttgagggtcagcttga 230
              || |||||||||||||||||||||| ||||||||||||||
Sbjct: 145701 atctggctgtcaagcacttctctgtggagggtcagcttga 145662



 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                          
Query: 71     tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
              ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 134362 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 134303

                                                                          
Query: 131    agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
              |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 134302 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 134243

                                                      
Query: 191    atttggctgtcaagcacttctctgttgagggtcagcttga 230
              || |||||||||||||||||||||| ||||||||||||||
Sbjct: 134242 atctggctgtcaagcacttctctgtggagggtcagcttga 134203



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 1      gagggcaaggttgaggatgttgatgagg 28
              ||||| ||||||||||||||||||||||
Sbjct: 134432 gagggaaaggttgaggatgttgatgagg 134405



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 1      gagggcaaggttgaggatgttgatgagg 28
              ||||| ||||||||||||||||||||||
Sbjct: 123586 gagggaaaggttgaggatgttgatgagg 123559



to top

>dbj|AK101323.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034F03, full
            insert sequence
          Length = 2598

 Score =  222 bits (112), Expect = 4e-55
 Identities = 148/160 (92%)
 Strand = Plus / Plus

                                                                        
Query: 71   tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
            ||||||||||||||||| || | ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 893  tctctcatgagtggaacgtgatgaacaagcagaaacctatttggttgaggaagccagagg 952

                                                                        
Query: 131  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
            |||||| |||||||||||||||||||||||||||||||||||| || ||||||||||| |
Sbjct: 953  agatcaccaaggaagagtatgctgctttctacaagagcttgacaaacgactgggaggaac 1012

                                                    
Query: 191  atttggctgtcaagcacttctctgttgagggtcagcttga 230
            || |||||||||||||||||||||| ||||||||||||||
Sbjct: 1013 atctggctgtcaagcacttctctgtggagggtcagcttga 1052



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||| ||||||||||||||||||||||
Sbjct: 823 gagggaaaggttgaggatgttgatgagg 850



to top

>dbj|AK064780.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000B06, full
            insert sequence
          Length = 2410

 Score =  222 bits (112), Expect = 4e-55
 Identities = 148/160 (92%)
 Strand = Plus / Plus

                                                                        
Query: 71   tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
            ||||||||||||||||| || | ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 894  tctctcatgagtggaacgtgatgaacaagcagaaacctatttggttgaggaagccagagg 953

                                                                        
Query: 131  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
            |||||| |||||||||||||||||||||||||||||||||||| || ||||||||||| |
Sbjct: 954  agatcaccaaggaagagtatgctgctttctacaagagcttgacaaacgactgggaggaac 1013

                                                    
Query: 191  atttggctgtcaagcacttctctgttgagggtcagcttga 230
            || |||||||||||||||||||||| ||||||||||||||
Sbjct: 1014 atctggctgtcaagcacttctctgtggagggtcagcttga 1053



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||| ||||||||||||||||||||||
Sbjct: 824 gagggaaaggttgaggatgttgatgagg 851



to top

>gb|BT018733.1| Zea mays clone EL01N0520C02.d mRNA sequence
          Length = 2179

 Score =  214 bits (108), Expect = 9e-53
 Identities = 147/160 (91%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           |||||||||||| | ||||| |||||||||||||||||||||||||| ||||| ||||||
Sbjct: 702 tctcatgagtggcaattggttaacaagcagaagcctatctggatgagaaagcctgaggag 761

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           || | ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 762 attaccaaagaagagtatgctgctttctacaagagcttgaccaacgactgggaggagcat 821

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            | || || |||||||||||||||||||||||||||||||
Sbjct: 822 ctcgccgttaagcacttctctgttgagggtcagcttgagt 861



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 1   gagggcaaggttgaggatgttgatgag 27
           |||||||||||||||||||||||||||
Sbjct: 633 gagggcaaggttgaggatgttgatgag 659



to top

>dbj|AB111810.1| Oryza sativa (japonica cultivar-group) Hsp90 mRNA for heat shock
            protein 90, complete cds
          Length = 2408

 Score =  214 bits (108), Expect = 9e-53
 Identities = 147/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 71   tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
            ||||||||||||||||| || | ||||||||||| ||||| ||| |||||||||||||||
Sbjct: 872  tctctcatgagtggaacgtgatgaacaagcagaaacctatttggttgaggaagccagagg 931

                                                                        
Query: 131  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
            |||||| |||||||||||||||||| ||||||||||||||||| || ||||||||||| |
Sbjct: 932  agatcaccaaggaagagtatgctgcattctacaagagcttgacaaacgactgggaggaac 991

                                                    
Query: 191  atttggctgtcaagcacttctctgttgagggtcagcttga 230
            || |||||||||||||||||||||| ||||||||||||||
Sbjct: 992  atctggctgtcaagcacttctctgtggagggtcagcttga 1031



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||| |||||||||||| |||||||||
Sbjct: 802 gagggaaaggttgaggatcttgatgagg 829



to top

>ref|NM_124982.2| Arabidopsis thaliana ATP binding / unfolded protein binding AT5G56000
            mRNA, complete cds
          Length = 2336

 Score =  212 bits (107), Expect = 4e-52
 Identities = 146/159 (91%)
 Strand = Plus / Plus

                                                                        
Query: 74   ctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggaga 133
            ||||||||||| | ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 849  ctcatgagtgggatttggtgaacaaacagaagcctatctggatgaggaagccagaggaga 908

                                                                        
Query: 134  tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
            |||||||||| ||||| ||||||||||||||||| |||| |||||| |||||||||||||
Sbjct: 909  tcaacaaggaggagtacgctgctttctacaagagtttgagcaatgattgggaggagcatt 968

                                                   
Query: 194  tggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 969  tggctgtgaagcatttctctgttgaaggacagcttgagt 1007



to top

>emb|Y11828.1|ATHSP814 A.thaliana hsp81.4 gene
          Length = 2507

 Score =  212 bits (107), Expect = 4e-52
 Identities = 146/159 (91%)
 Strand = Plus / Plus

                                                                        
Query: 74   ctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggaga 133
            ||||||||||| | ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1153 ctcatgagtgggatttggtgaacaaacagaagcctatctggatgaggaagccagaggaga 1212

                                                                        
Query: 134  tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
            |||||||||| ||||| ||||||||||||||||| |||| |||||| |||||||||||||
Sbjct: 1213 tcaacaaggaggagtacgctgctttctacaagagtttgagcaatgattgggaggagcatt 1272

                                                   
Query: 194  tggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 1273 tggctgtgaagcatttctctgttgaaggacagcttgagt 1311



to top

>dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7
          Length = 82033

 Score =  212 bits (107), Expect = 4e-52
 Identities = 146/159 (91%)
 Strand = Plus / Minus

                                                                         
Query: 74    ctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggaga 133
             ||||||||||| | ||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 13258 ctcatgagtgggatttggtgaacaaacagaagcctatctggatgaggaagccagaggaga 13199

                                                                         
Query: 134   tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
             |||||||||| ||||| ||||||||||||||||| |||| |||||| |||||||||||||
Sbjct: 13198 tcaacaaggaggagtacgctgctttctacaagagtttgagcaatgattgggaggagcatt 13139

                                                    
Query: 194   tggctgtcaagcacttctctgttgagggtcagcttgagt 232
             ||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 13138 tggctgtgaagcatttctctgttgaaggacagcttgagt 13100



 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                         
Query: 73    tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
             |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 22416 tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 22475

                                                                         
Query: 133   atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
             ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 22476 atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 22535

                                                     
Query: 193   ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
             |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 22536 ttggctgtgaagcatttctctgttgaaggacagcttgagt 22575



 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                         
Query: 73    tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
             |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 16894 tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 16953

                                                                         
Query: 133   atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
             ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 16954 atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 17013

                                                     
Query: 193   ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
             |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 17014 ttggctgtgaagcatttctcagttgaaggacagcttgagt 17053



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     ggcaaggttgaggatgttgatgagg 28
             |||||||||||||| ||||||||||
Sbjct: 22347 ggcaaggttgaggaagttgatgagg 22371



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 4     ggcaaggttgaggatgttgatgagg 28
             |||||||||||||| ||||||||||
Sbjct: 16825 ggcaaggttgaggaagttgatgagg 16849



to top

>ref|NM_124985.3| Arabidopsis thaliana HSP81-2; ATP binding / unfolded protein binding
            AT5G56030 (HSP81-2) mRNA, complete cds
          Length = 2408

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 854  tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 913

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 914  atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 973

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 974  ttggctgtgaagcatttctctgttgaaggacagcttgagt 1013



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 785 ggcaaggttgaggaagttgatgagg 809



to top

>gb|BT000717.1| Arabidopsis thaliana clone RAFL09-76-I24 (R19621) putative heat shock
            protein 81-2 (HSP81-2) (At5g56030) mRNA, complete cds
          Length = 2384

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 852  tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 911

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 912  atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 971

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 972  ttggctgtgaagcatttctctgttgaaggacagcttgagt 1011



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 783 ggcaaggttgaggaagttgatgagg 807



to top

>gb|AY064070.2| Arabidopsis thaliana At5g56030 mRNA sequence
          Length = 1690

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 856  tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 915

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 916  atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 975

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 976  ttggctgtgaagcatttctctgttgaaggacagcttgagt 1015



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 787 ggcaaggttgaggaagttgatgagg 811



to top

>gb|AY128805.1| Arabidopsis thaliana heat shock protein 81-2 (At5g56030) mRNA,
           complete cds
          Length = 2261

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 763 tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 822

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 823 atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 882

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 883 ttggctgtgaagcatttctctgttgaaggacagcttgagt 922



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 694 ggcaaggttgaggaagttgatgagg 718



to top

>gb|AY062750.1| Arabidopsis thaliana HEAT SHOCK PROTEIN 81-2 (HSP81-2) (MDA7.7) mRNA,
            complete cds
          Length = 2382

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 849  tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 908

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 909  atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 968

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 969  ttggctgtgaagcatttctctgttgaaggacagcttgagt 1008



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 780 ggcaaggttgaggaagttgatgagg 804



to top

>gb|BT002535.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 2302

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 852  tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 911

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 912  atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 971

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 972  ttggctgtgaagcatttctctgttgaaggacagcttgagt 1011



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 783 ggcaaggttgaggaagttgatgagg 807



to top

>gb|BT024184.1| Zea mays clone EL01N0315D01 mRNA sequence
          Length = 1740

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           |||||||||||| | ||||| |||||||||||||| ||||||||||||||||| ||||||
Sbjct: 139 tctcatgagtggcaattggtaaacaagcagaagccaatctggatgaggaagcctgaggag 198

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           || | ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 199 attaccaaagaagagtatgctgctttctacaagagcttgaccaacgactgggaggagcat 258

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            | || || |||||||||||||||||||| ||||||||||
Sbjct: 259 cttgccgtgaagcacttctctgttgagggccagcttgagt 298



 Score = 44.1 bits (22), Expect = 0.19
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                    
Query: 1  gagggcaaggttgaggatgttgatga 26
          ||||| ||||||||||||||||||||
Sbjct: 67 gagggtaaggttgaggatgttgatga 92



to top

>gb|BT001944.1| Arabidopsis thaliana clone C105057 putative heat-shock protein
           HSP81-2 (At5g56030) mRNA, complete cds
          Length = 2131

 Score =  206 bits (104), Expect = 2e-50
 Identities = 146/160 (91%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           |||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 763 tctcatgagtgggatttggtgaacaagcagaagcctatctggatgaggaagccagaggag 822

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           ||||||||||| ||||| |||||||||||||||||  | | |||||| ||||||||||||
Sbjct: 823 atcaacaaggaggagtacgctgctttctacaagagtctcagcaatgattgggaggagcat 882

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 883 ttggctgtgaagcatttctctgttgaaggacagcttgagt 922



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 694 ggcaaggttgaggaagttgatgagg 718



to top

>gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBa0087J09, complete sequence
          Length = 153351

 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                         
Query: 71    tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
             ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 11953 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 11894

                                                                         
Query: 131   agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
             |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 11893 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 11834

                                                     
Query: 191   atttggctgtcaagcacttctctgttgagggtcagcttga 230
             || |||||||||||||||||||||| ||||||||||||||
Sbjct: 11833 atctggctgtcaagcacttctctgtggagggtcagcttga 11794



 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 494 tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 435

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 434 agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 375

                                                   
Query: 191 atttggctgtcaagcacttctctgttgagggtcagcttga 230
           || |||||||||||||||||||||| ||||||||||||||
Sbjct: 374 atctggctgtcaagcacttctctgtggagggtcagcttga 335



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 1     gagggcaaggttgaggatgttgatgagg 28
             ||||| ||||||||||||||||||||||
Sbjct: 12023 gagggaaaggttgaggatgttgatgagg 11996



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||| ||||||||||||||||||||||
Sbjct: 564 gagggaaaggttgaggatgttgatgagg 537



to top

>dbj|AK061896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-G11, full
            insert sequence
          Length = 2440

 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 71   tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
            ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 891  tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 950

                                                                        
Query: 131  agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
            |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 951  agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 1010

                                                    
Query: 191  atttggctgtcaagcacttctctgttgagggtcagcttga 230
            || |||||||||||||||||||||| ||||||||||||||
Sbjct: 1011 atctggctgtcaagcacttctctgtggagggtcagcttga 1050



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 1   gagggcaaggttgaggatgttgatgagg 28
           ||||| ||||||||||||||||||||||
Sbjct: 821 gagggaaaggttgaggatgttgatgagg 848



to top

>dbj|AK119663.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B04, full
           insert sequence
          Length = 1538

 Score =  198 bits (100), Expect = 5e-48
 Identities = 145/160 (90%)
 Strand = Plus / Plus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||||| ||||||||| || | ||||||||||| || || ||| |||||||||||||||
Sbjct: 22  tctctcacgagtggaacgtgatgaacaagcagaaacccatttggttgaggaagccagagg 81

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 82  agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 141

                                                   
Query: 191 atttggctgtcaagcacttctctgttgagggtcagcttga 230
           || |||||||||||||||||||||| ||||||||||||||
Sbjct: 142 atctggctgtcaagcacttctctgtggagggtcagcttga 181



to top

>gb|AY368905.1| Nicotiana benthamiana molecular chaperone Hsp90-2 mRNA, complete
           cds
          Length = 2100

 Score =  192 bits (97), Expect = 3e-46
 Identities = 133/145 (91%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| || ||||||||||| || |||||||||||||| ||||||||||  |||||||||
Sbjct: 778 ttggtaaataagcagaagcccatatggatgaggaagcctgaggagatcacaaaggaagag 837

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           ||||||||||||||||||||| |||| |||||||||||||| ||||||||||| ||||||
Sbjct: 838 tatgctgctttctacaagagcctgactaatgactgggaggaacatttggctgtgaagcac 897

                                    
Query: 208 ttctctgttgagggtcagcttgagt 232
           |||||||||||||||||||| ||||
Sbjct: 898 ttctctgttgagggtcagctggagt 922



to top

>gb|AY310776.1| Nicotiana benthamiana clone 8-240 unknown mRNA
          Length = 2258

 Score =  192 bits (97), Expect = 3e-46
 Identities = 142/157 (90%)
 Strand = Plus / Plus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||| ||||||||  |||||| |||||||||||||| || |||||||||||||| ||||
Sbjct: 720 tctctaatgagtggtccttggtgaacaagcagaagcccatatggatgaggaagcccgagg 779

