ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet59a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 46 0.030
2ref|NM_123065.1| Arabidopsis thaliana ATCHX24; monovalent cation... 44 0.12
3ref|NM_124017.2| Arabidopsis thaliana ATP binding / nucleoside-t... 44 0.12
4gb|DQ499022.1| Arabidopsis thaliana cation/H+ exchanger (CHX24) ... 44 0.12
5gb|AE012295.1| Xanthomonas campestris pv. campestris str. ATCC 3... 44 0.12
6gb|AC116801.9| Mus musculus chromosome 8, clone RP24-337F7, comp... 44 0.12
7gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 44 0.12
8emb|BX834041.1|CNS09Z50 Arabidopsis thaliana Full-length cDNA Co... 44 0.12
9dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.12
10dbj|AB019223.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.12
11dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 44 0.12
12gb|AC119267.8| Mus musculus chromosome 8, clone RP24-322H19, com... 44 0.12
13gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 44 0.12
14dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 44 0.12
15ref|NM_127820.2| Arabidopsis thaliana SVP (SHORT VEGETATIVE PHAS... 42 0.47
16ref|NM_105945.2| Arabidopsis thaliana ATP binding / transmembran... 42 0.47
17gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 42 0.47
18gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosom... 42 0.47
19gb|AC122118.7| Mus musculus chromosome 18, clone RP24-225P17, co... 42 0.47
20gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosom... 42 0.47
21emb|CT010441.11| Mouse DNA sequence from clone CH29-521N19 on ch... 42 0.47
22gb|AC129078.6| Mus musculus BAC clone RP24-71C5 from chromosome ... 42 0.47
23gb|AC106705.7| Homo sapiens 3 BAC RP11-262L17 (Roswell Park Canc... 42 0.47
24gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl... 42 0.47
25gb|AC121972.2| Mus musculus BAC clone RP24-276H18 from 2, comple... 42 0.47
26gb|AC025540.7| Homo sapiens BAC clone RP11-295N22 from 7, comple... 42 0.47
27gb|AC157942.7| Mus musculus BAC clone RP24-118E2 from chromosome... 42 0.47
28gb|AC111648.6| Rattus norvegicus 2 BAC CH230-103N18 (Children's ... 42 0.47
29gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 0.47
30emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete ... 42 0.47
31emb|BX640431.1| Bordetella parapertussis strain 12822, complete ... 42 0.47
32emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete ... 42 0.47
33emb|AL161492.2|ATCHRIV4 Arabidopsis thaliana DNA chromosome 4, c... 42 0.47
34emb|AL669827.5| Mouse DNA sequence from clone RP23-350D17 on chr... 42 0.47
35gb|AC161757.5| Mus musculus BAC clone RP24-87P2 from chromosome ... 42 0.47
36gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cance... 42 0.47
37gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, comp... 42 0.47
38dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102 42 0.47
39gb|AC006592.6| Arabidopsis thaliana chromosome 2 clone F14M13 ma... 42 0.47
40gb|AC159825.2| Mus musculus BAC clone RP23-100J21 from chromosom... 42 0.47
41gb|AC122406.5| Mus musculus BAC clone RP24-126L14 from chromosom... 42 0.47
42emb|BX816419.1|CNS0ABKT Arabidopsis thaliana Full-length cDNA Co... 42 0.47
43emb|BX842456.1|CNS0A915 Arabidopsis thaliana Full-length cDNA Co... 42 0.47
44emb|BX842440.1|CNS0A8OH Arabidopsis thaliana Full-length cDNA Co... 42 0.47
45emb|BX842431.1|CNS0A8GM Arabidopsis thaliana Full-length cDNA Co... 42 0.47
46gb|AE009471.1| Brucella melitensis 16M chromosome I, section 28 ... 42 0.47
47gb|AF211171.1|AF211171 Arabidopsis thaliana short vegetative pha... 42 0.47
48gb|AF096370.1|F11O4 Arabidopsis thaliana BAC F11O4 42 0.47
49gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 42 0.47
50dbj|AK176273.1| Arabidopsis thaliana mRNA, complete cds, clone: ... 42 0.47
51dbj|AK175241.1| Arabidopsis thaliana mRNA for short vegegative p... 42 0.47
52emb|BX537257.4| Mouse DNA sequence from clone RP23-89C2 on chrom... 42 0.47
53gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cance... 42 0.47
54emb|BX545905.9| Mouse DNA sequence from clone RP23-339J7 on chro... 42 0.47
55emb|BX470181.7| Zebrafish DNA sequence from clone CH211-91P22 in... 42 0.47
56gb|AC154912.3| Mus musculus BAC clone RP23-23B10 from 17, comple... 42 0.47
57gb|AC154401.2| Mus musculus BAC clone RP23-166O7 from 13, comple... 42 0.47
58emb|AL929229.6| Zebrafish DNA sequence from clone CH211-1E14 in ... 42 0.47
59gb|AC008017.2|AC008017 Arabidopsis thaliana chromosome I BAC F3N... 42 0.47
60gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome... 42 0.47
61gb|AC134555.4| Mus musculus BAC clone RP24-320K4 from 17, comple... 42 0.47
62gb|AC124428.4| Mus musculus BAC clone RP24-239M23 from 5, comple... 42 0.47
63gb|AC135290.5| Mus musculus BAC clone RP23-58D13 from 18, comple... 42 0.47
64emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 42 0.47
65emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chro... 42 0.47
66gb|AC153899.3| Mus musculus BAC RP23-128C4 (Roswell Park Cancer... 40 1.9
67ref|NM_125889.1| Arabidopsis thaliana unknown protein AT5G64905 ... 40 1.9
68gb|AC161519.11| Mus musculus chromosome 18, clone RP24-83L9, com... 40 1.9
69gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 40 1.9
70gb|AC163661.4| Mus musculus BAC clone RP23-288B18 from chromosom... 40 1.9
71ref|NM_194553.1| Oryza sativa (japonica cultivar-group) putative... 40 1.9
72ref|XM_516401.1| PREDICTED: Pan troglodytes similar to Zinc fing... 40 1.9
73gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 1.9
74gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, com... 40 1.9
75gb|AC138382.10| Mus musculus chromosome 1, clone RP24-400E14, co... 40 1.9
76gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, comp... 40 1.9
77ref|XM_421780.1| PREDICTED: Gallus gallus similar to RIKEN cDNA ... 40 1.9
78gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosom... 40 1.9
79ref|NM_003420.2| Homo sapiens zinc finger protein 35 (ZNF35), mRNA 40 1.9
80gb|BC013597.1| Homo sapiens zinc finger protein 35 (clone HF.10)... 40 1.9
81ref|XM_712010.1| Candida albicans SC5314 hypothetical protein (C... 40 1.9
82gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosom... 40 1.9
83gb|AC141426.3| Mus musculus BAC clone RP23-280I14 from chromosom... 40 1.9
84gb|AC160517.3| Mus musculus chromosome 8, clone RP23-279A11, com... 40 1.9
85gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 40 1.9
86gb|AC068241.7| Mus musculus chromosome 10, clone RP23-48L1, comp... 40 1.9
87gb|AC116111.17| Mus musculus chromosome 10, clone RP23-23B18, co... 40 1.9
88gb|AY386265.1| Bovine papular stomatitis virus strain BV-AR02, c... 40 1.9
89gb|AY512913.1| Mus musculus clone NIA:K0221A09 unknown mRNA 40 1.9
90gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome ... 40 1.9
91gb|AC141563.3| Mus musculus BAC clone RP23-410M22 from chromosom... 40 1.9
92gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosom... 40 1.9
93gb|DQ483819.1| Gymnogyps californianus clone 242F microsatellite... 40 1.9
94gb|DQ483785.1| Gymnogyps californianus clone 208F microsatellite... 40 1.9
95gb|DQ483551.1| Gymnogyps californianus clone 110D microsatellite... 40 1.9
96gb|DQ483458.1| Gymnogyps californianus clone 17D microsatellite ... 40 1.9
97gb|DQ484033.1| Gymnogyps californianus clone 199G microsatellite... 40 1.9
98gb|DQ484027.1| Gymnogyps californianus clone 193G microsatellite... 40 1.9
99gb|DQ483993.1| Gymnogyps californianus clone 159G microsatellite... 40 1.9
100gb|DQ483980.1| Gymnogyps californianus clone 146G microsatellite... 40 1.9
101gb|DQ483845.1| Gymnogyps californianus clone 11G microsatellite ... 40 1.9
102gb|DQ483838.1| Gymnogyps californianus clone 4G microsatellite s... 40 1.9
103gb|DQ483428.1| Gymnogyps californianus clone 131H microsatellite... 40 1.9
104gb|DQ483424.1| Gymnogyps californianus clone 127H microsatellite... 40 1.9
105gb|DQ483419.1| Gymnogyps californianus clone 122H microsatellite... 40 1.9
106gb|DQ483406.1| Gymnogyps californianus clone 109H microsatellite... 40 1.9
107gb|DQ483399.1| Gymnogyps californianus clone 102H microsatellite... 40 1.9
108gb|DQ483359.1| Gymnogyps californianus clone 62H microsatellite ... 40 1.9
109gb|DQ483303.1| Gymnogyps californianus clone 6H microsatellite s... 40 1.9
110ref|XM_824533.1| Trypanosoma brucei TREU927 hypothetical protein... 40 1.9
111ref|XM_540368.2| PREDICTED: Canis familiaris similar to POU doma... 40 1.9
112gb|AC124473.2| Mus musculus BAC clone RP24-86K23 from chromosome... 40 1.9
113ref|XM_570774.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 1.9
114gb|AC121842.3| Mus musculus BAC clone RP24-80L24 from chromosome... 40 1.9
115ref|XM_803101.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 1.9
116gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosom... 40 1.9
117gb|AC115294.5| Mus musculus BAC clone RP23-97A19 from chromosome... 40 1.9
118gb|BC015892.1| Homo sapiens zinc finger protein 35 (clone HF.10)... 40 1.9
119gb|AC125078.2| Mus musculus BAC clone RP23-478C7 from chromosome... 40 1.9
120gb|AC121926.3| Mus musculus BAC clone RP24-202B3 from chromosome... 40 1.9
121ref|XM_798654.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 1.9
122gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, comple... 40 1.9
123gb|AC098890.3| Mus musculus BAC clone RP23-122P22 from X, comple... 40 1.9
124ref|XM_734600.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 1.9
125gb|AC102527.6| Mus musculus chromosome 8, clone RP23-29G4, compl... 40 1.9
126gb|AC142499.9| Mus musculus strain C57BL/6J clone rp23-333m15, c... 40 1.9
127gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, compl... 40 1.9
128gb|AC012397.33| Mus musculus strain 129/Sv clone ct7-369p18 map ... 40 1.9
129gb|AC160032.7| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cance... 40 1.9
130emb|AL606970.12| Human DNA sequence from clone RP11-503C24 on ch... 40 1.9
131ref|XM_793038.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 1.9
132gb|BC055360.1| Mus musculus cDNA clone IMAGE:30046664, partial cds 40 1.9
133gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, comp... 40 1.9
134gb|AC109542.6| Rattus norvegicus 1 BAC CH230-270O15 (Children's ... 40 1.9
135ref|XM_790439.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 1.9
136gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 40 1.9
137emb|X07289.1|HSHF10 Human HF.10 gene mRNA 40 1.9
138gb|AC160970.7| Mus musculus BAC clone RP24-492D11 from chromosom... 40 1.9
139emb|BX640451.1| Bordetella bronchiseptica strain RB50, complete ... 40 1.9
140emb|BX640436.1| Bordetella parapertussis strain 12822, complete ... 40 1.9
141emb|AL669822.10| Mouse DNA sequence from clone RP23-47J12 on chr... 40 1.9
142gb|BT007738.1| Synthetic construct Homo sapiens zinc finger prot... 40 1.9
143gb|BT006962.1| Homo sapiens zinc finger protein 35 (clone HF.10)... 40 1.9
144emb|AL805916.7| Mouse DNA sequence from clone RP23-164N15 on chr... 40 1.9