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           ||||||  ||||||||||||||||| |||||||||||| |||| |||||||||||||| |
Sbjct: 780 agatcacaaaggaagagtatgctgcattctacaagagcctgactaatgactgggaggaac 839

                                                
Query: 191 atttggctgtcaagcacttctctgttgagggtcagct 227
           |||||||||| |||||||||||||||||||| |||||
Sbjct: 840 atttggctgtgaagcacttctctgttgagggccagct 876



to top

>ref|NM_124983.3| Arabidopsis thaliana HSP81-3; ATP binding / unfolded protein binding
            AT5G56010 (HSP81-3) mRNA, complete cds
          Length = 2423

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 868  tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 927

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 928  atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 987

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 988  ttggctgtgaagcatttctcagttgaaggacagcttgagt 1027



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 799 ggcaaggttgaggaagttgatgagg 823



to top

>emb|Y11827.1|ATHSP812 A.thaliana hsp81.2 gene
          Length = 2669

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 1313 tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 1372

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 1373 atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 1432

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 1433 ttggctgtgaagcatttctcagttgaaggacagcttgagt 1472



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 4    ggcaaggttgaggatgttgatgagg 28
            |||||||||||||| ||||||||||
Sbjct: 1244 ggcaaggttgaggaagttgatgagg 1268



to top

>gb|AY070031.1| Arabidopsis thaliana putative heat shock protein 90 (At5g56010) mRNA,
            complete cds
          Length = 2353

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 860  tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 919

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 920  atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 979

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 980  ttggctgtgaagcatttctcagttgaaggacagcttgagt 1019



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 791 ggcaaggttgaggaagttgatgagg 815



to top

>gb|AY081302.1| Arabidopsis thaliana heat shock protein 90 (At5g56010) mRNA, complete
            cds
          Length = 2373

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 866  tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 925

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 926  atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 985

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 986  ttggctgtgaagcatttctcagttgaaggacagcttgagt 1025



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 797 ggcaaggttgaggaagttgatgagg 821



to top

>gb|AY062832.1| Arabidopsis thaliana heat shock protein 90 (At5g56010; MDA7.5) mRNA,
            complete cds
          Length = 2359

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 868  tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 927

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 928  atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 987

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 988  ttggctgtgaagcatttctcagttgaaggacagcttgagt 1027



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 799 ggcaaggttgaggaagttgatgagg 823



to top

>gb|AY050349.1| Arabidopsis thaliana AT5g56010/MDA7_5 mRNA, partial cds
          Length = 1685

 Score =  190 bits (96), Expect = 1e-45
 Identities = 144/160 (90%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 866  tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 925

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| |||||||||||| ||||||
Sbjct: 926  atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggaagagcat 985

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 986  ttggctgtgaagcatttctcagttgaaggacagcttgagt 1025



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 4   ggcaaggttgaggatgttgatgagg 28
           |||||||||||||| ||||||||||
Sbjct: 797 ggcaaggttgaggaagttgatgagg 821



to top

>gb|AY368904.1| Nicotiana benthamiana molecular chaperone Hsp90-1 mRNA, complete
           cds
          Length = 2100

 Score =  184 bits (93), Expect = 8e-44
 Identities = 126/137 (91%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| |||||||||||||| || |||||||||||||| || |||||||  |||||||||
Sbjct: 778 ttggtgaacaagcagaagcccatttggatgaggaagcctgatgagatcacgaaggaagag 837

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           ||||| |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 838 tatgccgctttctataagagcttgactaatgactgggaggagcatttggctgtgaagcac 897

                            
Query: 208 ttctctgttgagggtca 224
           |||||||||||||||||
Sbjct: 898 ttctctgttgagggtca 914



to top

>dbj|D29710.1|RICYK22 Oryza sativa mRNA, partial homologous to heat shock protein 90 gene
          Length = 293

 Score =  182 bits (92), Expect = 3e-43
 Identities = 121/131 (92%)
 Strand = Plus / Plus

                                                                       
Query: 100 cagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgctgctttc 159
           ||||| ||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1   cagaaacctatttggttgaggaagccagaggagatcaccaaggaagagtatgctgctttc 60

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           |||||||||||||| || ||||||||||| ||| ||||||| |||||||||||||| |||
Sbjct: 61  tacaagagcttgacaaacgactgggaggaacatctggctgtnaagcacttctctgtggag 120

                      
Query: 220 ggtcagcttga 230
           |||||||||||
Sbjct: 121 ggtcagcttga 131



to top

>gb|U55860.1|TAU55860 Triticum aestivum heat shock protein 90 mRNA, partial cds
          Length = 502

 Score =  182 bits (92), Expect = 3e-43
 Identities = 143/160 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           ||||| ||||||||| || |||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 310 tctcacgagtggaacctgatcaacaagcagaagcccatctggatgaggaagcctgaggag 369

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           |||| |||||| ||||||||||| |||||||||||| |||| || |||||||||||||| 
Sbjct: 370 atcaccaaggatgagtatgctgccttctacaagagcctgacaaacgactgggaggagcac 429

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            | || |||||||||||||| || ||||||||||||||||
Sbjct: 430 cttgccgtcaagcacttctcggtggagggtcagcttgagt 469



to top

>ref|XM_483191.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2100

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 769 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 828

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 829 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 888

                                              
Query: 193 ttggctgtcaagcacttctctgttgagggtcagct 227
            | |||||||||||||||||||| |||||||||||
Sbjct: 889 cttgctgtcaagcacttctctgtggagggtcagct 923



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 1   gagggcaaggttgaggatgttgatga 26
           ||||||||||||||||||||||||||
Sbjct: 697 gagggcaaggttgaggatgttgatga 722



to top

>emb|Z11920.1|OSHSP82A O.sativa gene for heat shock protein 82 HSP82
          Length = 5310

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 3600 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 3659

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 3660 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 3719

                                               
Query: 193  ttggctgtcaagcacttctctgttgagggtcagct 227
             | |||||||||||||||||||| |||||||||||
Sbjct: 3720 cttgctgtcaagcacttctctgtggagggtcagct 3754



 Score = 44.1 bits (22), Expect = 0.19
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1    gagggcaaggttgaggatgttgatga 26
            ||||| ||||||||||||||||||||
Sbjct: 3528 gaggggaaggttgaggatgttgatga 3553



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Minus

                                                                            
Query: 73       tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
                ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 24713531 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 24713472

                                                                            
Query: 133      atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
                ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 24713471 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 24713412

                                                   
Query: 193      ttggctgtcaagcacttctctgttgagggtcagct 227
                 | |||||||||||||||||||| |||||||||||
Sbjct: 24713411 cttgctgtcaagcacttctctgtggagggtcagct 24713377



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 1        gagggcaaggttgaggatgttgatga 26
                ||||||||||||||||||||||||||
Sbjct: 24713603 gagggcaaggttgaggatgttgatga 24713578



to top

>dbj|AP003892.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1345_D02
          Length = 159613

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Minus

                                                                         
Query: 73    tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
             ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 14332 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 14273

                                                                         
Query: 133   atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
             ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 14272 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 14213

                                                
Query: 193   ttggctgtcaagcacttctctgttgagggtcagct 227
              | |||||||||||||||||||| |||||||||||
Sbjct: 14212 cttgctgtcaagcacttctctgtggagggtcagct 14178



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 1     gagggcaaggttgaggatgttgatga 26
             ||||||||||||||||||||||||||
Sbjct: 14404 gagggcaaggttgaggatgttgatga 14379



to top

>dbj|AP003873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1118_A06
          Length = 92836

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Minus

                                                                         
Query: 73    tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
             ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 85835 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 85776

                                                                         
Query: 133   atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
             ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 85775 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 85716

                                                
Query: 193   ttggctgtcaagcacttctctgttgagggtcagct 227
              | |||||||||||||||||||| |||||||||||
Sbjct: 85715 cttgctgtcaagcacttctctgtggagggtcagct 85681



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 1     gagggcaaggttgaggatgttgatga 26
             ||||||||||||||||||||||||||
Sbjct: 85907 gagggcaaggttgaggatgttgatga 85882



to top

>dbj|AK102426.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093F17, full
            insert sequence
          Length = 3149

 Score =  180 bits (91), Expect = 1e-42
 Identities = 139/155 (89%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            ||||||||||||  | |||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1578 tctcatgagtggtccctggtcaacaaacagaagcctatctggatgaggaagcctgaggag 1637

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||  ||||| |||||||||||||||||||||  | |||| || |||||||||||||||
Sbjct: 1638 atcactaaggaggagtatgctgctttctacaagtccctgacaaacgactgggaggagcat 1697

                                               
Query: 193  ttggctgtcaagcacttctctgttgagggtcagct 227
             | |||||||||||||||||||| |||||||||||
Sbjct: 1698 cttgctgtcaagcacttctctgtggagggtcagct 1732



 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 1    gagggcaaggttgaggatgttgatga 26
            ||||||||||||||||||||||||||
Sbjct: 1506 gagggcaaggttgaggatgttgatga 1531



to top

>gb|AY368907.1| Lycopersicon esculentum molecular chaperone Hsp90-2 mRNA, complete
           cds
          Length = 2100

 Score =  176 bits (89), Expect = 2e-41
 Identities = 125/137 (91%)
 Strand = Plus / Plus

                                                                       
Query: 89  tggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagt 148
           |||| ||||||||||||||||| |||||||| |||||||| |||||||  ||||||||||
Sbjct: 779 tggtgaacaagcagaagcctatttggatgagaaagccagaagagatcacaaaggaagagt 838

                                                                       
Query: 149 atgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcact 208
           ||||||||||||||||||||||||| ||||| ||||| |||||| | ||||| |||||||
Sbjct: 839 atgctgctttctacaagagcttgactaatgattgggaagagcatcttgctgtgaagcact 898

                            
Query: 209 tctctgttgagggtcag 225
           |||||||||||||||||
Sbjct: 899 tctctgttgagggtcag 915



to top

>gb|AY310781.1| Nicotiana benthamiana clone 9-037 unknown mRNA
          Length = 1906

 Score =  176 bits (89), Expect = 2e-41
 Identities = 131/145 (90%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| || ||||||||||| || ||||||||||| || ||||||||||  |||||||||
Sbjct: 413 ttggtaaataagcagaagcccatatggatgaggaaacccgaggagatcacaaaggaagag 472

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           ||||||||||||||||||||| |||| ||||||||||| || ||||||||||| ||||||
Sbjct: 473 tatgctgctttctacaagagcctgactaatgactgggaagaacatttggctgtgaagcac 532

                                    
Query: 208 ttctctgttgagggtcagcttgagt 232
           |||||||||||||||||||| ||||
Sbjct: 533 ttctctgttgagggtcagctggagt 557



to top

>gb|M96549.1|TOMHSC80P Tomato heat shock cognate protein 80 gene, 3' end
          Length = 3535

 Score =  176 bits (89), Expect = 2e-41
 Identities = 125/137 (91%)
 Strand = Plus / Plus

                                                                        
Query: 89   tggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagt 148
            |||| ||||||||||||||||| |||||||| |||||||| |||||||  ||||||||||
Sbjct: 2026 tggtgaacaagcagaagcctatttggatgagaaagccagaagagatcacaaaggaagagt 2085

                                                                        
Query: 149  atgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcact 208
            ||||||||||||||||||||||||| ||||| ||||| |||||| | ||||| |||||||
Sbjct: 2086 atgctgctttctacaagagcttgactaatgattgggaagagcatcttgctgtgaagcact 2145

                             
Query: 209  tctctgttgagggtcag 225
            |||||||||||||||||
Sbjct: 2146 tctctgttgagggtcag 2162



to top

>gb|S77849.1| HSP81-3=heat-shock Protein [Arabidopsis thaliana=thale-cress,
            Genomic, 3094 nt]
          Length = 3094

 Score =  174 bits (88), Expect = 8e-41
 Identities = 142/160 (88%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            |||||||||||| | ||||| ||||||||||| || || |||||||||||||||||||||
Sbjct: 1496 tctcatgagtgggatttggtgaacaagcagaaaccgatttggatgaggaagccagaggag 1555

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||||||||| ||||| ||||||||||||||||| |||| ||||||||||||  || ||
Sbjct: 1556 atcaacaaggaggagtacgctgctttctacaagagtttgagcaatgactgggacaaggat 1615

                                                    
Query: 193  ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||| ||||| ||||| ||||| || ||||||||||
Sbjct: 1616 ttggctgtgaagcatttctcagttgaaggacagcttgagt 1655



 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 4    ggcaaggttgaggatgttgatgagg 28
            |||||||||||||| ||||||||||
Sbjct: 1427 ggcaaggttgaggaagttgatgagg 1451



to top

>dbj|D10428.1|RICAK108 Oryza sativa mRNA for heat shock protein 90KD (AK108 gene), partial
           sequence
          Length = 356

 Score =  174 bits (88), Expect = 8e-41
 Identities = 144/160 (90%), Gaps = 2/160 (1%)
 Strand = Plus / Plus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||||| |||||||||| | | ||||||||||| ||  | ||| |||||||||||||||
Sbjct: 26  tctctcacgagtggaact-gatgaacaagcagaaaccctt-tggttgaggaagccagagg 83

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||||| |
Sbjct: 84  agatcaccaaggaagagtacgctgctttctacaagagcttgacaaacgactgggaggaac 143

                                                   
Query: 191 atttggctgtcaagcacttctctgttgagggtcagcttga 230
           || |||||||||||||||||||||| ||||||||||||||
Sbjct: 144 atctggctgtcaagcacttctctgtggagggtcagcttga 183



to top

>gb|AY368906.1| Lycopersicon esculentum molecular chaperone Hsp90-1 mRNA, complete
           cds
          Length = 2100

 Score =  170 bits (86), Expect = 1e-39
 Identities = 143/162 (88%)
 Strand = Plus / Plus

                                                                       
Query: 71  tctctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagagg 130
           ||||| ||||||||   ||||| || ||||||||||| || |||||||||||||| ||||
Sbjct: 761 tctctaatgagtggtcattggttaataagcagaagcccatatggatgaggaagcccgagg 820

                                                                       
Query: 131 agatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagc 190
           ||||||  || || ||||||||||| |||||||||||| |||| ||||| ||||| ||||
Sbjct: 821 agatcacaaaagaggagtatgctgcattctacaagagcctgacaaatgattgggaagagc 880

                                                     
Query: 191 atttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           |||||||||||||||||||||||||||| |||||||||||||
Sbjct: 881 atttggctgtcaagcacttctctgttgaaggtcagcttgagt 922



to top

>gb|AY310789.1| Nicotiana benthamiana clone 10-186 unknown mRNA
          Length = 2317

 Score =  170 bits (86), Expect = 1e-39
 Identities = 122/134 (91%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| |||||||||||||| || ||||||||||| || || |||||||  |||||||||
Sbjct: 823 ttggtgaacaagcagaagcccatttggatgaggaaacctgacgagatcacgaaggaagag 882

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 883 tatgccgctttctataagagcttgaccaatgactgggaggagcatttggctgtgaagcac 942

                         
Query: 208 ttctctgttgaggg 221
           |||||||| |||||
Sbjct: 943 ttctctgtcgaggg 956



to top

>gb|AY103538.1| Zea mays PCO150589 mRNA sequence
          Length = 2534

 Score =  167 bits (84), Expect = 2e-38
 Identities = 135/152 (88%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            ||||||||||||   |||||||||||||||||||| || ||||||||||||||||| || 
Sbjct: 948  tctcatgagtggtcattggtcaacaagcagaagcccatatggatgaggaagccagaagaa 1007

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
            ||||  || ||||| |||||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 1008 atcacaaaagaagaatatgctgccttctataagagcttgacaaatgactgggaggagcat 1067

                                            
Query: 193  ttggctgtcaagcacttctctgttgagggtca 224
             ||||||| |||||||||||||| ||||||||
Sbjct: 1068 ctggctgtgaagcacttctctgtggagggtca 1099



 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 7   aaggttgaggatgttgatgagg 28
           ||||||||||||||||||||||
Sbjct: 882 aaggttgaggatgttgatgagg 903



to top

>emb|X63195.1|NTHSP82 N.tabacum mRNA for heat shock protein 82
          Length = 1747

 Score =  161 bits (81), Expect = 1e-36
 Identities = 123/137 (89%)
 Strand = Plus / Plus

                                                                       
Query: 94  aacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgct 153
           ||||||||||| ||||||||| || | || ||||||||||||| |||||| |||||||| 
Sbjct: 187 aacaagcagaaacctatctggttgcgcaaaccagaggagatcaccaaggatgagtatgcc 246

                                                                       
Query: 154 gctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctct 213
            |||||||||||||||||||||||||||||||||||||  | |||||||| |||||||||
Sbjct: 247 tctttctacaagagcttgaccaatgactgggaggagcaccttgctgtcaaacacttctct 306

                            
Query: 214 gttgagggtcagcttga 230
           |||||||| ||||||||
Sbjct: 307 gttgaggggcagcttga 323



to top

>gb|U55859.1|TAU55859 Triticum aestivum heat shock protein 80 mRNA, complete cds
          Length = 2397

 Score =  161 bits (81), Expect = 1e-36
 Identities = 143/161 (88%), Gaps = 2/161 (1%)
 Strand = Plus / Plus

                                                                        
Query: 73   tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
            ||||| ||||||||| || |||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 878  tctcacgagtggaacctgatcaacaagcagaagcccatctggatgaggaagcctgaggag 937

                                                                        
Query: 133  atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagca- 191
            ||||  ||||| |||| |||||| |||| ||||||| |||| || |||||||||||||| 
Sbjct: 938  atcacaaaggatgagtttgctgccttcttcaagagcctgacaaacgactgggaggagcac 997

                                                     
Query: 192  tttggctgtcaagcacttctctgttgagggtcagcttgagt 232
             ||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 998  cttggc-gtcaagcacttctctgtggagggtcagcttgagt 1037



to top

>gb|DQ252488.1| Solanum tuberosum clone 054G03 Hsp90-2-like mRNA, complete cds
          Length = 2188

 Score =  161 bits (81), Expect = 1e-36
 Identities = 120/133 (90%)
 Strand = Plus / Plus

                                                                       
Query: 89  tggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagt 148
           |||| |||||||||||||| || ||||||||||||||||| |||||||  ||||| ||||
Sbjct: 855 tggtgaacaagcagaagcccatttggatgaggaagccagaagagatcacaaaggaggagt 914

                                                                       
Query: 149 atgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcact 208
           ||||||||||||||||||||||||| ||||| ||||| |||||| | ||||| |||||||
Sbjct: 915 atgctgctttctacaagagcttgactaatgattgggaagagcatcttgctgtgaagcact 974

                        
Query: 209 tctctgttgaggg 221
           |||||||||||||
Sbjct: 975 tctctgttgaggg 987



to top

>gb|AY805121.1| Iris tectorum clone 3ItDoFw-Z3 putative heat shock protein mRNA,
           partial cds
          Length = 924

 Score =  159 bits (80), Expect = 5e-36
 Identities = 128/144 (88%)
 Strand = Plus / Plus

                                                                       
Query: 89  tggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagt 148
           ||||||||||||||||||| ||||||||||||||||| |||||||| | |||||| ||||
Sbjct: 231 tggtcaacaagcagaagccaatctggatgaggaagcccgaggagattaccaaggaggagt 290

                                                                       
Query: 149 atgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcact 208
           ||||||| |||||||||||  | || |||||||||||||||||  ||||||| |||||||
Sbjct: 291 atgctgcattctacaagagtctcactaatgactgggaggagcacctggctgttaagcact 350

                                   
Query: 209 tctctgttgagggtcagcttgagt 232
           |||| || ||||| ||||||||||
Sbjct: 351 tctcagtggagggccagcttgagt 374



to top

>gb|AY519499.1| Nicotiana tabacum heat shock protein 90 (OINtHsp90) mRNA, complete
           cds
          Length = 2306

 Score =  155 bits (78), Expect = 7e-35
 Identities = 120/134 (89%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| |||||||||||||| || |||||||||||||| || || ||||  ||||||| |
Sbjct: 818 ttggtgaacaagcagaagcccatttggatgaggaagcctgacgaaatcacgaaggaaggg 877

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           ||||| |||||||| ||||||||||| |||||||||||||||||| ||||||| ||||||
Sbjct: 878 tatgccgctttctataagagcttgactaatgactgggaggagcatatggctgtgaagcac 937

                         
Query: 208 ttctctgttgaggg 221
           ||||||||||||||
Sbjct: 938 ttctctgttgaggg 951



to top

>ref|NM_124642.2| Arabidopsis thaliana HSP81-1 (HEAT SHOCK PROTEIN 81-1); ATP binding /
            unfolded protein binding AT5G52640 (HSP81-1) mRNA,
            complete cds
          Length = 2440

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 908  tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 967

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 968  ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 1027

                            
Query: 212  ctgttgagggtcagct 227
            | || |||||||||||
Sbjct: 1028 cagtggagggtcagct 1043



to top

>gb|BT001091.1| Arabidopsis thaliana At5g52640/F6N7_13 mRNA, complete cds
          Length = 2118

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                       
Query: 92  tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
           ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 800 tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 859

                                                                       
Query: 152 ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
           |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 860 ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 919

                           
Query: 212 ctgttgagggtcagct 227
           | || |||||||||||
Sbjct: 920 cagtggagggtcagct 935



to top

>emb|Y07613.1|ATHSP90A A.thaliana hsp90A gene
          Length = 3413

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 1900 tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 1959

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 1960 ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 2019

                            
Query: 212  ctgttgagggtcagct 227
            | || |||||||||||
Sbjct: 2020 cagtggagggtcagct 2035



to top

>gb|AY128296.1| Arabidopsis thaliana AT5g52640/F6N7_13 mRNA, complete cds
          Length = 2441

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 908  tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 967

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 968  ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 1027

                            
Query: 212  ctgttgagggtcagct 227
            | || |||||||||||
Sbjct: 1028 cagtggagggtcagct 1043



to top

>dbj|AB025606.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F6N7
          Length = 74282

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                         
Query: 92    tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
             ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 33167 tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 33226

                                                                         
Query: 152   ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
             |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 33227 ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 33286

                             
Query: 212   ctgttgagggtcagct 227
             | || |||||||||||
Sbjct: 33287 cagtggagggtcagct 33302



to top

>dbj|D00710.1|ATHHSP81 Arabidopsis thaliana HSP81-1 gene for 81kDa heat-shock protein,
            complete cds
          Length = 3213

 Score =  151 bits (76), Expect = 1e-33
 Identities = 121/136 (88%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||||||
Sbjct: 1737 tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtatg 1796

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 1797 ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 1856

                            
Query: 212  ctgttgagggtcagct 227
            | || |||||||||||
Sbjct: 1857 cagtggagggtcagct 1872



to top

>gb|M62984.1|ATHHSP83 A.thaliana heat shock protein 83 mRNA, complete cds
          Length = 2390

 Score =  143 bits (72), Expect = 3e-31
 Identities = 120/136 (88%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            ||||||||||||| || |||||| ||||||||||||| |||||||  |||||||||| ||
Sbjct: 869  tcaacaagcagaaaccgatctggttgaggaagccagaagagatcactaaggaagagtctg 928

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||||||||||||||||||||||||||||||||| || || || || || || |||||||
Sbjct: 929  ctgctttctacaagagcttgaccaatgactgggaagatcacttagccgtgaaacacttct 988

                            
Query: 212  ctgttgagggtcagct 227
            | || |||||||||||
Sbjct: 989  cagtggagggtcagct 1004



to top

>emb|CT573078.1| Medicago truncatula chromosome 5 clone mte1-4f8, COMPLETE SEQUENCE
          Length = 165916

 Score =  139 bits (70), Expect = 4e-30
 Identities = 121/138 (87%)
 Strand = Plus / Plus

                                                                         
Query: 88    ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
             ||||| |||||||| || ||||| |||||||||||||| |||||||| |  ||||| |||
Sbjct: 32502 ttggtgaacaagcaaaaacctatttggatgaggaagcccgaggagattacaaaggatgag 32561

                                                                         
Query: 148   tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
             ||||||||||| ||||||||  | |||||||| ||||| |||||||||||||| ||||||
Sbjct: 32562 tatgctgctttttacaagagtctcaccaatgattgggaagagcatttggctgttaagcac 32621

                               
Query: 208   ttctctgttgagggtcag 225
             ||||| ||||||||||||
Sbjct: 32622 ttctcagttgagggtcag 32639



 Score =  139 bits (70), Expect = 4e-30
 Identities = 121/138 (87%)
 Strand = Plus / Plus

                                                                         
Query: 88    ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
             ||||| |||||||| || ||||| |||||||||||||| |||||||| |  ||||| |||
Sbjct: 21861 ttggtgaacaagcaaaaacctatttggatgaggaagcccgaggagattacaaaggatgag 21920

                                                                         
Query: 148   tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
             ||||||||||| ||||||||  | |||||||| ||||| |||||||||||||| ||||||
Sbjct: 21921 tatgctgctttttacaagagtctcaccaatgattgggaagagcatttggctgttaagcac 21980

                               
Query: 208   ttctctgttgagggtcag 225
             ||||| ||||||||||||
Sbjct: 21981 ttctcagttgagggtcag 21998



to top

>dbj|D11138.1|RICGE2 Oryza sativa (japonica cultivar-group) mRNA of strong gravity
           stress responsible gene, partial cds
          Length = 667

 Score =  135 bits (68), Expect = 7e-29
 Identities = 105/116 (90%), Gaps = 1/116 (0%)
 Strand = Plus / Plus

                                                                       
Query: 116 tgaggaagccagaggagatcaacaaggaagagtatgc-tgctttctacaagagcttgacc 174
           ||||||||||||||||||||| |||||||||||| || ||||||||||||||||| ||| 
Sbjct: 44  tgaggaagccagaggagatcaccaaggaagagtacgcatgctttctacaagagctcgaca 103

                                                                   
Query: 175 aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttga 230
           || ||||||||||| ||| ||||||||||  |||||||||| ||||||||||||||
Sbjct: 104 aacgactgggaggaacatctggctgtcaacgacttctctgtggagggtcagcttga 159



to top

>gb|S56878.1| gravity specific cDNA {clone GSC381} [Oryza sativa, Nipponbare,
           suspension callus, mRNA, 685 nt]
          Length = 685

 Score =  135 bits (68), Expect = 7e-29
 Identities = 105/116 (90%), Gaps = 1/116 (0%)
 Strand = Plus / Plus

                                                                       
Query: 116 tgaggaagccagaggagatcaacaaggaagagtatgc-tgctttctacaagagcttgacc 174
           ||||||||||||||||||||| |||||||||||| || ||||||||||||||||| ||| 
Sbjct: 44  tgaggaagccagaggagatcaccaaggaagagtacgcatgctttctacaagagctcgaca 103

                                                                   
Query: 175 aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttga 230
           || ||||||||||| ||| ||||||||||  |||||||||| ||||||||||||||
Sbjct: 104 aacgactgggaggaacatctggctgtcaacgacttctctgtggagggtcagcttga 159



to top

>gb|BC008189.1| Mus musculus, clone IMAGE:3584589, mRNA, partial cds
          Length = 1728

 Score =  131 bits (66), Expect = 1e-27
 Identities = 120/138 (86%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| |||||||| ||||| |||||||||||||||||||| ||||||| ||| || |||
Sbjct: 157 ttggttaacaagcaaaagcccatctggatgaggaagccagaagagatcaccaaagaggag 216

                                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac 207
           || ||||| || ||||||||  | |||||||||||||| |||||||||   || ||||||
Sbjct: 217 tacgctgcattttacaagagtcttaccaatgactgggaagagcatttgcaagtgaagcac 276

                             
Query: 208 ttctctgttgagggtcag 225
           ||||||||||||||||||
Sbjct: 277 ttctctgttgagggtcag 294



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 1  gagggcaaggttgaggatgttgatgagg 28
          ||||| ||||| ||||||||||||||||
Sbjct: 70 gagggtaaggtagaggatgttgatgagg 97



to top

>gb|M99431.1|PHNHSP83A Pharbitis nil heat shock protein 83 (Hsp83) gene, complete cds
          Length = 3563

 Score =  129 bits (65), Expect = 4e-27
 Identities = 119/137 (86%)
 Strand = Plus / Plus

                                                                        
Query: 94   aacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgct 153
            |||||||| || || |||||| || | ||||| |||||||||| |||||| || ||||| 
Sbjct: 1873 aacaagcaaaaaccaatctggttgcgcaagcctgaggagatcaccaaggaggaatatgcc 1932

                                                                        
Query: 154  gctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctct 213
             ||||||||||||| || |||||||| |||||||| ||| | ||||||||||||||||||
Sbjct: 1933 tctttctacaagagtttaaccaatgattgggaggatcatcttgctgtcaagcacttctct 1992

                             
Query: 214  gttgagggtcagcttga 230
            |||||||||||||||||
Sbjct: 1993 gttgagggtcagcttga 2009



to top

>dbj|AP005092.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1112_E07
          Length = 132055

 Score =  127 bits (64), Expect = 2e-26
 Identities = 137/159 (86%), Gaps = 8/159 (5%)
 Strand = Plus / Plus

                                                                          
Query: 75     tcatgagtggaacttggtcaacaagcag-aagcctatctggatgaggaagccagaggaga 133
              ||||||||| |||||| ||||||||||| ||||| ||||||||||||||  |||||| ||
Sbjct: 107836 tcatgagtgcaacttgatcaacaagcaggaagcc-atctggatgaggaaatcagaggtga 107894

                                                                          
Query: 134    tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
              ||| ||||||||      | || ||||| ||||||||||| || ||||||||||| ||| 
Sbjct: 107895 tcaccaaggaag------cagccttctaaaagagcttgacaaacgactgggaggaacatc 107948

                                                     
Query: 194    tggctgtcaagcacttctctgttgagggtcagcttgagt 232
              |||||||||||||||||||||| ||||||||||||||||
Sbjct: 107949 tggctgtcaagcacttctctgtggagggtcagcttgagt 107987



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 1      gagggcaaggttgaggatgttgatgagg 28
              ||||| ||||||||||||||||||||||
Sbjct: 107762 gagggaaaggttgaggatgttgatgagg 107789