145emb|AL663082.5| Mouse DNA sequence from clone RP23-327G1 on chro... 40 1.9
146emb|AL929499.5| Mouse DNA sequence from clone RP23-116K8 on chro... 40 1.9
147gb|AC119909.12| Mus musculus chromosome 8, clone RP24-241I4, com... 40 1.9
148gb|AC087889.15| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, ... 40 1.9
149gb|AC007961.32| Mus musculus strain 129S6/SvEvTac clone rp21-594... 40 1.9
150gb|AC092046.2| Homo sapiens chromosome 3 clone RP11-189H19, comp... 40 1.9
151gb|AC068654.2| Genomic Sequence For Oryza sativa (japonica culti... 40 1.9
152gb|AC099669.2| Homo sapiens chromosome 3 clone RP11-944L7, compl... 40 1.9
153gb|AC007844.32| Mus musculus strain 129/Sv ES cell line CJ7 chro... 40 1.9
154emb|AL732483.8| Mouse DNA sequence from clone RP23-70K10 on chro... 40 1.9
155gb|AC099760.5| Mus musculus BAC clone RP23-122E16 from chromosom... 40 1.9
156gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome ... 40 1.9
157gb|AC101817.13| Mus musculus chromosome 15, clone RP24-359I22, c... 40 1.9
158gb|AC104195.10| Mus musculus chromosome 5, clone RP24-95O4, comp... 40 1.9
159emb|BX323875.15| Zebrafish DNA sequence from clone CH211-135L21 ... 40 1.9
160gb|AE008684.1|AE008684 Mus musculus T-cell receptor alpha/delta ... 40 1.9
161emb|BX935708.2| Gallus gallus finished cDNA, clone ChEST326o24 40 1.9
162gb|AC159192.2| Mus musculus BAC clone RP24-121M18 from chromosom... 40 1.9
163gb|AC152954.1| Mus musculus 6 BAC RP23-296N5 (Roswell Park Cance... 40 1.9
164dbj|AK017207.1| Mus musculus 11 days pregnant adult female ovary... 40 1.9
165dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
166dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
167dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
168gb|AC092608.2| Homo sapiens BAC clone RP11-154F14 from 4, comple... 40 1.9
169gb|AF369029.2| White spot syndrome virus, complete genome 40 1.9
170dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
171emb|BX931778.1| Gallus gallus finished cDNA, clone ChEST797a3 40 1.9
172gb|AY183422.1| Phytophthora sojae clone 10-11f-MY unknown protei... 40 1.9
173gb|AY087551.1| Arabidopsis thaliana clone 3657 mRNA, complete se... 40 1.9
174emb|AL772151.17| Mouse DNA sequence from clone RP23-320C6 on chr... 40 1.9
175dbj|AP005004.3| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
176gb|AY891687.1| Synthetic construct Homo sapiens clone FLH013101.... 40 1.9
177gb|AY889142.1| Synthetic construct Homo sapiens clone FLH013105.... 40 1.9
178dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 1.9
179gb|AF440570.1| Shrimp white spot syndrome virus, complete genome 40 1.9
180dbj|AK104730.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
181dbj|AK104633.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
182gb|AC122431.4| Mus musculus BAC clone RP24-176L8 from 6, complet... 40 1.9
183gb|AC152922.5| Mus musculus BAC clone RP24-386D3 from 10, comple... 40 1.9
184dbj|AK061462.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 1.9
185gb|AC104892.10| Mus musculus chromosome 18, clone RP23-262H4, co... 40 1.9
186tpe|BN000654.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-gr... 40 1.9
187emb|CT025599.16| Mouse DNA sequence from clone RP24-254G12 on ch... 40 1.9
188gb|AC151669.5| Mus musculus chromosome 5, clone RP23-44L13, comp... 40 1.9
189gb|AC107808.20| Mus musculus chromosome 9, clone RP23-61B14, com... 40 1.9
190dbj|AP002962.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 1.9
191emb|AL805963.23| Mouse DNA sequence from clone RP23-98K7 on chro... 40 1.9
192emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chr... 40 1.9
193gb|AC162863.5| Mus musculus chromosome 15, clone RP23-276I6, com... 40 1.9
194gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 1.9
195gb|AC139241.4| Mus musculus BAC clone RP24-79L4 from 3, complete... 40 1.9
196gb|AC140454.4| Mus musculus BAC clone RP24-163I14 from 1, comple... 40 1.9
197gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complet... 40 1.9
198gb|AC003994.1|AC003994 Mouse cosmid ma53a271 from 14D1-D2 (Mouse... 40 1.9
199emb|AL928992.7| Mouse DNA sequence from clone RP23-208O9 on chro... 40 1.9
200gb|AC154793.2| Mus musculus BAC clone RP23-88B6 from chromosome ... 40 1.9
201gb|M76702.1|HUMZNF35P2 Homo sapiens zinc finger protein 35 (ZNF3... 40 1.9
202gb|AC153971.3| Mus musculus 10 BAC RP24-254O21 (Roswell Park Can... 40 1.9
203gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Can... 40 1.9
204gb|AC152980.2| Mus musculus 10 BAC RP23-462F3 (Roswell Park Canc... 40 1.9
205emb|AL591209.17| Mouse DNA sequence from clone RP23-309H19 on ch... 40 1.9
206emb|AL590429.9| Mouse DNA sequence from clone RP23-462O16 on chr... 40 1.9
207gb|AC101660.25| Mus musculus chromosome 15, clone RP23-4I22, com... 40 1.9
208gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, com... 40 1.9
209gb|AC166241.7| Mus musculus chromosome 8, clone RP23-125A7, comp... 40 1.9
210emb|AL671732.15| Mouse DNA sequence from clone RP23-309O6 on chr... 40 1.9
211emb|AL831759.5| Mouse DNA sequence from clone RP23-150J13 on chr... 40 1.9
212emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chro... 40 1.9
213emb|AL669925.8| Mouse DNA sequence from clone RP23-174D24 on chr... 40 1.9
214gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, c... 38 7.4
215gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 38 7.4
216ref|NM_133433.2| Homo sapiens Nipped-B homolog (Drosophila) (NIP... 38 7.4
217ref|NM_015384.3| Homo sapiens Nipped-B homolog (Drosophila) (NIP... 38 7.4
218ref|NM_114958.2| Arabidopsis thaliana unknown protein AT3G50980 ... 38 7.4
219ref|NM_105228.2| Arabidopsis thaliana calcium ion binding AT1G65... 38 7.4
220ref|NM_105156.1| Arabidopsis thaliana antiporter/ drug transport... 38 7.4
221gb|AC119220.11| Mus musculus chromosome 1, clone RP24-201K16, co... 38 7.4
222ref|NM_118905.1| Arabidopsis thaliana unknown protein AT4G27660 ... 38 7.4
223ref|NM_128655.3| Arabidopsis thaliana ATP binding / kinase/ prot... 38 7.4
224gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome... 38 7.4
225gb|AC147806.5| Mus musculus chromosome 1, clone RP23-6O16, compl... 38 7.4
226gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, co... 38 7.4
227gb|AC159312.2| Mus musculus BAC clone RP23-156N21 from chromosom... 38 7.4
228gb|AC158357.4| Mus musculus BAC clone RP23-434L22 from chromosom... 38 7.4
229gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, co... 38 7.4
230gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome... 38 7.4
231gb|AC165224.9| Mus musculus chromosome 5, clone RP24-389L10, com... 38 7.4
232gb|AY355461.1| Homo sapiens MNK1-like kinase 1b (MNK1B) mRNA, co... 38 7.4
233gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, comp... 38 7.4
234ref|XM_521135.1| PREDICTED: Pan troglodytes similar to cysteine-... 38 7.4
235gb|AC155825.2| Mus musculus BAC clone RP23-54D15 from chromosome... 38 7.4
236gb|AC135668.5| Mus musculus BAC clone RP23-280P7 from chromosome... 38 7.4
237gb|AC161342.10| Mus musculus chromosome 1, clone RP23-313K17, co... 38 7.4
238gb|AC169209.2| Mus musculus chromosome 7, clone wi1-98D1, comple... 38 7.4
239ref|XM_483507.1| Oryza sativa (japonica cultivar-group), mRNA 38 7.4
240ref|XM_507598.1| PREDICTED Oryza sativa (japonica cultivar-group... 38 7.4
241ref|XM_507306.1| PREDICTED Oryza sativa (japonica cultivar-group... 38 7.4
242ref|XM_474057.1| Oryza sativa (japonica cultivar-group), predic... 38 7.4
243ref|XM_520459.1| PREDICTED: Pan troglodytes similar to SWI/SNF-r... 38 7.4
244gb|AC162898.10| Mus musculus chromosome 5, clone RP23-391P21, co... 38 7.4
245gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 38 7.4
246gb|AC102638.13| Mus musculus chromosome 3, clone RP23-406D2, com... 38 7.4
247ref|NM_193355.1| Oryza sativa (japonica cultivar-group), predic... 38 7.4
248ref|XM_469232.1| Oryza sativa (japonica cultivar-group), mRNA 38 7.4
249gb|AC158121.12| Mus musculus chromosome 5, clone RP23-440H19, co... 38 7.4
250ref|XM_525881.1| PREDICTED: Pan troglodytes similar to Ubiquinol... 38 7.4
251ref|XM_524574.1| PREDICTED: Pan troglodytes similar to MNK1 (LOC... 38 7.4
252gb|AC153558.7| Mus musculus 10 BAC RP23-367D2 (Roswell Park Canc... 38 7.4
253gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, comp... 38 7.4
254gb|AC107634.8| Mus musculus chromosome 5, clone RP23-19G21, comp... 38 7.4
255ref|NM_145463.3| Mus musculus transmembrane protein 46 (Tmem46),... 38 7.4
256gb|AC139513.10| Mus musculus chromosome 15, clone RP23-151N6, co... 38 7.4
257gb|AC102168.9| Mus musculus chromosome 7, clone RP23-452N21, com... 38 7.4
258gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1R... 38 7.4
259gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 38 7.4
260gb|AC084046.13| Trypanosoma brucei chromosome 6 clone RPCI93-3D8... 38 7.4
261gb|AC156992.13| Mus musculus chromosome 7, clone RP23-474C17, co... 38 7.4
262gb|AC117585.8| Mus musculus chromosome 5, clone RP23-155F13, com... 38 7.4
263gb|AC164980.3| Mus musculus BAC clone RP23-184C3 from chromosome... 38 7.4
264gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosom... 38 7.4
265gb|AC156163.2| Mus musculus BAC clone RP24-122E11 from chromosom... 38 7.4
266gb|AC161235.6| Mus musculus chromosome 3, clone RP24-86C19, comp... 38 7.4
267gb|AC166326.2| Mus musculus BAC clone RP23-259L9 from chromosome... 38 7.4
268gb|AC119854.7| Mus musculus chromosome 3, clone RP23-234F9, comp... 38 7.4
269gb|AC136009.4| Oryza sativa (japonica cultivar-group) chromosome... 38 7.4
270gb|AC150202.2| Oryza sativa (japonica cultivar-group) chromosome... 38 7.4
271gb|AC092241.2| Drosophila melanogaster clone BACR09F02, complete... 38 7.4
272ref|NG_003104.1| Homo sapiens zinc finger protein 91 homolog (mo... 38 7.4
273gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 38 7.4
274gb|AC122669.6| Rattus norvegicus 4 BAC CH230-172C22 (Children's ... 38 7.4
275gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 38 7.4
276ref|XM_423552.1| PREDICTED: Gallus gallus similar to Myeloid/lym... 38 7.4
277ref|XM_866769.1| PREDICTED: Bos taurus similar to cysteine-rich ... 38 7.4
278gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 38 7.4
279gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 38 7.4
280ref|XM_415130.1| PREDICTED: Gallus gallus Ca2+ ATPase (SERCA2A),... 38 7.4
281gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, co... 38 7.4
282gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, co... 38 7.4
283gb|AC131594.10| Mus musculus chromosome 15, clone RP24-568P18, c... 38 7.4
284gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 38 7.4
285gb|AC140389.3| Mus musculus BAC clone RP24-202H2 from chromosome... 38 7.4
286ref|XM_323802.1| Neurospora crassa OR74A hypothetical protein (N... 38 7.4
287ref|XM_950815.1| Neurospora crassa OR74A hypothetical protein (N... 38 7.4