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 1      gagggcaaggttgaggatgttgatgagg 28
              ||||| ||||||||||||||||||||||
Sbjct: 107618 gagggaaaggttgaggatgttgatgagg 107645



to top

>dbj|AK065528.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013031D07, full
            insert sequence
          Length = 3207

 Score =  127 bits (64), Expect = 2e-26
 Identities = 137/159 (86%), Gaps = 8/159 (5%)
 Strand = Plus / Plus

                                                                        
Query: 75   tcatgagtggaacttggtcaacaagcag-aagcctatctggatgaggaagccagaggaga 133
            ||||||||| |||||| ||||||||||| ||||| ||||||||||||||  |||||| ||
Sbjct: 1605 tcatgagtgcaacttgatcaacaagcaggaagcc-atctggatgaggaaatcagaggtga 1663

                                                                        
Query: 134  tcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatt 193
            ||| ||||||||      | || ||||| ||||||||||| || ||||||||||| ||| 
Sbjct: 1664 tcaccaaggaag------cagccttctaaaagagcttgacaaacgactgggaggaacatc 1717

                                                   
Query: 194  tggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||||||||||||||||| ||||||||||||||||
Sbjct: 1718 tggctgtcaagcacttctctgtggagggtcagcttgagt 1756



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1    gagggcaaggttgaggatgttgatgagg 28
            ||||| ||||||||||||||||||||||
Sbjct: 1531 gagggaaaggttgaggatgttgatgagg 1558



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1    gagggcaaggttgaggatgttgatgagg 28
            ||||| ||||||||||||||||||||||
Sbjct: 1387 gagggaaaggttgaggatgttgatgagg 1414



to top

>dbj|AB236777.1| Trifolium pratense RNA for putative HEAT SHOCK PROTEIN 81-2,
           partial cds, clone: C1601
          Length = 1498

 Score =  121 bits (61), Expect = 1e-24
 Identities = 130/153 (84%)
 Strand = Plus / Plus

                                                                       
Query: 73  tctcatgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggag 132
           |||||||||||| | ||||| ||||| ||||| ||||| |||||||||||||| || |||
Sbjct: 827 tctcatgagtgggatttggtgaacaaacagaaacctatttggatgaggaagcctgaagag 886

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           || |  ||||| |||||||||||||| ||||||||  | ||||| || ||||| || |||
Sbjct: 887 attacaaaggatgagtatgctgctttttacaagagtcttaccaacgattgggaagaacat 946

                                            
Query: 193 ttggctgtcaagcacttctctgttgagggtcag 225
           ||||| || ||||| ||||||||||||||||||
Sbjct: 947 ttggccgttaagcatttctctgttgagggtcag 979



to top

>gb|AF521007.1| Hevea brasiliensis heat shock protein mRNA, complete cds
          Length = 2405

 Score =  117 bits (59), Expect = 2e-23
 Identities = 119/139 (85%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            |||||||||| || || |||||| || | ||||| |||||||||| |||||| || ||||
Sbjct: 899  tcaacaagcaaaaacccatctggctgcgcaagccggaggagatcaccaaggaggaatatg 958

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |  ||||||| |||||||||||||| ||||||||||| ||  | ||||||||||| ||||
Sbjct: 959  catctttctataagagcttgaccaacgactgggaggaccaccttgctgtcaagcatttct 1018

                               
Query: 212  ctgttgagggtcagcttga 230
            |||| ||||||||||||||
Sbjct: 1019 ctgtcgagggtcagcttga 1037



to top

>gb|AF462213.1| Narcissus pseudonarcissus putative heat shock protein mRNA, partial
           cds
          Length = 416

 Score =  113 bits (57), Expect = 2e-22
 Identities = 120/141 (85%)
 Strand = Plus / Plus

                                                                       
Query: 92  tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
           |||||||||||||||| |||||| |  | ||||| |||||||||| ||| || |||||||
Sbjct: 182 tcaacaagcagaagcccatctggcttcgtaagccggaggagatcaccaaagaggagtatg 241

                                                                       
Query: 152 ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
           || | |||||||||||| |||||||||| |||||||| ||| | || || ||||| ||||
Sbjct: 242 cttcgttctacaagagcctgaccaatgattgggaggaccatcttgccgttaagcatttct 301

                                
Query: 212 ctgttgagggtcagcttgagt 232
           |||| ||||||||||| ||||
Sbjct: 302 ctgtcgagggtcagctcgagt 322



to top

>gb|AY226090.1| Nematostella vectensis 90-kDa heat-shock protein (hsp90) mRNA,
           partial cds
          Length = 1722

 Score =  111 bits (56), Expect = 1e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           ||||||||||||||||||||||||||||| || ||  | |||||||||||||||||||||
Sbjct: 847 ttctacaagagcttgaccaatgactgggaagaacaccttgctgtcaagcacttctctgtt 906

                           
Query: 217 gagggtcagcttgagt 232
           ||||||||||||||||
Sbjct: 907 gagggtcagcttgagt 922



to top

>gb|AY226088.1| Sycon sp. AR-2003 90-kDa heat-shock protein (hsp90) mRNA, partial
           cds
          Length = 1716

 Score =  111 bits (56), Expect = 1e-21
 Identities = 89/100 (89%)
 Strand = Plus / Plus

                                                                       
Query: 133 atcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcat 192
           |||| |||||| |||||||| |  ||||||||||||||||||||||||||||| || |||
Sbjct: 817 atcagcaaggatgagtatgccgacttctacaagagcttgaccaatgactgggaagaccat 876

                                                   
Query: 193 ttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            | ||||||||||| |||||||||||||||||||| ||||
Sbjct: 877 cttgctgtcaagcatttctctgttgagggtcagctcgagt 916



to top

>gb|AY423488.1| Opistophthalmus carinatus Hsp90 (HSP90) mRNA, complete cds
          Length = 2310

 Score =  107 bits (54), Expect = 2e-20
 Identities = 111/130 (85%)
 Strand = Plus / Plus

                                                                        
Query: 103  aagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgctgctttctac 162
            ||||| || ||||||||||| ||||| || |||| |||||||||||||| ||  ||||||
Sbjct: 892  aagccaatttggatgaggaatccagatgacatcagcaaggaagagtatggtgaattctac 951

                                                                        
Query: 163  aagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggt 222
            |||||  |||| ||||||||||| || ||||||||||||   |||||||| |||||||| 
Sbjct: 952  aagagtctgactaatgactgggaagaacatttggctgtccgtcacttctcagttgagggc 1011

                      
Query: 223  cagcttgagt 232
            ||||||||||
Sbjct: 1012 cagcttgagt 1021



to top

>gb|AY122634.1| Naegleria gruberi strain ATCC 30224 heat shock protein 90 (HSP-90)
           gene, partial cds
          Length = 2004

 Score =  105 bits (53), Expect = 6e-20
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 138 caaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggc 197
           ||||||||| |||||| | |||||||||  |||||||||||||||||| || ||||||||
Sbjct: 849 caaggaagaatatgcttcattctacaaggccttgaccaatgactgggaagaacatttggc 908

                                
Query: 198 tgtcaagcacttctctgttga 218
           |||||||||||||||||||||
Sbjct: 909 tgtcaagcacttctctgttga 929



to top

>gb|AY167735.1| Populus alba HSP80 mRNA, partial cds
          Length = 535

 Score = 95.6 bits (48), Expect = 6e-17
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 88  ttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagag 147
           ||||| |||||||||||||| ||||||| |||||| |||||||||||||  || || |||
Sbjct: 426 ttggtgaacaagcagaagcccatctggacgaggaaaccagaggagatcactaaagaggag 485

                                                       
Query: 148 tatgctgctttctacaagagcttgaccaatgactgggaggagca 191
           | || ||| || ||||||||| | ||||||||||||||||||||
Sbjct: 486 tgtggtgcattttacaagagccttaccaatgactgggaggagca 529



to top

>gb|AY389747.1| Hyacinthus orientalis heat shock protein 82 mRNA, partial cds
          Length = 868

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 92/105 (87%), Gaps = 4/105 (3%)
 Strand = Plus / Plus

                                                                       
Query: 87  cttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaaga 146
           ||||||||||||||||||||||  |||| |||||||||| || ||||||| |||||| ||
Sbjct: 734 cttggtcaacaagcagaagcct--ctgggtgaggaagcctgaagagatcaccaaggagga 791

                                                        
Query: 147 gtatgctgctttctacaagagcttgaccaatgactgggaggagca 191
           || |||||| |||||||||||| | ||||  ||||||||||||||
Sbjct: 792 gtctgctgccttctacaagagccttacca--gactgggaggagca 834



to top

>gb|AY236717.1| Thaumatomonas sp. (SA) heat shock protein 90 (Hsp90) gene, partial
           cds
          Length = 1831

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                       
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgag 231
           ||||| ||||||||||||||||||||||||||||||||||| || ||||||||||| |||
Sbjct: 921 accaacgactgggaggagcatttggctgtcaagcacttctccgtcgagggtcagctcgag 980

            
Query: 232 t 232
           |
Sbjct: 981 t 981



to top

>ref|NM_001030484.1| Xenopus tropicalis heat shock 90kDa protein beta (hsp90beta), mRNA
          Length = 3040

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| ||||||||||||||||||| || |||||||| |||||||||||||| 
Sbjct: 953  ttctacaagagcctgaccaatgactgggaggatcacttggctgtgaagcacttctctgtg 1012

                 
Query: 217  gaggg 221
            |||||
Sbjct: 1013 gaggg 1017



to top

>gb|BC090610.1| Xenopus tropicalis heat shock 90kDa protein beta, mRNA (cDNA clone
            MGC:69447 IMAGE:5335884), complete cds
          Length = 3040

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| ||||||||||||||||||| || |||||||| |||||||||||||| 
Sbjct: 953  ttctacaagagcctgaccaatgactgggaggatcacttggctgtgaagcacttctctgtg 1012

                 
Query: 217  gaggg 221
            |||||
Sbjct: 1013 gaggg 1017



to top

>gb|DQ062089.1| Lamtostyla sp. LPJ-2005 heat shock protein 90 mRNA, partial cds;
           macronuclear
          Length = 848

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 96/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 tggatgaggaagccagaggagatcaacaaggaagagtatgctgctttctacaagagcttg 171
           |||||||| ||| |||||||||||| ||||||||| ||  |||||||||| |||||||| 
Sbjct: 3   tggatgagaaaggcagaggagatcaccaaggaagaatactctgctttctataagagctta 62

                                                                
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtca 224
            | ||||| ||||| || || ||||| |||||||||||||| ||||| |||||
Sbjct: 63  tcaaatgattgggaagaccacttggcagtcaagcacttctcagttgaaggtca 115



to top

>gb|AY391258.1| Oxyrrhis marina heat shock protein 90 gene, partial cds
          Length = 1713

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 142 gaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtc 201
           |||||||||||| |||||||||||   ||| || | ||||||||||| ||||||||||| 
Sbjct: 790 gaagagtatgcttctttctacaagtcgttgtccgacgactgggaggaccatttggctgtg 849

                                          
Query: 202 aagcacttctctgttgagggtcagcttgagt 232
           |||||||| ||||| ||||| ||||||||||
Sbjct: 850 aagcacttttctgtggagggccagcttgagt 880



to top

>gb|AY226087.1| Leucosolenia sp. 90-kDa heat-shock protein (hsp90) mRNA, partial
           cds
          Length = 1716

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||||||||||||||| |||||||| || |||||||| |||||||||||||| ||||| 
Sbjct: 844 tacaagagcttgaccaacgactgggaagaccatttggcagtcaagcacttctcagttgaa 903

                      
Query: 220 ggtcagcttga 230
           || ||||||||
Sbjct: 904 ggccagcttga 914



to top

>gb|DQ206492.1| Platynereis dumerilii isolate TOA67 heat shock 90 kDa protein mRNA,
           partial cds
          Length = 1719

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 170 tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
           ||||||||||||||||||| |||||||| |||||||||||||| || ||||| |||||||
Sbjct: 857 tgaccaatgactgggaggaccatttggccgtcaagcacttctccgtggagggccagcttg 916

              
Query: 230 agt 232
           |||
Sbjct: 917 agt 919



to top

>gb|AY214170.1| Paralichthys olivaceus heat shock protein 90 beta mRNA, complete cds
          Length = 2694

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||  ||||||||||||||||||| ||| ||||||||||||||||||| || 
Sbjct: 996  ttctacaagagtctgaccaatgactgggaggatcatctggctgtcaagcacttctcagtg 1055

                          
Query: 217  gagggtcagcttga 230
            || || ||||||||
Sbjct: 1056 gaaggccagcttga 1069



to top

>ref|XM_470993.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2112

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 92  tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
           |||||||||||||||| |||||| || ||||||| |||||||||| |  ||| ||||| |
Sbjct: 803 tcaacaagcagaagcccatctggctgcggaagccggaggagatcagccgggaggagtacg 862

                                                                       
Query: 152 ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
           |  | |||||||||||| | ||||| ||||||||||| ||  | || || ||||||||||
Sbjct: 863 cgtccttctacaagagcctcaccaacgactgggaggaccacctcgccgtgaagcacttct 922

                                
Query: 212 ctgttgagggtcagcttgagt 232
           | || ||||| ||||| ||||
Sbjct: 923 ccgtggaggggcagctggagt 943



to top

>ref|XM_323481.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) heat
           shock protein 80 [Neurospora crassa OR74A]  )
           (NCU04142.1) partial mRNA
          Length = 2118

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 92  tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
           |||||||||||||||| |||||||   | || ||  |||| |||| | |||| |||||||
Sbjct: 797 tcaacaagcagaagcccatctggactcgcaacccccaggacatcacccaggaggagtatg 856

                                                                       
Query: 152 ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
           |||| |||||||||  | |  |||| ||||||||||| ||  | ||||||||||||||||
Sbjct: 857 ctgccttctacaagtccctctccaacgactgggaggaccacctcgctgtcaagcacttct 916

                                
Query: 212 ctgttgagggtcagcttgagt 232
           | |||||||||||||| ||||
Sbjct: 917 ccgttgagggtcagctcgagt 937



to top

>ref|XM_956205.1| Neurospora crassa OR74A hypothetical protein ( (AL513463) heat
           shock protein 80 [Neurospora crassa OR74A]  )
           (NCU04142.1) partial mRNA
          Length = 2118

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 92  tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
           |||||||||||||||| |||||||   | || ||  |||| |||| | |||| |||||||
Sbjct: 797 tcaacaagcagaagcccatctggactcgcaacccccaggacatcacccaggaggagtatg 856

                                                                       
Query: 152 ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
           |||| |||||||||  | |  |||| ||||||||||| ||  | ||||||||||||||||
Sbjct: 857 ctgccttctacaagtccctctccaacgactgggaggaccacctcgctgtcaagcacttct 916

                                
Query: 212 ctgttgagggtcagcttgagt 232
           | |||||||||||||| ||||
Sbjct: 917 ccgttgagggtcagctcgagt 937



to top

>emb|Y11528.1|ANSSPB Aspergillus niger partial sspB gene for heat shock protein, strain
           N400
          Length = 1966

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 80/93 (86%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctg 199
           |||| ||||| |||||||||||||||  | |  |||| ||||||||||| || |||||||
Sbjct: 696 aggaggagtacgctgctttctacaagtccctctccaacgactgggaggaccacttggctg 755

                                            
Query: 200 tcaagcacttctctgttgagggtcagcttgagt 232
           ||||||||||||| || ||||||||||| ||||
Sbjct: 756 tcaagcacttctccgtcgagggtcagctcgagt 788



to top

>emb|AL606642.3|OSJN00073 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027H06,
            complete sequence
          Length = 143730

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            |||||||||||||||| |||||| || ||||||| |||||||||| |  ||| ||||| |
Sbjct: 5923 tcaacaagcagaagcccatctggctgcggaagccggaggagatcagccgggaggagtacg 5982

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |  | |||||||||||| | ||||| ||||||||||| ||  | || || ||||||||||
Sbjct: 5983 cgtccttctacaagagcctcaccaacgactgggaggaccacctcgccgtgaagcacttct 6042

                                 
Query: 212  ctgttgagggtcagcttgagt 232
            | || ||||| ||||| ||||
Sbjct: 6043 ccgtggaggggcagctggagt 6063



to top

>emb|AL513463.1|NC9G6 Neurospora crassa DNA linkage group V Cosmid contig 9G6
          Length = 125561

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                         
Query: 92    tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
             |||||||||||||||| |||||||   | || ||  |||| |||| | |||| |||||||
Sbjct: 62330 tcaacaagcagaagcccatctggactcgcaacccccaggacatcacccaggaggagtatg 62271

                                                                         
Query: 152   ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
             |||| |||||||||  | |  |||| ||||||||||| ||  | ||||||||||||||||
Sbjct: 62270 ctgccttctacaagtccctctccaacgactgggaggaccacctcgctgtcaagcacttct 62211

                                  
Query: 212   ctgttgagggtcagcttgagt 232
             | |||||||||||||| ||||
Sbjct: 62210 ccgttgagggtcagctcgagt 62190



to top

>gb|BC065359.1| Danio rerio heat shock protein 90kDa alpha (cytosolic), class B
            member 1, mRNA (cDNA clone MGC:77433 IMAGE:6970738),
            complete cds
          Length = 2669

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| |||||||| || ||  |||||||||||||||||||||| |||
Sbjct: 983  tacaagagcctgaccaacgactgggaagaccacctggctgtcaagcacttctctgtggag 1042

                         
Query: 220  ggtcagcttgagt 232
            |||||||| ||||
Sbjct: 1043 ggtcagctggagt 1055



to top

>ref|NM_131310.1| Danio rerio heat shock protein 90kDa alpha (cytosolic), class B
            member 1 (hsp90ab1), mRNA
          Length = 2642

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| |||||||| || ||  |||||||||||||||||||||| |||
Sbjct: 957  tacaagagcctgaccaacgactgggaagaccacctggctgtcaagcacttctctgtggag 1016

                         
Query: 220  ggtcagcttgagt 232
            |||||||| ||||
Sbjct: 1017 ggtcagctggagt 1029



to top

>gb|AF212996.1|AF212996 Neurospora crassa heat shock protein 80 gene, complete cds
          Length = 3556

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                        
Query: 92   tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
            |||||||||||||||| |||||||   | || ||  |||| |||| | |||| |||||||
Sbjct: 1999 tcaacaagcagaagcccatctggactcgcaacccccaggacatcacccaggaggagtatg 2058

                                                                        
Query: 152  ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
            |||| |||||||||  | |  |||| ||||||||||| ||  | ||||||||||||||||
Sbjct: 2059 ctgccttctacaagtccctctccaacgactgggaggaccacctcgctgtcaagcacttct 2118

                                 
Query: 212  ctgttgagggtcagcttgagt 232
            | |||||||||||||| ||||
Sbjct: 2119 ccgttgagggtcagctcgagt 2139



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4,
              complete sequence
          Length = 35498469

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                          
Query: 92     tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
              |||||||||||||||| |||||| || ||||||| |||||||||| |  ||| ||||| |
Sbjct: 474955 tcaacaagcagaagcccatctggctgcggaagccggaggagatcagccgggaggagtacg 475014

                                                                          
Query: 152    ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
              |  | |||||||||||| | ||||| ||||||||||| ||  | || || ||||||||||
Sbjct: 475015 cgtccttctacaagagcctcaccaacgactgggaggaccacctcgccgtgaagcacttct 475074

                                   
Query: 212    ctgttgagggtcagcttgagt 232
              | || ||||| ||||| ||||
Sbjct: 475075 ccgtggaggggcagctggagt 475095



to top

>emb|AL606620.3|OSJN00065 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0085F13,
              complete sequence
          Length = 130249

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                          
Query: 92     tcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatg 151
              |||||||||||||||| |||||| || ||||||| |||||||||| |  ||| ||||| |
Sbjct: 113707 tcaacaagcagaagcccatctggctgcggaagccggaggagatcagccgggaggagtacg 113766

                                                                          
Query: 152    ctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttct 211
              |  | |||||||||||| | ||||| ||||||||||| ||  | || || ||||||||||
Sbjct: 113767 cgtccttctacaagagcctcaccaacgactgggaggaccacctcgccgtgaagcacttct 113826

                                   
Query: 212    ctgttgagggtcagcttgagt 232
              | || ||||| ||||| ||||
Sbjct: 113827 ccgtggaggggcagctggagt 113847



to top

>gb|AF068772.1|AF068772 Danio rerio heat shock protein hsp90beta mRNA, complete cds
          Length = 2672

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| |||||||| || ||  |||||||||||||||||||||| |||
Sbjct: 976  tacaagagcctgaccaacgactgggaagaccacctggctgtcaagcacttctctgtggag 1035

                         
Query: 220  ggtcagcttgagt 232
            |||||||| ||||
Sbjct: 1036 ggtcagctggagt 1048



to top

>gb|AF042108.1|AF042108 Danio rerio heat shock protein 90-beta (hsp90beta) mRNA, complete cds
          Length = 2642

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| |||||||| || ||  |||||||||||||||||||||| |||
Sbjct: 957  tacaagagcctgaccaacgactgggaagaccacctggctgtcaagcacttctctgtggag 1016

                         
Query: 220  ggtcagcttgagt 232
            |||||||| ||||
Sbjct: 1017 ggtcagctggagt 1029



to top

>gb|AY190704.1| Pagrus major heat shock protein 90 beta mRNA, partial cds
          Length = 1784

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| ||||||| ||||||||||| ||  ||||||||||||||||||| || 
Sbjct: 38  ttctacaagagcctgaccaacgactgggaggatcacctggctgtcaagcacttctcagtg 97

                           
Query: 217 gagggtcagcttgagt 232
           ||||| ||||| ||||
Sbjct: 98  gagggccagctcgagt 113



to top

>gb|AY702458.1|AY702457S2 Oxyuranus scutellatus scutellatus clone R37 HSP 90 mRNA, partial
           cds
          Length = 1887

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| | |||||||||||||| || |||||||| |||||||| |||||||| 
Sbjct: 142 ttctacaagagcctcaccaatgactgggaagaccatttggcggtcaagcatttctctgtg 201

                           
Query: 217 gagggtcagcttgagt 232
           ||||| ||||| ||||
Sbjct: 202 gaggggcagctggagt 217



to top

>dbj|AB196457.1| Oncorhynchus mykiss HSP90BA mRNA for heat shock 90kDa protein 1 beta
            isoform a, complete cds
          Length = 2683

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| ||||||||||||||||||| ||  |||||||||||||||| || || 
Sbjct: 961  ttctacaagagcctgaccaatgactgggaggaacacctggctgtcaagcacttttcagtg 1020

                            
Query: 217  gagggtcagcttgagt 232
            ||||| ||||| ||||
Sbjct: 1021 gagggccagctggagt 1036



to top

>gb|AF457579.1| Bursaphelenchus xylophilus heat shock protein 90 gene, partial cds
          Length = 254

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||  |||| |||| ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 64  ttctacaagtccttgtccaacgactgggaggaccatttggctgtcaagcacttctccgtg 123

                           
Query: 217 gagggtcagcttgagt 232
           || ||||| |||||||
Sbjct: 124 gaaggtcaacttgagt 139



to top

>emb|AJ890081.1| Delia antiqua mRNA for Hsp90 protein
          Length = 2841

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                       
Query: 172  accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttga 230
            |||||||||||||| || ||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 1096 accaatgactgggaagaacatttggctgtcaagcacttctccgttgaaggtcaacttga 1154



to top

>gb|L47285.1|MSQHSP82G Anopheles albimanus heat shock protein gene (hsp82) genes, complete
            cds
          Length = 7587

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                       
Query: 169  ttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagct 227
            |||||||| ||||||||||| ||| ||||||| ||||||||||| ||||||||||||||
Sbjct: 6151 ttgaccaacgactgggaggaccatctggctgtgaagcacttctccgttgagggtcagct 6209



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                       
Query: 169  ttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagct 227
            |||||||| ||||||||||| ||| ||||||| ||||||||||| ||||||||||||||
Sbjct: 2404 ttgaccaacgactgggaggaccatctggctgtgaagcacttctccgttgagggtcagct 2346



to top

>gb|AY729865.1| Prymnesium parvum heat shock protein 90 gene, partial cds
          Length = 1893

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 114/139 (82%)
 Strand = Plus / Plus

                                                                        
Query: 94   aacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgct 153
            |||||||||||||| ||||||| | ||||||| |||||| | |  ||||| ||||| |  
Sbjct: 913  aacaagcagaagcccatctggacgcggaagcccgaggaggtgacgaaggaggagtacggc 972

                                                                        
Query: 154  gctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctct 213
            || |||||||||  | || | |||||||||||||||||  | || |||||||||||||| 
Sbjct: 973  gccttctacaaggccctgtcgaatgactgggaggagcaccttgcggtcaagcacttctcc 1032

                               
Query: 214  gttgagggtcagcttgagt 232
            || ||||||||||| ||||
Sbjct: 1033 gtggagggtcagctcgagt 1051



to top

>dbj|AK110411.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-H01, full
            insert sequence
          Length = 2819

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 125/154 (81%)
 Strand = Plus / Plus

                                                                        
Query: 79   gagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggagatcaac 138
            ||||||||| || | ||||||||||| || ||||||||| | || || |||||| ||| |
Sbjct: 867  gagtggaacctgctgaacaagcagaaacccatctggatgcgcaaccctgaggaggtcacc 926

                                                                        
Query: 139  aaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggct 198
             | || |||||||| || |||||||||  | | ||||| ||||||||||| ||  |||| 
Sbjct: 927  caagaggagtatgcggccttctacaagtccatcaccaacgactgggaggaccacctggcc 986

                                              
Query: 199  gtcaagcacttctctgttgagggtcagcttgagt 232
            || |||||||||||||| ||||| ||||| ||||
Sbjct: 987  gtgaagcacttctctgtggagggccagctggagt 1020



to top

>gb|AF465639.1| Mus musculus strain C57BL/6 heat shock protein 84b (Hsp84b) mRNA,
            complete cds
          Length = 2525

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1005 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1064

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1065 gaaggtcag 1073



to top

>gb|BC054457.1| Mus musculus cDNA clone IMAGE:6493938, **** WARNING: chimeric clone
           ****
          Length = 1185

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 438 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 497

                    
Query: 217 gagggtcag 225
           || ||||||
Sbjct: 498 gaaggtcag 506



to top

>gb|BC088985.1| Mus musculus heat shock protein 90kDa alpha (cytosolic), class B
            member 1, mRNA (cDNA clone MGC:115780 IMAGE:6808699),
            complete cds
          Length = 2520

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 999  ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1058

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1059 gaaggtcag 1067



to top

>ref|NM_008302.2| Mus musculus heat shock protein 90kDa alpha (cytosolic), class B
            member 1 (Hsp90ab1), mRNA
          Length = 2525

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1005 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1064

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1065 gaaggtcag 1073



to top

>dbj|AK135366.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820406O06 product:heat shock protein 1,
            beta, full insert sequence
          Length = 2514

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1013 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1072

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1073 gaaggtcag 1081



to top

>dbj|AK146205.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
            clone:I730034B14 product:heat shock protein 1, beta, full
            insert sequence
          Length = 2517

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1016 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1075

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1076 gaaggtcag 1084



to top

>dbj|AK084097.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
            enriched library, clone:D130091M03 product:heat shock
            protein, 84 kDa 1, full insert sequence
          Length = 2516

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1013 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1072

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1073 gaaggtcag 1081



to top

>ref|NM_074225.2| Caenorhabditis elegans abnormal DAuer Formation family member
            (daf-21) (daf-21) mRNA, complete cds
          Length = 2357

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 142  gaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtc 201
            ||||| |||||||  ||||||||||||||| ||||||||||||| || ||| | || |||
Sbjct: 962  gaagaatatgctgagttctacaagagcttgtccaatgactgggaagatcatcttgccgtc 1021

                                         
Query: 202  aagcacttctctgttgagggtcagcttga 230
            ||||| ||||| |||||||| || |||||
Sbjct: 1022 aagcatttctccgttgagggacaacttga 1050



to top

>dbj|AK030768.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730586E07 product:heat shock
            protein, 84 kDa 1, full insert sequence
          Length = 2512

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1011 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1070

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1071 gaaggtcag 1079



to top

>ref|NM_213973.1| Sus scrofa 90-kDa heat shock protein (HSP90), mRNA
          Length = 2456

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                 
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcactt 209
            ||||| |||||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 961  ttctataagagcttgaccaatgactgggaggatcacttggctgtgaagcactt 1013



to top

>gb|U94395.1|SSU94395 Sus scrofa 90-kDa heat shock protein (hsp90) mRNA, complete cds
          Length = 2456

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                 
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcactt 209
            ||||| |||||||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 961  ttctataagagcttgaccaatgactgggaggatcacttggctgtgaagcactt 1013



to top

>gb|M36829.1|MUSHSP84B Mouse heat-shock protein hsp84 mRNA
          Length = 2499

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 993  ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1052

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1053 gaaggtcag 1061



to top

>gb|M18186.1|MUSHSP84A Mouse 84 kD heat shock protein mRNA, complete cds
          Length = 2509

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || ||||| ||||||||||||||||| 
Sbjct: 1004 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgta 1063

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1064 gaaggtcag 1072



to top

>gb|AY395632.1| Dicentrarchus labrax HSP-90 mRNA, complete cds
          Length = 2265

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||  ||||||| ||||||||||| ||  ||||||||||||||||||| || 
Sbjct: 989  ttctacaagagtctgaccaacgactgggaggatcacctggctgtcaagcacttctcggtg 1048

                            
Query: 217  gagggtcagcttgagt 232
            ||||| ||||| ||||
Sbjct: 1049 gagggccagctcgagt 1064



to top

>gb|AY226081.1| Monosiga brevicollis 90-kDa heat-shock protein (hsp90) mRNA,
           partial cds
          Length = 2264

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| | ||||| ||||||||||| ||  | || |||||||||||||| |||
Sbjct: 832 ttctacaagagcctcaccaacgactgggaggatcaccttgccgtcaagcacttctccgtt 891

                           
Query: 217 gagggtcagcttgagt 232
           ||||||||||| ||||
Sbjct: 892 gagggtcagctcgagt 907



to top

>gb|AY236716.1| Prymnesium patelliferum heat shock protein 90 (Hsp90) gene, partial
           cds
          Length = 857

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 111/136 (81%)
 Strand = Plus / Plus