288gb|AC084310.16| Mus musculus chromosome 1, clone RP23-10C10, com... 38 7.4
289gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 38 7.4
290gb|AC117693.9| Mus musculus chromosome 1, clone RP23-448D22, com... 38 7.4
291gb|AC133649.2| Mus musculus BAC clone RP23-341M13 from chromosom... 38 7.4
292gb|AC139328.4| Mus musculus BAC clone RP24-299C21 from chromosom... 38 7.4
293gb|AC101760.9| Mus musculus chromosome 1, clone RP24-196A8, comp... 38 7.4
294gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 38 7.4
295gb|AC147044.2| Mus musculus BAC clone RP23-106B19 from chromosom... 38 7.4
296gb|AC138792.2| Mus musculus BAC clone RP23-235I2 from chromosome... 38 7.4
297gb|AC130719.3| Mus musculus BAC clone RP24-107M5 from chromosome... 38 7.4
298gb|AC135359.2| Mus musculus BAC clone RP24-209E17 from chromosom... 38 7.4
299gb|AC140927.2| Mus musculus BAC clone RP23-409D19 from chromosom... 38 7.4
300gb|AC147613.2| Mus musculus BAC clone RP23-381J20 from chromosom... 38 7.4
301gb|DQ481665.1| Takifugu rubripes HoxBa gene cluster, complete se... 38 7.4
302gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, com... 38 7.4
303gb|AC139377.4| Mus musculus chromosome 5 clone RP24-291G12, comp... 38 7.4
304gb|BT013325.1| Lycopersicon esculentum clone 135045R, mRNA sequence 38 7.4
305gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, co... 38 7.4
306ref|NM_020340.2| Homo sapiens KIAA1244 (KIAA1244), mRNA 38 7.4
307gb|AC102622.7| Mus musculus chromosome 3, clone RP23-434O10, com... 38 7.4
308gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, com... 38 7.4
309gb|AF130866.6| Homo sapiens chromosome 8 clone GS1-172N13 map q2... 38 7.4
310gb|AC167332.2| Mus musculus BAC clone RP24-165A19 from chromosom... 38 7.4
311gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 38 7.4
312gb|AC158347.4| Mus musculus chromosome 3, clone RP23-380F8, comp... 38 7.4
313gb|AC159545.18| Mus musculus 6 BAC RP23-244E8 (Roswell Park Canc... 38 7.4
314gb|AC159829.10| Mus musculus 10 BAC RP23-269H11 (Roswell Park Ca... 38 7.4
315gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 38 7.4
316gb|AC137871.18| Mus musculus chromosome 15, clone RP23-41B9, com... 38 7.4
317gb|AC154583.3| Mus musculus BAC clone RP23-248H18 from chromosom... 38 7.4
318gb|AC142453.3| Mus musculus BAC clone RP23-398A2 from chromosome... 38 7.4
319ref|XM_844913.1| PREDICTED: Canis familiaris similar to cysteine... 38 7.4
320ref|XR_001808.1| PREDICTED: Mus musculus hypothetical protein LO... 38 7.4
321gb|AC125082.3| Mus musculus BAC clone RP24-90M24 from chromosome... 38 7.4
322gb|AC125019.6| Mus musculus chromosome 19, clone RP24-158H8, com... 38 7.4
323gb|AC140353.2| Mus musculus BAC clone RP24-67E1 from chromosome ... 38 7.4
324ref|XR_003360.1| PREDICTED: Mus musculus hypothetical protein LO... 38 7.4
325gb|AC092508.3| Mus musculus strain C57BL6/J chromosome 5 clone R... 38 7.4
326gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, comp... 38 7.4
327gb|AC101902.9| Mus musculus chromosome 1, clone RP24-147M23, com... 38 7.4
328gb|AC116392.12| Mus musculus chromosome 10, clone RP23-93D3, com... 38 7.4
329gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 38 7.4
330gb|AC122243.3| Mus musculus BAC clone RP23-148C10 from chromosom... 38 7.4
331gb|AC136023.5| Mus musculus BAC clone RP24-501J4 from chromosome... 38 7.4
332emb|CT009518.6| Mouse DNA sequence from clone RP23-118M14 on chr... 38 7.4
333ref|XM_540761.2| PREDICTED: Canis familiaris similar to cryptoch... 38 7.4
334emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chro... 38 7.4
335gb|AC146454.3| Pan troglodytes BAC clone CH251-387H9 from Y, com... 38 7.4
336gb|AC146232.2| Pan troglodytes BAC clone RP43-27C6 from 7, compl... 38 7.4
337gb|AC121913.3| Mus musculus BAC clone RP24-185E15 from chromosom... 38 7.4
338gb|AC130838.3| Mus musculus BAC clone RP24-369B4 from chromosome... 38 7.4
339gb|AC122510.5| Mus musculus BAC clone RP24-445P13 from chromosom... 38 7.4
340gb|AC122050.3| Mus musculus BAC clone RP24-457L7 from chromosome... 38 7.4
341gb|AC127552.3| Mus musculus BAC clone RP24-550N13 from chromosom... 38 7.4
342gb|AC141430.3| Mus musculus BAC clone RP23-95O14 from chromosome... 38 7.4
343gb|AC117214.3| Mus musculus BAC clone RP23-307B15 from chromosom... 38 7.4
344emb|X64199.1|ATXERO A.thaliana XERO gene for dehydrin 38 7.4
345ref|XM_807257.1| Trypanosoma cruzi strain CL Brener hypothetical... 38 7.4
346gb|AC140723.16| Mus musculus chromosome 16, clone RP23-346N4, co... 38 7.4
347ref|XM_809538.1| Trypanosoma cruzi strain CL Brener hypothetical... 38 7.4
348gb|AC118020.11| Mus musculus, clone RP23-459B19, complete sequence 38 7.4
349gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome... 38 7.4
350gb|AC124424.4| Mus musculus BAC clone RP24-230J3 from chromosome... 38 7.4
351gb|AC122447.4| Mus musculus BAC clone RP24-240O5 from chromosome... 38 7.4
352gb|AC124431.4| Mus musculus BAC clone RP24-243J21 from chromosom... 38 7.4
353gb|AC125340.3| Mus musculus BAC clone RP24-364H15 from chromosom... 38 7.4
354gb|AC127563.4| Mus musculus BAC clone RP24-283E13 from chromosom... 38 7.4
355ref|XM_812878.1| Trypanosoma cruzi strain CL Brener inositol 5-p... 38 7.4
356gb|AC125076.4| Mus musculus BAC clone RP23-472F9 from chromosome... 38 7.4
357gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome... 38 7.4
358gb|AC121798.3| Mus musculus BAC clone RP23-426H21 from chromosom... 38 7.4
359gb|AC122338.2| Mus musculus BAC clone RP23-353I2 from chromosome... 38 7.4
360gb|AC123534.3| Mus musculus BAC clone RP23-356I5 from chromosome... 38 7.4
361gb|AC121912.3| Mus musculus BAC clone RP24-183P18 from chromosom... 38 7.4
362gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, com... 38 7.4
363gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome... 38 7.4
364gb|AC124720.3| Mus musculus BAC clone RP23-387F14 from chromosom... 38 7.4
365gb|AC122182.4| Mus musculus BAC clone RP23-12G9 from 1, complete... 38 7.4
366gb|AC123949.5| Mus musculus BAC clone RP23-119H13 from 14, compl... 38 7.4
367gb|AC122272.4| Mus musculus BAC clone RP23-225J2 from 6, complet... 38 7.4
368gb|AC124541.4| Mus musculus BAC clone RP23-257F7 from 7, complet... 38 7.4
369gb|AC124545.4| Mus musculus BAC clone RP23-272D9 from 7, complet... 38 7.4
370gb|AC126457.3| Mus musculus BAC clone RP23-68E6 from 16, complet... 38 7.4
371gb|AC122884.2| Mus musculus BAC clone RP23-88O13 from 5, complet... 38 7.4
372emb|BX571713.11| Zebrafish DNA sequence from clone DKEY-19H21 in... 38 7.4
373gb|AC121877.2| Mus musculus BAC clone RP24-127G8 from 7, complet... 38 7.4
374gb|AC121876.2| Mus musculus BAC clone RP24-127E16 from 6, comple... 38 7.4
375gb|AC122059.1| Mus musculus BAC clone RP24-468J3 from 1, complet... 38 7.4
376gb|AC124189.3| Mus musculus BAC clone RP23-254C8 from 5, complet... 38 7.4
377ref|XM_546344.2| PREDICTED: Canis familiaris similar to delangin... 38 7.4
378ref|XM_862990.1| PREDICTED: Canis familiaris similar to delangin... 38 7.4
379ref|XM_862986.1| PREDICTED: Canis familiaris similar to delangin... 38 7.4
380ref|XM_862982.1| PREDICTED: Canis familiaris similar to delangin... 38 7.4
381gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, comp... 38 7.4
382gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosom... 38 7.4
383gb|AC092647.2| Homo sapiens BAC clone RP11-419M24 from 7, comple... 38 7.4
384gb|AC091812.4| Homo sapiens BAC clone RP11-613E4 from 7, complet... 38 7.4
385gb|AC079763.7| Homo sapiens BAC clone RP11-153N17 from 7, comple... 38 7.4
386gb|AC079760.6| Homo sapiens BAC clone RP11-142A5 from 7, complet... 38 7.4
387gb|AC110200.9| Mus musculus chromosome 16, clone RP23-150K16, co... 38 7.4
388gb|AC108392.17| Mus musculus chromosome 10, clone RP23-121B23, c... 38 7.4
389gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, co... 38 7.4
390gb|AC115755.8| Mus musculus chromosome 15, clone RP23-47L17, com... 38 7.4
391gb|AC115735.8| Mus musculus chromosome 15, clone RP23-470I4, com... 38 7.4
392gb|AC113085.6| Mus musculus chromosome 8, clone RP23-292P21, com... 38 7.4
393gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome... 38 7.4
394gb|AC134528.6| Mus musculus BAC clone RP24-502G8 from chromosome... 38 7.4
395gb|AC161399.2| Medicago truncatula chromosome 2 BAC clone mte1-3... 38 7.4
396gb|AC087900.19| Mus musculus strain C57BL/6J clone rp23-171i6 ma... 38 7.4
397gb|AY870423.1| Botrychium lunarioides tRNA-Gly (trnG) gene and t... 38 7.4
398gb|AC158982.2| Mus musculus BAC clone RP23-235N21 from chromosom... 38 7.4
399gb|AC157595.4| Mus musculus BAC clone RP23-238F18 from chromosom... 38 7.4
400gb|BC096868.1| Danio rerio similar to Neurofilament triplet L pr... 38 7.4
401gb|BC042099.1| Homo sapiens cDNA clone IMAGE:5784375, **** WARNI... 38 7.4
402gb|DQ446874.1| Arabidopsis thaliana clone pENTR221-At4g27660 unk... 38 7.4
403gb|DQ446394.1| Arabidopsis thaliana clone pENTR221-At1g64820 MAT... 38 7.4
404gb|AC182767.3| Pan troglodytes BAC clone CH251-283B24 from chrom... 38 7.4
405emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chrom... 38 7.4
406emb|AL732372.15| Human DNA sequence from clone RP4-669L17 on chr... 38 7.4
407emb|AL731534.7| Human DNA sequence from clone RP11-550A9 on chro... 38 7.4
408emb|AL731661.4| Human DNA sequence from clone XX-C2158C12 on chr... 38 7.4
409gb|BC114232.1| Danio rerio zgc:136626, mRNA (cDNA clone MGC:1366... 38 7.4
410emb|AL445423.13| Human DNA sequence from clone RP11-295M18 on ch... 38 7.4
411emb|AL359920.15| Human DNA sequence from clone RP11-359P14 on ch... 38 7.4
412ref|NM_198973.1| Homo sapiens MAP kinase interacting serine/thre... 38 7.4
413emb|AL358796.43| Human DNA sequence from clone RP13-260P4 on chr... 38 7.4
414ref|NM_003684.3| Homo sapiens MAP kinase interacting serine/thre... 38 7.4
415gb|AC026231.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 38 7.4
416emb|AL163533.14| Human DNA sequence from clone RP11-114G1 on chr... 38 7.4
417gb|AC091537.2| Rattus norvegicus strain Brown Norway clone RP31-... 38 7.4
418emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chro... 38 7.4
419gb|AC087286.12| Homo sapiens chromosome 15, clone RP11-815J21, c... 38 7.4
420gb|AC073939.6| Mus musculus strain C57BL/6J chromosome 12 clone ... 38 7.4
421emb|AL080245.14|HSBA89B2 Human DNA sequence from clone RP11-89B2... 38 7.4
422emb|AL109753.9|HSJ875J14 Human DNA sequence from clone RP5-875J1... 38 7.4
423gb|AC158228.3| Mus musculus chromosome 5, clone RP23-118K12, com... 38 7.4
424emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23... 38 7.4
425emb|AL031782.1|HS708F5 Human DNA sequence from clone RP4-708F5 o... 38 7.4
426ref|XM_961756.1| PREDICTED: Tribolium castaneum similar to RNA-d... 38 7.4
427gb|AC112163.7| Mus Musculus chromosome 13 BAC, clone MGS1-437011... 38 7.4
428emb|CR936642.1| Homo sapiens mRNA; cDNA DKFZp686F2342 (from clon... 38 7.4