                                                                       
Query: 97  aagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtatgctgct 156
           ||||||||||||||||||| | | ||||| |||||| | |  ||||| ||||| |  || 
Sbjct: 370 aagcagaagcctatctggacgcgcaagcccgaggaggtgacgaaggaggagtacggcgcg 429

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||  | |  |||| ||||||||||||||  | || |||||||||||||| || 
Sbjct: 430 ttctacaaggccctctccaacgactgggaggagcaccttgcggtcaagcacttctccgtc 489

                           
Query: 217 gagggtcagcttgagt 232
           ||||||||||||||||
Sbjct: 490 gagggtcagcttgagt 505



to top

>emb|X03811.1|DSHSP82 Drosophila simulans gene fragment for heat shock protein hsp 82
          Length = 3072

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||  | ||||||| ||||||||||| ||| |||| |||||||||||||| || 
Sbjct: 2836 ttctacaagtccctgaccaacgactgggaggatcatctggccgtcaagcacttctccgtg 2895

                            
Query: 217  gagggtcagcttgagt 232
            ||||||||||| ||||
Sbjct: 2896 gagggtcagctggagt 2911



to top

>dbj|AB196458.1| Oncorhynchus mykiss HSP90BB mRNA for heat shock 90kDa protein 1 beta
            isoform b, complete cds
          Length = 2694

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| ||||||||||||||||||| ||  | || |||||||||||||| || 
Sbjct: 957  ttctacaagagcctgaccaatgactgggaggaccaccttgcagtcaagcacttctcagtg 1016

                            
Query: 217  gagggtcagcttgagt 232
            ||||| ||||| ||||
Sbjct: 1017 gagggccagctggagt 1032



to top

>gb|AF135117.1|AF135117 Salmo salar heat shock protein hsp90 beta (hsp90 beta) mRNA, complete
            cds
          Length = 2625

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| ||||||| ||||||||||| ||  |||||||||||||||| || || 
Sbjct: 986  ttctacaagagcctgaccaacgactgggaggaacacctggctgtcaagcacttttcagtg 1045

                            
Query: 217  gagggtcagcttgagt 232
            ||||| ||||| ||||
Sbjct: 1046 gagggccagctggagt 1061



to top

>gb|U81165.1|PAU81165 Podospora anserina suppressor of vegetative incompatibility MOD-E
            (mod-E) gene, complete cds
          Length = 3480

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                        
Query: 173  ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||| ||||||||||| ||  | || ||||||||||||||||||||||||||||||||||
Sbjct: 1823 ccaacgactgggaggaccacctcgccgtcaagcacttctctgttgagggtcagcttgagt 1882



to top

>gb|L32987.1|SMRHSC90R Pleurodeles waltlii 90kDa heat shock protein (HSC90) mRNA, partial
           cds
          Length = 2093

 Score = 71.9 bits (36), Expect = 8e-10
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| ||||||| ||||||||||| ||  |||| |||||||||||||| || 
Sbjct: 364 ttctacaagagcctgaccaacgactgggaggaccacctggccgtcaagcacttctcggtg 423

                           
Query: 217 gagggtcagcttgagt 232
           ||||| ||||| ||||
Sbjct: 424 gagggccagctcgagt 439



to top

>gb|AY724481.1| Rattus norvegicus clone UI-R-FJ0-cpu-m-19-0-UI unknown mRNA
          Length = 2461

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
           |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 926 ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 984



to top

>gb|BC082009.1| Rattus norvegicus cDNA clone MGC:94263 IMAGE:7131767, complete cds
          Length = 2510

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 981  ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 1039



to top

>emb|CR729074.1|CNS0GPI0 Tetraodon nigroviridis full-length cDNA
          Length = 1656

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 12  tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 71

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 72  ggccaacttga 82



to top

>emb|CR725456.2|CNS0GMPI Tetraodon nigroviridis full-length cDNA
          Length = 1872

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 212 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 271

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 272 ggccaacttga 282



to top

>emb|CR724678.2|CNS0GM3W Tetraodon nigroviridis full-length cDNA
          Length = 1866

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 205 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 264

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 265 ggccaacttga 275



to top

>emb|CR707681.2|CNS0G8ZX Tetraodon nigroviridis full-length cDNA
          Length = 1020

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 888 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 947

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 948 ggccaacttga 958



to top

>emb|CR682196.2|CNS0FPC0 Tetraodon nigroviridis full-length cDNA
          Length = 1892

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 240 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 299

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 300 ggccaacttga 310



to top

>emb|CR655460.2|CNS0F4Q2 Tetraodon nigroviridis full-length cDNA
          Length = 1125

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 101 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 160

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 161 ggccaacttga 171



to top

>emb|CR642933.2|CNS0EV23 Tetraodon nigroviridis full-length cDNA
          Length = 1219

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 83  tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 142

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 143 ggccaacttga 153



to top

>emb|CR643737.2|CNS0EVOF Tetraodon nigroviridis full-length cDNA
          Length = 1306

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 167 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 226

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 227 ggccaacttga 237



to top

>emb|CR634580.2|CNS0EOM2 Tetraodon nigroviridis full-length cDNA
          Length = 1678

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 539 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 598

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 599 ggccaacttga 609



to top

>ref|NM_001004082.2| Rattus norvegicus heat shock 90kDa protein 1, beta (Hspcb), mRNA
          Length = 2524

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 987  ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 1045



to top

>gb|DQ022068.2| Rattus norvegicus 84 kDa heat shock protein (hsp84) gene, promoter
            region and complete cds
          Length = 3923

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 2408 ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 2466



to top

>emb|X07265.1|GGHSPAA Chicken mRNA for 90kDa heat shock protein
          Length = 2835

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | || |||||||||||||| || ||||||||||| ||||||||||| 
Sbjct: 941  ttctataagagcctaactaatgactgggaggaccacttggctgtcaaacacttctctgtg 1000

                       
Query: 217  gagggtcagct 227
            || ||||||||
Sbjct: 1001 gaaggtcagct 1011



to top

>emb|X03810.1|DMHSP82 Drosophila melanogaster gene for heat shock protein hsp 82
          Length = 5024

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 3056 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 3115

               
Query: 230  agt 232
            |||
Sbjct: 3116 agt 3118



to top

>emb|X00065.1|DMHS83 Drosophila melanogaster 5'end of heat shock gene hsp83
          Length = 3292

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 3069 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 3128

               
Query: 230  agt 232
            |||
Sbjct: 3129 agt 3131



to top

>gb|AY695393.1| Rattus norvegicus strain SS/JrHsdMcwi heat shock protein 90 (Hsp90)
            mRNA, complete cds
          Length = 2326

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 943  ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 1001



to top

>gb|AY695392.1| Rattus norvegicus strain BN/NHsdMcwi heat shock protein 90 (Hsp90)
            mRNA, complete cds
          Length = 2338

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 955  ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 1013



to top

>gb|AY122080.1| Drosophila melanogaster AT20544 full insert cDNA
          Length = 2932

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1243 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1302

               
Query: 230  agt 232
            |||
Sbjct: 1303 agt 1305



to top

>gb|AC097725.2| Drosophila melanogaster 3L BAC RP98-48E19 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 176521

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                          
Query: 170    tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
              ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 138399 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 138458

                 
Query: 230    agt 232
              |||
Sbjct: 138459 agt 138461



to top

>gb|AC024568.6| Homo sapiens chromosome 5 clone CTD-2179L22, complete sequence
          Length = 128501

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                        
Query: 157   ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
             |||||||||||||| |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 79054 ttctacaagagcttcaccagtgactaggaagaccatttggcagtcaagcacttctctgt 79112



to top

>ref|NM_079175.2| Drosophila melanogaster Heat shock protein 83 CG1242-RA (Hsp83), mRNA
          Length = 2904

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1243 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1302

               
Query: 230  agt 232
            |||
Sbjct: 1303 agt 1305



to top

>gb|S45392.1| heat shock protein 90 [rats, brain, mRNA, 2524 nt]
          Length = 2524

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||| | |||||||||||||| || || ||||| |||||||||||||||||
Sbjct: 987  ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttctctgt 1045



to top

>gb|AC008493.5| Homo sapiens chromosome 5 clone CTC-427G18, complete sequence
          Length = 107137

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
            |||||||||||||| |||| ||||| ||| || |||||||| |||||||||||||||||
Sbjct: 7396 ttctacaagagcttcaccagtgactaggaagaccatttggcagtcaagcacttctctgt 7338



to top

>dbj|AB196477.1| Sarcophaga similis Hsp83 mRNA for heat-shock protein 83, partial
           cds
          Length = 680

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttga 230
           |||||||||||||| || ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 525 accaatgactgggaagatcatttggctgtaaagcacttctccgttgaaggtcaacttga 583



to top

>dbj|AK177162.1| Mus musculus cDNA, clone:Y0G0101N05, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000024739, based on BLAT search
          Length = 228

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgt 215
           ||||| |||||| | ||||||||||||||||| || ||||| |||||||||||||||||
Sbjct: 128 ttctataagagcctcaccaatgactgggaggaccacttggcagtcaagcacttctctgt 186



to top

>gb|AY729862.1| Pythium graminicola heat shock protein 90 gene, partial cds
          Length = 1716

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 178 gactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||||||||||||||  | ||||||||||||||||| ||||| |||||||||||||
Sbjct: 817 gactgggaggagcacctcgctgtcaagcacttctcggttgaaggtcagcttgagt 871



to top

>gb|AE003477.3| Drosophila melanogaster chromosome 3L, section 11 of 83 of the complete
              sequence
          Length = 297894

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                          
Query: 170    tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
              ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 124521 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 124580

                 
Query: 230    agt 232
              |||
Sbjct: 124581 agt 124583



to top

>gb|U57473.1|DMU57473 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57472.1|DMU57472 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57471.1|DMU57471 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57470.1|DMU57470 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57469.1|DMU57469 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57468.1|DMU57468 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57467.1|DMU57467 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1382

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1171 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1230

               
Query: 230  agt 232
            |||
Sbjct: 1231 agt 1233



to top

>gb|U57466.1|DMU57466 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57465.1|DMU57465 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57464.1|DMU57464 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57463.1|DMU57463 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57462.1|DMU57462 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57461.1|DMU57461 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57460.1|DMU57460 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|U57459.1|DMU57459 Drosophila melanogaster heat shock protein 83 (Hsp83) gene, partial
            cds
          Length = 1385

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                        
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
            ||||||| ||||||||||| ||| |||| |||||||||||||| || ||||||||||| |
Sbjct: 1174 tgaccaacgactgggaggatcatctggccgtcaagcacttctccgtggagggtcagctgg 1233

               
Query: 230  agt 232
            |||
Sbjct: 1234 agt 1236



to top

>gb|AY459430.1| Eimeria acervulina isolate 12 heat shock protein 90 (Hsp90) gene,
            complete cds
          Length = 3898

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                      
Query: 175  aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||| ||||| |||||||||||||| |||||||||  ||||||||||||||| ||||
Sbjct: 1205 aatgattgggaagagcatttggctgtgaagcacttcagtgttgagggtcagctcgagt 1262



 Score = 46.1 bits (23), Expect = 0.048
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 94   aacaagcagaagcctatctggatgaggaagccagaggag 132
            ||||||||||||||| | |||||| | ||||||||||||
Sbjct: 1124 aacaagcagaagcctctgtggatgcgcaagccagaggag 1162



to top

>gb|BC075757.1| Danio rerio heat shock protein 90-alpha, mRNA (cDNA clone MGC:86652
            IMAGE:6894022), complete cds
          Length = 2499

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            |||||||| || | ||||||||||||||| || |||||||||||||| ||||| ||||||
Sbjct: 1005 tacaagagtttaagcaatgactgggaggatcacttggctgtcaagcatttctcagttgag 1064

              
Query: 220  gg 221
            ||
Sbjct: 1065 gg 1066



to top

>ref|NM_131328.1| Danio rerio heat shock protein 90-alpha (hsp90a), mRNA
          Length = 2482

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            |||||||| || | ||||||||||||||| || |||||||||||||| ||||| ||||||
Sbjct: 988  tacaagagtttaagcaatgactgggaggatcacttggctgtcaagcatttctcagttgag 1047

              
Query: 220  gg 221
            ||
Sbjct: 1048 gg 1049



to top

>emb|CR651823.2|CNS0F1X1 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 884 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 943

             
Query: 220 gg 221
           ||
Sbjct: 944 gg 945



to top

>emb|CR633567.2|CNS0ENTX Tetraodon nigroviridis full-length cDNA
          Length = 2021

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| |||| ||||||||||| ||||| |||
Sbjct: 888 tacaaaagcctgaccaatgattgggaggagcatctggcggtcaagcacttttctgtggag 947

             
Query: 220 gg 221
           ||
Sbjct: 948 gg 949



to top

>ref|XM_682791.1| PREDICTED: Danio rerio similar to heat shock protein 90-alpha
           (LOC559452), mRNA
          Length = 2930

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           |||||||| || | ||||||||||||||| || |||||||||||||| ||||| ||||||
Sbjct: 849 tacaagagtttaagcaatgactgggaggatcacttggctgtcaagcatttctcagttgag 908

             
Query: 220 gg 221
           ||
Sbjct: 909 gg 910



 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| ||||||||||| ||| ||||||| |||||||| || || || 
Sbjct: 2709 tacaagagcctgaccaacgactgggaggatcatctggctgttaagcacttttcagtggaa 2768

                    
Query: 220  ggtcagct 227
            ||||||||
Sbjct: 2769 ggtcagct 2776



to top

>gb|AY459429.1| Eimeria acervulina clone 62 heat shock protein 90 (Hsp90) mRNA,
            complete cds
          Length = 2653

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                      
Query: 175  aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||| ||||| |||||||||||||| |||||||||  ||||||||||||||| ||||
Sbjct: 1034 aatgattgggaagagcatttggctgtgaagcacttcagtgttgagggtcagctcgagt 1091



 Score = 46.1 bits (23), Expect = 0.048
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 94  aacaagcagaagcctatctggatgaggaagccagaggag 132
           ||||||||||||||| | |||||| | ||||||||||||
Sbjct: 953 aacaagcagaagcctctgtggatgcgcaagccagaggag 991



to top

>gb|AY335224.1| Drosophila saltans heat shock protein 83 (Hsp83) gene, partial cds
          Length = 1065

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcag 225
           ||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 892 accaacgattgggaagatcatttggctgtcaagcatttctctgttgagggtcag 945



to top

>gb|AF068773.1|AF068773 Danio rerio heat shock protein hsp90alpha mRNA, complete cds
          Length = 2482

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            |||||||| || | ||||||||||||||| || |||||||||||||| ||||| ||||||
Sbjct: 988  tacaagagtttaagcaatgactgggaggatcacttggctgtcaagcatttctcagttgag 1047

              
Query: 220  gg 221
            ||
Sbjct: 1048 gg 1049



to top

>dbj|AB043677.1| Equus caballus Hsp90 alpha mRNA for heat shock protein 90 alpha,
           partial cds
          Length = 2157

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           ||||||||||||||||||||||||||||| || || ||||| || |||||||| || |||
Sbjct: 904 ttctacaagagcttgaccaatgactgggaagatcacttggcagtgaagcacttttcagtt 963

             
Query: 217 ga 218
           ||
Sbjct: 964 ga 965



to top

>gb|AY651252.1| Rhynchobodo ATCC50359 heat shock protein 90 gene, partial cds
          Length = 1897