429gb|AC116715.22| Mus musculus chromosome 5, clone RP23-129N14, co... 38 7.4
430gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 38 7.4
431emb|BX908808.1| Neurospora crassa DNA linkage group IV Cosmid co... 38 7.4
432emb|BX842622.1| Neurospora crassa DNA linkage group I BAC clone ... 38 7.4
433emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome... 38 7.4
434emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 38 7.4
435gb|AC140254.4| Mus musculus BAC clone RP23-467N7 from chromosome... 38 7.4
436emb|BX538193.1|HSM806417 Homo sapiens mRNA; cDNA DKFZp686E14208 ... 38 7.4
437gb|AC155933.3| Mus musculus BAC clone RP23-89K6 from chromosome ... 38 7.4
438gb|AC147018.4| Mus musculus BAC clone RP23-284H11 from chromosom... 38 7.4
439gb|AC163902.2| Mus musculus BAC clone RP23-479B18 from chromosom... 38 7.4
440gb|AC124351.3| Mus musculus BAC clone RP24-467D20 from chromosom... 38 7.4
441emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 38 7.4
442gb|BC048976.2| Homo sapiens chromosome 10 open reading frame 40,... 38 7.4
443emb|AL606724.17| Mouse DNA sequence from clone RP23-285D3 on chr... 38 7.4
444emb|AL627215.12| Mouse DNA sequence from clone RP23-292E3 on chr... 38 7.4
445emb|AL606649.4|OSJN00094 Oryza sativa genomic DNA, chromosome 4,... 38 7.4
446emb|AL606657.4|OSJN00101 Oryza sativa genomic DNA, chromosome 4,... 38 7.4
447emb|AL606656.3|OSJN00099 Oryza sativa genomic DNA, chromosome 4,... 38 7.4
448emb|AL161571.2|ATCHRIV67 Arabidopsis thaliana DNA chromosome 4, ... 38 7.4
449emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B... 38 7.4
450emb|AL035602.1|ATT29A15 Arabidopsis thaliana DNA chromosome 4, B... 38 7.4
451gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, com... 38 7.4
452emb|AJ310932.1|HSA310932 Homo sapiens MYO18B gene for myosin hea... 38 7.4
453gb|AC158986.2| Mus musculus BAC clone RP23-284L2 from chromosome... 38 7.4
454emb|AL645685.12| Mouse DNA sequence from clone RP23-198I4 on chr... 38 7.4
455emb|AL596252.11| Mouse DNA sequence from clone RP23-123O10 on ch... 38 7.4
456emb|AL845463.7| Mouse DNA sequence from clone RP23-386K17 on chr... 38 7.4
457emb|AL669858.8| Mouse DNA sequence from clone RP23-51G7 on chrom... 38 7.4
458emb|AL645965.8| Mouse DNA sequence from clone RP23-65I14 on chro... 38 7.4
459gb|AC053481.13| Homo sapiens chromosome 17, clone RP11-51L5, com... 38 7.4
460gb|BC057640.1| Mus musculus transmembrane protein 46, mRNA (cDNA... 38 7.4
461emb|CR933684.1| Homo sapiens mRNA; cDNA DKFZp781D1522 (from clon... 38 7.4
462gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, com... 38 7.4
463gb|AC154755.2| Mus musculus BAC clone RP24-406B22 from chromosom... 38 7.4
464emb|CR932804.1| Mus musculus chromosome 2, clone ResGen-475I1 st... 38 7.4
465emb|AL805940.7| Mouse DNA sequence from clone RP24-286B19 on chr... 38 7.4
466emb|AL844157.5| Mouse DNA sequence from clone RP24-313C24 on chr... 38 7.4
467emb|BX072541.1| Mouse DNA sequence from clone RP23-189G9 on chro... 38 7.4
468gb|AC102287.16| Mus musculus chromosome 8, clone RP24-345M16, co... 38 7.4
469gb|AC157783.7| Mus musculus chromosome 5, clone RP23-340G2, comp... 38 7.4
470gb|AC092711.14| Mus musculus chromosome 5, clone RP23-7D3, compl... 38 7.4
471gb|AC157603.4| Mus musculus BAC clone RP23-55O6 from chromosome ... 38 7.4
472gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 38 7.4
473emb|CR858387.1| Pongo pygmaeus mRNA; cDNA DKFZp459I1132 (from cl... 38 7.4
474gb|AF351806.1|F351799S08 Mus musculus Abcg8 gene, partial sequence 38 7.4
475gb|AC154350.3| Mus musculus BAC clone RP23-225B15 from chromosom... 38 7.4
476gb|AC160537.6| Mus musculus chromosome 8, clone RP24-95H19, comp... 38 7.4
477gb|AC156608.10| Mus musculus chromosome 8, clone RP23-303A11, co... 38 7.4
478gb|AC159323.3| Mus musculus BAC clone RP23-6I8 from chromosome 1... 38 7.4
479gb|CP000077.1| Sulfolobus acidocaldarius DSM 639, complete genome 38 7.4
480gb|AC090647.6| Genomic sequence for Mus musculus, clone RP23-252... 38 7.4
481gb|AC010032.10| Drosophila melanogaster 3L BAC RP98-2N23 (Roswel... 38 7.4
482gb|AC022780.19| Mus musculus chromosome 11, clone RP23-179C3, co... 38 7.4
483dbj|BS000681.1| Pan troglodytes chromosome Y clone: PTBY-009L06,... 38 7.4
484gb|AC106716.3| Homo sapiens 3 BAC RP11-202P1 (Roswell Park Cance... 38 7.4
485dbj|AB231934.1| Rosa hybrid cultivar Asami Red DNA, microsatelli... 38 7.4
486gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 7.4
487gb|AC099842.2| Homo sapiens chromosome 11, clone RP11-747E23, co... 38 7.4
488gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 m... 38 7.4
489gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence 38 7.4
490dbj|AK096423.1| Homo sapiens cDNA FLJ39104 fis, clone NTONG20046... 38 7.4
491ref|NM_001039840.1| Homo sapiens cysteine-rich hydrophobic domai... 38 7.4
492ref|NM_001039838.1| Danio rerio zgc:136626 (zgc:136626), mRNA 38 7.4
493gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, c... 38 7.4
494gb|AC108447.3| Homo sapiens chromosome 8, clone RP11-1104D13, co... 38 7.4
495gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 38 7.4
496gb|AC103691.2| Homo sapiens chromosome 15, clone RP11-959H21, co... 38 7.4
497gb|AC021037.6| Homo sapiens chromosome 10 clone RP11-44D15, comp... 38 7.4
498dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 38 7.4
499dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 38 7.4
500ref|NM_138225.2| Drosophila melanogaster CG13907-RA (CG13907), mRNA 38 7.4