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                       
Query: 128 aggagatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgggagg 187
           |||| |||| |||||| ||||| ||||| |||||||||  | |  |||| ||||||||||
Sbjct: 732 aggacatcaccaaggaggagtacgctgccttctacaaggccatctccaacgactgggagg 791

                                                        
Query: 188 agcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||||  | |  |||||||||||||| || ||||||||||||||||
Sbjct: 792 agcacctcggcgtcaagcacttctccgtggagggtcagcttgagt 836



to top

>gb|AY785160.1| Xenopus laevis Hsp90beta mRNA, complete cds
          Length = 3051

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                        
Query: 140  aggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctg 199
            ||||||||||||  |  |||||||||||  ||||||||||||||||||| ||  ||||||
Sbjct: 942  aggaagagtatggagagttctacaagagtctgaccaatgactgggaggatcacctggctg 1001

                                             
Query: 200  tcaagcacttctctgttgagggtcagcttgagt 232
            | ||||| |||||||| || || ||||| ||||
Sbjct: 1002 taaagcatttctctgtggaagggcagctggagt 1034



to top

>gb|DQ198859.1| Sesamia nonagrioides 90 kDa heat shock protein 83 (hsp83) mRNA,
           partial cds
          Length = 903

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtca 224
           |||||||||||||| || ||| | ||||||||||||||||||||||| |||||
Sbjct: 10  accaatgactgggaagatcatcttgctgtcaagcacttctctgttgaaggtca 62



to top

>gb|AY383484.1| Equus caballus heat shock protein 90 (Hsp90) mRNA, complete cds
          Length = 2568

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||  | |||||||||||||| || || ||||| ||||||||||||||||| 
Sbjct: 1014 ttctacaagagtcttaccaatgactgggaagaccacttggcagtcaagcacttctctgta 1073

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1074 gaaggtcag 1082



to top

>gb|BC077195.1| Xenopus laevis heat shock 90kDa protein beta, mRNA (cDNA clone
            MGC:78910 IMAGE:4175543), complete cds
          Length = 3068

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                        
Query: 140  aggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctg 199
            ||||||||||||  |  |||||||||||  ||||||||||||||||||| ||  ||||||
Sbjct: 934  aggaagagtatggagagttctacaagagtctgaccaatgactgggaggatcacctggctg 993

                                             
Query: 200  tcaagcacttctctgttgagggtcagcttgagt 232
            | ||||| |||||||| || || ||||| ||||
Sbjct: 994  taaagcatttctctgtggaagggcagctggagt 1026



to top

>gb|BC073535.1| Xenopus laevis heat shock 90kDa protein beta, mRNA (cDNA clone
           IMAGE:5440230)
          Length = 2984

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 140 aggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctg 199
           ||||||||||||  |  |||||||||||  ||||||||||||||||||| ||  ||||||
Sbjct: 882 aggaagagtatggagagttctacaagagtctgaccaatgactgggaggatcacctggctg 941

                                            
Query: 200 tcaagcacttctctgttgagggtcagcttgagt 232
           | ||||| |||||||| || || ||||| ||||
Sbjct: 942 taaagcatttctctgtggaagggcagctggagt 974



to top

>ref|XM_777937.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 90-alpha (LOC577725), mRNA
          Length = 1639

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                        
Query: 172  accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgag 231
            |||||||| ||||| || |||||||| ||||||||||||||||| || || |||||||||
Sbjct: 1046 accaatgattgggaagatcatttggccgtcaagcacttctctgtggaagggcagcttgag 1105

             
Query: 232  t 232
            |
Sbjct: 1106 t 1106



to top

>emb|AL110469.1|SPAC926 S.pombe chromosome I cosmid c926
          Length = 23193

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 138  caaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggc 197
            |||||||||||||||  |||||||||||   ||||| || |||||||| || ||||||||
Sbjct: 6132 caaggaagagtatgcctctttctacaagtctttgactaacgactgggaagaccatttggc 6073

                         
Query: 198  tgtcaagcacttc 210
             ||||||||||||
Sbjct: 6072 cgtcaagcacttc 6060



to top

>emb|CR860313.1| Pongo pygmaeus mRNA; cDNA DKFZp459I055 (from clone DKFZp459I055)
          Length = 2530

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| | |||||||||||||| || || ||||| ||||||||||| ||||| 
Sbjct: 1001 ttctacaagagcctcaccaatgactgggaagaccacttggcagtcaagcacttttctgta 1060

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1061 gaaggtcag 1069



to top

>dbj|AK146809.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920059K05 product:heat shock protein 1,
            beta, full insert sequence
          Length = 2480

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            ||||| |||||| | ||||||||||||||||| || |||||  |||||||||||||||| 
Sbjct: 977  ttctataagagcctcaccaatgactgggaggaccacttggcaatcaagcacttctctgta 1036

                     
Query: 217  gagggtcag 225
            || ||||||
Sbjct: 1037 gaaggtcag 1045



to top

>gb|DQ295223.1| Trimastix marina cytosolic heat shock protein 90 (HSP90) gene,
            partial cds
          Length = 1949

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 138  caaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggc 197
            |||||||||||||||||| |||||||||||| |  |||| || ||||| || ||||||||
Sbjct: 965  caaggaagagtatgctgccttctacaagagcatctccaacgattgggaagatcatttggc 1024

                         
Query: 198  tgtcaagcacttc 210
             || |||||||||
Sbjct: 1025 cgtgaagcacttc 1037



to top

>ref|NM_001019786.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC926.04c),
           partial mRNA
          Length = 2115

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 138 caaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggc 197
           |||||||||||||||  |||||||||||   ||||| || |||||||| || ||||||||
Sbjct: 840 caaggaagagtatgcctctttctacaagtctttgactaacgactgggaagaccatttggc 899

                        
Query: 198 tgtcaagcacttc 210
            ||||||||||||
Sbjct: 900 cgtcaagcacttc 912



to top

>gb|AF254880.1|AF254880 Spodoptera frugiperda 90-kDa heat shock protein HSP83 (hsp83) mRNA,
            complete cds
          Length = 2470

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                        
Query: 172  accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgag 231
            ||||||||||||||||| ||  | |||||||| |||||||||||||| |||||||| |||
Sbjct: 1077 accaatgactgggaggaccaccttgctgtcaaacacttctctgttgaaggtcagctggag 1136

             
Query: 232  t 232
            |
Sbjct: 1137 t 1137



to top

>gb|L35550.1|YSPHSP90X Schizosaccharomyces pombe heat shock protein 90 (Hsp90) gene,
            complete cds
          Length = 2535

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 138  caaggaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggc 197
            |||||||||||||||  |||||||||||   ||||| || |||||||| || ||||||||
Sbjct: 1245 caaggaagagtatgcctctttctacaagtctttgactaacgactgggaagaccatttggc 1304

                         
Query: 198  tgtcaagcacttc 210
             ||||||||||||
Sbjct: 1305 cgtcaagcacttc 1317



to top

>dbj|AB043676.1| Equus caballus Hsp90beta mRNA for heat shock protein 90 beta,
           partial cds
          Length = 2139

 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||  | |||||||||||||| || || ||||| ||||||||||||||||| 
Sbjct: 886 ttctacaagagtcttaccaatgactgggaagaccacttggcagtcaagcacttctctgta 945

                    
Query: 217 gagggtcag 225
           || ||||||
Sbjct: 946 gaaggtcag 954



to top

>gb|AF384807.1| Cryptococcus bacillisporus heat-shock protein 90 gene, complete cds
          Length = 3957

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                        
Query: 173  ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||| ||||||||||| ||  | || ||||||||||||||||||||||||||||| ||||
Sbjct: 1988 ccaacgactgggaggaccaccttgccgtcaagcacttctctgttgagggtcagctcgagt 2047



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 92   tcaacaagcagaagcctatctgga 115
            |||||||||||||||| |||||||
Sbjct: 1849 tcaacaagcagaagcccatctgga 1872



to top

>emb|X70101.1|GGHSP90B G.gallus hsp 90 beta mRNA for heat shock protein 90 beta
          Length = 2633

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctc 212
           |||||||| ||| | ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 913 ttctacaaaagcctcaccaatgactgggaggaccacttggcagtcaagcacttctc 968



to top

>emb|X03813.1|DVHSP82 Drosophila virilis gene fragment for heat shock protein hsp 82
          Length = 2889

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 169  ttgaccaatgactgggaggagcatttggctgtcaagcacttctc 212
            |||||||| ||||||||||| |||||||| ||||||||||||||
Sbjct: 2665 ttgaccaacgactgggaggaccatttggccgtcaagcacttctc 2708



to top

>gb|AY550117.1| Megachile rotundata 90 kDa heat shock protein (HSP90) mRNA, partial
           cds
          Length = 708

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||||||||||| || ||||| || ||| |||||||||| || |||||||| 
Sbjct: 519 ttctacaagagcttgaccaacgattgggaagatcatctggctgtcaaacatttctctgta 578

                   
Query: 217 gagggtca 224
           || |||||
Sbjct: 579 gaaggtca 586



to top

>ref|NM_206959.1| Gallus gallus heat shock 90kDa protein 1, beta (HSPCB), mRNA
          Length = 2633

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctc 212
           |||||||| ||| | ||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 913 ttctacaaaagcctcaccaatgactgggaggaccacttggcagtcaagcacttctc 968



to top

>dbj|AB226298.1| Aspergillus oryzae cDNA, contig sequence: AoEST3160
          Length = 2622

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                        
Query: 173  ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||||||||||||||| ||  | || |||||||||||||| |||||||||||||| ||||
Sbjct: 1032 ccaatgactgggaggatcaccttgccgtcaagcacttctccgttgagggtcagctcgagt 1091



to top

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                           
Query: 173     ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
               |||||||||||||||| ||  | || |||||||||||||| |||||||||||||| ||||
Sbjct: 1685168 ccaatgactgggaggatcaccttgccgtcaagcacttctccgttgagggtcagctcgagt 1685227



to top

>gb|AF421541.1| Crypthecodinium cohnii Hsp90 mRNA, complete cds
          Length = 2540

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| |  |||| ||||||||||| || |||||||| |||||||||  ||| 
Sbjct: 936  ttctacaagagcctttccaacgactgggaggaccacttggctgtgaagcacttcagtgtc 995

                            
Query: 217  gagggtcagcttgagt 232
            ||||||||||| ||||
Sbjct: 996  gagggtcagctcgagt 1011



to top

>ref|XM_704119.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
            (HSP 86), transcript variant 3 (LOC565155), mRNA
          Length = 2520

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| ||||||||||| ||| ||||||| |||||||| || || || 
Sbjct: 1074 tacaagagcctgaccaacgactgggaggatcatctggctgttaagcacttttcagtggaa 1133

                    
Query: 220  ggtcagct 227
            ||||||||
Sbjct: 1134 ggtcagct 1141



to top

>ref|XM_683871.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
            (HSP 86), transcript variant 1 (LOC565155), mRNA
          Length = 2562

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| ||||||||||| ||| ||||||| |||||||| || || || 
Sbjct: 1035 tacaagagcctgaccaacgactgggaggatcatctggctgttaagcacttttcagtggaa 1094

                    
Query: 220  ggtcagct 227
            ||||||||
Sbjct: 1095 ggtcagct 1102



to top

>ref|XM_704118.1| PREDICTED: Danio rerio similar to Heat shock protein HSP 90-alpha
            (HSP 86), transcript variant 2 (LOC565155), mRNA
          Length = 2601

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 160  tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
            ||||||||| ||||||| ||||||||||| ||| ||||||| |||||||| || || || 
Sbjct: 1074 tacaagagcctgaccaacgactgggaggatcatctggctgttaagcacttttcagtggaa 1133

                    
Query: 220  ggtcagct 227
            ||||||||
Sbjct: 1134 ggtcagct 1141



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                          
Query: 173    ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
              |||| ||||||||||| |  |||||||||||||||||||| || ||||||||||| ||||
Sbjct: 157459 ccaacgactgggaggacccattggctgtcaagcacttctcggtcgagggtcagctagagt 157400



to top

>gb|DQ340384.1| Oscheius myriophila heat shock protein 90 (Hsp90) gene, partial cds
          Length = 875

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| || |||| ||||||||||| ||  | || |||||||||||||| || 
Sbjct: 684 ttctacaagagcctgtccaacgactgggaggaccacctcgccgtcaagcacttctccgtc 743

                           
Query: 217 gagggtcagcttgagt 232
           ||||||||||| ||||
Sbjct: 744 gagggtcagctcgagt 759



to top

>gb|AY754522.1| Drosophila affinis heat shock protein 83 (Hsp83) gene, exon 1 and
           partial cds
          Length = 1065

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||  |||||| || ||||||||||| ||| ||  ||| ||||||||||| |||
Sbjct: 871 ttctacaagtccttgactaacgactgggaggatcatctgtgtgtgaagcacttctcggtt 930

                           
Query: 217 gagggtcagcttgagt 232
           ||||||||||| ||||
Sbjct: 931 gagggtcagctggagt 946



to top

>gb|AY928608.1| Paracoccidioides brasiliensis heat shock protein 90 (HSP90) mRNA,
            complete cds
          Length = 3055

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 173  ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtca 224
            |||||||||||||||| ||| | ||||||||||||||||| ||||| |||||
Sbjct: 1201 ccaatgactgggaggaccatcttgctgtcaagcacttctccgttgaaggtca 1252



to top

>ref|NM_210756.1| Eremothecium gossypii AFL148Cp (AFL148C), mRNA
          Length = 2115

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 173 ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           |||| ||||||||||| |  |||||||||||||||||||| || ||||||||||| ||||
Sbjct: 875 ccaacgactgggaggacccattggctgtcaagcacttctcggtcgagggtcagctagagt 934



to top

>gb|DQ206514.1| Priapulus caudatus isolate TOA67 heat shock 90 kDa protein mRNA,
           partial cds
          Length = 1722

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgt 215
           |||||||| |||||||| || |||||||||||||||||||||||
Sbjct: 862 accaatgattgggaggatcacttggctgtcaagcacttctctgt 905



to top

>emb|X03812.1|DPHSP82 Drosophila pseudoobscura gene for heat shock protein hsp 82
          Length = 3189

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||  ||||||||| ||||||||||| ||| ||  ||| ||||||||||| || 
Sbjct: 2953 ttctacaagtccttgaccaacgactgggaggatcatctgtgtgtgaagcacttctcagtc 3012

                            
Query: 217  gagggtcagcttgagt 232
            ||||||||||| ||||
Sbjct: 3013 gagggtcagctggagt 3028



to top

>gb|AF431814.1| Eremothecium gossypii heat shock protein (HSP82) gene, complete cds;
            CIN2 gene, partial sequence; and IQGAP-like protein
            (CYK1) gene, complete cds
          Length = 9312

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                        
Query: 173  ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
            |||| ||||||||||| |  |||||||||||||||||||| || ||||||||||| ||||
Sbjct: 1318 ccaacgactgggaggacccattggctgtcaagcacttctcggtcgagggtcagctagagt 1377



to top

>gb|AY391259.1| Perkinsus marinus heat shock protein 90 gene, partial cds
          Length = 1877

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 37/39 (94%)
 Strand = Plus / Plus

                                                   
Query: 194  tggctgtcaagcacttctctgttgagggtcagcttgagt 232
            ||||||||||||||||| |||||||||||||||| ||||
Sbjct: 994  tggctgtcaagcacttcgctgttgagggtcagctcgagt 1032



to top

>ref|XM_742833.1| Aspergillus fumigatus Af293 molecular chaperone HSP90 (Afu5g04170)
           partial mRNA
          Length = 2121

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 178 gactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||||||||||| ||| | |||||||| ||||||||||| ||||||||||| ||||
Sbjct: 886 gactgggaggaccatcttgctgtcaaacacttctctgtcgagggtcagctcgagt 940



to top

>emb|CR731669.1| Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 160 tacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgag 219
           ||||| ||| |||||||||| |||||||||||| | || ||||||||||| ||||| |||
Sbjct: 28  tacaaaagcctgaccaatgattgggaggagcatcttgcggtcaagcacttttctgtggag 87

                      
Query: 220 ggtcagcttga 230
           || || |||||
Sbjct: 88  ggccaacttga 98



to top

>emb|CR646339.2|CNS0EXOP Tetraodon nigroviridis full-length cDNA
          Length = 1289

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||| | ||||| ||||||||||| ||  |||||||||||||||| || || 
Sbjct: 993  ttctacaagagcctcaccaacgactgggaggatcacctggctgtcaagcacttgtcagtg 1052

                       
Query: 217  gagggtcagct 227
            || ||||||||
Sbjct: 1053 gaaggtcagct 1063



to top

>gb|U92465.1|AFU92465 Aspergillus fumigatus heat shock protein (Hsp1) mRNA, partial cds
          Length = 1649

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 178 gactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||||||||||| ||| | |||||||| ||||||||||| ||||||||||| ||||
Sbjct: 91  gactgggaggaccatcttgctgtcaaacacttctctgtcgagggtcagctcgagt 145



to top

>dbj|AB118970.1| Lucilia sericata Hsp90 mRNA for heat shock protein 90, partial cds
          Length = 334

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttga 230
           ||||| || ||||| || ||||||||||||||||||||||| ||||| ||||| |||||
Sbjct: 179 accaacgattgggaagatcatttggctgtcaagcacttctccgttgaaggtcaacttga 237



to top

>gb|AY603516.1| Zeldia punctata heat shock protein 90 gene, partial cds
          Length = 255

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 124 ccagaggagatcaacaaggaagagtatgctgctttctacaagagcttgaccaatgactgg 183
           ||||| || |||| ||| ||||| ||||| |  |||||||||||||| | ||| ||||||
Sbjct: 31  ccagatgatatcagcaatgaagaatatgccgagttctacaagagcttaagcaacgactgg 90

                                              
Query: 184 gaggagcatttggctgtcaagcacttctctgttga 218
           || || ||||||||||| || || |||||||||||
Sbjct: 91  gaagaccatttggctgtgaaacatttctctgttga 125



to top

>ref|NM_175761.2| Rattus norvegicus heat shock protein 1, alpha (Hspca), mRNA
          Length = 2795

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||||| ||||| |||||||| || |||||||| || ||||| || ||||||
Sbjct: 995  ttctacaagagcttaaccaacgactgggaagaacatttggcagtaaagcatttttctgtt 1054

              
Query: 217  ga 218
            ||
Sbjct: 1055 ga 1056



to top

>gb|BC085120.1| Rattus norvegicus heat shock protein 1, alpha, mRNA (cDNA clone
            MGC:105293 IMAGE:7114546), complete cds
          Length = 2785

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||||| ||||| |||||||| || |||||||| || ||||| || ||||||
Sbjct: 977  ttctacaagagcttaaccaacgactgggaagaacatttggcagtaaagcatttttctgtt 1036

              
Query: 217  ga 218
            ||
Sbjct: 1037 ga 1038



to top

>gb|BC072489.1| Rattus norvegicus heat shock protein 1, alpha, mRNA (cDNA clone
            MGC:91423 IMAGE:7105514), complete cds
          Length = 2795

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||||| ||||| |||||||| || |||||||| || ||||| || ||||||
Sbjct: 977  ttctacaagagcttaaccaacgactgggaagaacatttggcagtaaagcatttttctgtt 1036

              
Query: 217  ga 218
            ||
Sbjct: 1037 ga 1038



to top

>gb|DQ459547.1| Belgica antarctica heat shock protein 90 (hsp90) mRNA, partial cds
          Length = 710

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           ||||||||||| |||||||| |||||||| || |||||||| || ||||| ||||| |||
Sbjct: 520 ttctacaagagtttgaccaacgactgggaagatcatttggccgtgaagcatttctcggtt 579

             
Query: 217 ga 218
           ||
Sbjct: 580 ga 581



to top

>gb|AF461150.2| Heterodera glycines Hsp90 mRNA, complete cds
          Length = 2247

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 892 ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 941



to top

>gb|AF548366.1| Capra hircus heat shock protein-90 mRNA, partial cds
          Length = 847

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           |||||||||||| ||||||| ||||||||||| || ||||| ||||||||
Sbjct: 341 ttctacaagagcctgaccaacgactgggaggaccacttggcggtcaagca 390



to top

>emb|AJ428213.1|RNO428213 Rattus norvegicus hsp86 gene for heat shock protein 86
          Length = 2795

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
            |||||||||||||| ||||| |||||||| || |||||||| || ||||| || ||||||
Sbjct: 995  ttctacaagagcttaaccaacgactgggaagaacatttggcagtaaagcatttttctgtt 1054

              
Query: 217  ga 218
            ||
Sbjct: 1055 ga 1056



to top

>dbj|AB169853.1| Macaca fascicularis brain cDNA, clone: QtrA-10430, similar to human
            heat shock 90kDa protein 1, alpha (HSPCA), mRNA, RefSeq:
            NM_005348.2
          Length = 2958

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
            ||||||||||||||||||||||||||||| || || ||||| || |||||
Sbjct: 996  ttctacaagagcttgaccaatgactgggaagatcacttggcagtgaagca 1045



to top

>gb|DQ295221.1| Reclinomonas americana cytosolic heat shock protein 90 (HSP90) gene,
            partial cds
          Length = 2580

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                      
Query: 170  tgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagct 227
            ||||||| |||||||||||||| ||||| |||||||||||| | || ||||| |||||
Sbjct: 1561 tgaccaacgactgggaggagcacttggcagtcaagcacttcgccgtcgagggccagct 1618



to top

>ref|NM_001012670.1| Bos taurus heat shock 90kD protein 1, alpha (HSPCA), mRNA
          Length = 3005

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
            |||||||||||| ||||||| || |||||||| || ||||||||||||||
Sbjct: 1049 ttctacaagagcctgaccaacgattgggaggatcacttggctgtcaagca 1098



to top

>gb|AF457464.1| Heterodera glycines strain TN7 heat shock protein hsp-90 gene,
           partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF457463.1| Heterodera glycines strain OP25 heat shock protein hsp-90 gene,
           partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF449489.1| Heterodera glycines strain TN8 heat shock protein hsp-90 (hsp90)
           gene, partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF449488.1| Heterodera glycines strain TN6 heat shock protein hsp-90 (hsp90)
           gene, partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF449487.1| Heterodera glycines strain TN5 heat shock protein hsp-90 (hsp90)
           gene, partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF449486.1| Heterodera glycines strain NL1-RHp heat shock protein hsp-90 gene,
           partial cds
          Length = 390

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 98  ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 147



to top

>gb|AF449485.2| Heterodera glycines strain OP50 heat shock protein hsp-90 (hsp90)
           gene, partial cds
          Length = 1115

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
           ||||||||||||||| | |||||||||||||| ||| | |||||||||||
Sbjct: 820 ttctacaagagcttgtcaaatgactgggaggaccatcttgctgtcaagca 869



to top

>dbj|AK186456.1| Mus musculus cDNA, clone:Y0G0137G08, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000024739, based on BLAT search
          Length = 172

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttg 229
           ||||||||||||||||| || ||||  |||| |||||||||||| || ||||||||||
Sbjct: 50  accaatgactgggaggaccacttggaagtcacgcacttctctgtagaaggtcagcttg 107



to top

>gb|AY335223.1| Drosophila sucinea heat shock protein 83 (Hsp83) gene, partial cds
          Length = 952

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 168 cttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcag 225
           ||||||||| || |||||||| ||||| ||||| ||||| ||||| ||||||||||||
Sbjct: 814 cttgaccaacgattgggaggatcatttagctgtgaagcatttctccgttgagggtcag 871



to top

>gb|AY335222.1| Drosophila capricorni heat shock protein 83 (Hsp83) gene, partial
           cds
          Length = 1018

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 168 cttgaccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcag 225
           ||||||||| || |||||||| ||||| ||||| ||||| ||||| ||||||||||||
Sbjct: 846 cttgaccaacgattgggaggatcatttagctgtgaagcatttctccgttgagggtcag 903



to top

>dbj|AB072368.1| Bos taurus hsp90alpha mRNA for 90-kDa heat shock protein alpha,
            complete cds
          Length = 3005

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 157  ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagca 206
            |||||||||||| ||||||| || |||||||| || ||||||||||||||
Sbjct: 1049 ttctacaagagcctgaccaacgattgggaggatcacttggctgtcaagca 1098



to top

>gb|AY729863.1| Guillardia theta heat shock protein 90 gene, partial cds
          Length = 1725

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 114/142 (80%)
 Strand = Plus / Plus

                                                                       
Query: 91  gtcaacaagcagaagcctatctggatgaggaagccagaggagatcaacaaggaagagtat 150
           ||||||||||||||||| |||||||   | || || ||||| ||   |||||| || |||
Sbjct: 745 gtcaacaagcagaagcccatctggactcgcaatcctgaggacattcccaaggaggattat 804

                                                                       
Query: 151 gctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttc 210
           || || || ||||||  | | ||||| || |||||||| |||||||| ||||||||||||
Sbjct: 805 gccgccttttacaaggccctcaccaacgattgggaggatcatttggcagtcaagcacttc 864

                                 
Query: 211 tctgttgagggtcagcttgagt 232
              |||||||| ||||||||||
Sbjct: 865 aacgttgagggacagcttgagt 886



to top

>gb|AY729856.1| Isochrysis galbana heat shock protein 90 gene, partial cds
          Length = 1728

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 128/158 (81%), Gaps = 2/158 (1%)
 Strand = Plus / Plus

                                                                       
Query: 76  catgagtggaacttggtcaacaagcagaagcctatctggatgaggaagccagaggagatc 135
           ||||||||| || || | |||||||||||||| ||||||| | ||||||| |||||  | 
Sbjct: 727 catgagtgggacctgatgaacaagcagaagcccatctggacgcggaagcccgaggaagtg 786

                                                                       
Query: 136 aacaaggaagagtatgctgctttctacaagagct-tgaccaatgactgggaggagcattt 194
           | |||||| ||||| |  || ||||||||| ||| |  | ||||| |||||||||||  |
Sbjct: 787 accaaggaggagtacggcgccttctacaag-gctctttcgaatgattgggaggagcacct 845

                                                 
Query: 195 ggctgtcaagcacttctctgttgagggtcagcttgagt 232
           ||| || ||||||||||| || ||||| ||||||||||
Sbjct: 846 ggcggttaagcacttctccgtcgagggccagcttgagt 883



to top

>gb|AY729854.1| Heterosigma akashiwo heat shock protein 90 gene, partial cds
          Length = 1728

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 175 aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagcttgagt 232
           |||||||||||||||||    ||||| |||||||||||||||||||| ||||| ||||
Sbjct: 829 aatgactgggaggagcacgccgctgtaaagcacttctctgttgagggccagctcgagt 886



to top

>gb|U89426.1|MMU89426 Mus musculus strain BALB/c heat shock protein 84 (hsp84) mRNA,
           partial cds
          Length = 388

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 172 accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcag 225
           ||||||||||||||||| || ||||| |||||||||||||| || || ||||||
Sbjct: 113 accaatgactgggaggaccacttggcagtcaagcacttctccgtagaaggtcag 166



to top

>ref|XM_518911.1| PREDICTED: Pan troglodytes similar to Hspcb protein (LOC463195),
           mRNA
          Length = 1616

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 ttctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcacttctctgtt 216
           |||||||||||| | || ||||||||||| || || ||||| ||||||||||| ||||| 
Sbjct: 354 ttctacaagagcctcactaatgactgggaagaccacttggcagtcaagcacttttctgta 413

                    
Query: 217 gagggtcag 225
           || ||||||
Sbjct: 414 gaaggtcag 422



to top

>gb|AY362761.1| Chlamys farreri heat shock protein 90 mRNA, complete cds
          Length = 2710

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 175  aatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcagct 227
            ||||| |||||||| ||||||||||||||||| ||||| || || ||||||||
Sbjct: 1014 aatgattgggaggatcatttggctgtcaagcatttctcagtggaaggtcagct 1066



to top

>gb|AY528900.1| Chiromantes haematocheir hsp-90 mRNA, complete cds
          Length = 2515

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 172  accaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtca 224
            ||||| ||||||||||| ||  |||||||||||||||||  ||||||||||||
Sbjct: 991  accaacgactgggaggaccacctggctgtcaagcacttcagtgttgagggtca 1043



to top

>gb|AF402101.1| Achlya ambisexualis isolate JS855 heat shock protein Hsp90 mRNA,
           complete cds
          Length = 2144

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 142 gaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtc 201
           ||||| ||||||||||||||||||    | ||||| |||||||| || |||   ||||||
Sbjct: 840 gaagaatatgctgctttctacaagtcgctcaccaacgactgggaagaacatgctgctgtc 899

                                        
Query: 202 aagcacttctctgttgagggtcagcttga 230
           ||||||||||| ||||| ||||| |||||
Sbjct: 900 aagcacttctccgttgaaggtcaacttga 928



to top

>gb|AF402100.1| Achlya ambisexualis isolate JS854 heat shock protein Hsp90 mRNA,
           complete cds
          Length = 2153

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 142 gaagagtatgctgctttctacaagagcttgaccaatgactgggaggagcatttggctgtc 201
           ||||| ||||||||||||||||||    | ||||| |||||||| || |||   ||||||
Sbjct: 841 gaagaatatgctgctttctacaagtcgctcaccaacgactgggaagaacatgctgctgtc 900

                                        
Query: 202 aagcacttctctgttgagggtcagcttga 230
           ||||||||||| ||||| ||||| |||||
Sbjct: 901 aagcacttctccgttgaaggtcaacttga 929



to top

>gb|AY288511.1| Euglena gracilis heat shock protein 90 mRNA, partial cds
          Length = 1915

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 173 ccaatgactgggaggagcatttggctgtcaagcacttctctgttgagggtcag 225
           ||||||||||||| || ||||||||||| ||||||||||| || || ||||||
Sbjct: 795 ccaatgactgggaagaccatttggctgtgaagcacttctcggtggaaggtcag 847


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,777,701
Number of Sequences: 3902068
Number of extensions: 1777701
Number of successful extensions: 41650
Number of sequences better than 10.0: 471
Number of HSP's better than 10.0 without gapping: 469
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 40963
Number of HSP's gapped (non-prelim): 666
length of query: 232
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 210
effective length of database: 17,147,199,772
effective search space: 3600911952120
effective search space used: 3600911952120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top