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 46.1 bits (23), Expect = 0.030
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 51     gccgccaccttggccgcgctgct 73
              |||||||||||||||||||||||
Sbjct: 174832 gccgccaccttggccgcgctgct 174854



to top

>ref|NM_123065.1| Arabidopsis thaliana ATCHX24; monovalent cation:proton antiporter
            AT5G37060 (ATCHX24) mRNA, complete cds
          Length = 2580

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 25   cttcttcttcctcctcctttcg 46
            ||||||||||||||||||||||
Sbjct: 1648 cttcttcttcctcctcctttcg 1627



to top

>ref|NM_124017.2| Arabidopsis thaliana ATP binding / nucleoside-triphosphatase/
          nucleotide binding / transmembrane receptor AT5G46470
          mRNA, complete cds
          Length = 4849

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 21 atggcttcttcttcctcctcct 42
          ||||||||||||||||||||||
Sbjct: 1  atggcttcttcttcctcctcct 22



to top

>gb|DQ499022.1| Arabidopsis thaliana cation/H+ exchanger (CHX24) mRNA, partial cds
          Length = 2568

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 25   cttcttcttcctcctcctttcg 46
            ||||||||||||||||||||||
Sbjct: 1648 cttcttcttcctcctcctttcg 1627



to top

>gb|AE012295.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 203
           of 460 of the complete genome
          Length = 10029

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 48  gtggccgccaccttggccgcgc 69
           ||||||||||||||||||||||
Sbjct: 718 gtggccgccaccttggccgcgc 697



to top

>gb|AC116801.9| Mus musculus chromosome 8, clone RP24-337F7, complete sequence
          Length = 168297

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 12     cttagcaacatggcttcttctt 33
              ||||||||||||||||||||||
Sbjct: 167959 cttagcaacatggcttcttctt 167980



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 48      gtggccgccaccttggccgcgc 69
               ||||||||||||||||||||||
Sbjct: 2741322 gtggccgccaccttggccgcgc 2741343



to top

>emb|BX834041.1|CNS09Z50 Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTSIL91ZG09 of Silique of strain col-0 of
          Arabidopsis thaliana (thale cress)
          Length = 622

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 21 atggcttcttcttcctcctcct 42
          ||||||||||||||||||||||
Sbjct: 10 atggcttcttcttcctcctcct 31



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 59      cttggccgcgctgctggcggcc 80
               ||||||||||||||||||||||
Sbjct: 2768527 cttggccgcgctgctggcggcc 2768548



to top

>dbj|AB019223.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K11I1
          Length = 51529

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 21    atggcttcttcttcctcctcct 42
             ||||||||||||||||||||||
Sbjct: 14294 atggcttcttcttcctcctcct 14315



to top

>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 25   cttcttcttcctcctcctttcg 46
            ||||||||||||||||||||||
Sbjct: 5523 cttcttcttcctcctcctttcg 5544



to top

>gb|AC119267.8| Mus musculus chromosome 8, clone RP24-322H19, complete sequence
          Length = 191277

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 12    cttagcaacatggcttcttctt 33
             ||||||||||||||||||||||
Sbjct: 45678 cttagcaacatggcttcttctt 45699



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 63      gccgcgctgctggcggccgtctgcgt 88
               ||||||||||||||||||||| ||||
Sbjct: 4554101 gccgcgctgctggcggccgtcggcgt 4554126



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     cgccaccttggccgcgctg 71
              |||||||||||||||||||
Sbjct: 413888 cgccaccttggccgcgctg 413906



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 44.1 bits (22), Expect = 0.12
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 65      cgcgctgctggcggccgtctgc 86
               ||||||||||||||||||||||
Sbjct: 3118199 cgcgctgctggcggccgtctgc 3118178



to top

>ref|NM_127820.2| Arabidopsis thaliana SVP (SHORT VEGETATIVE PHASE); transcription
           factor AT2G22540 (SVP) mRNA, complete cds
          Length = 1546

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 378 tggcttcttcttcctcctcct 398



to top

>ref|NM_105945.2| Arabidopsis thaliana ATP binding / transmembrane receptor
          AT1G72870 mRNA, complete cds
          Length = 1648

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 20 catggcttcttcttcctcctc 40
          |||||||||||||||||||||
Sbjct: 8  catggcttcttcttcctcctc 28



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 16      gcaacatggcttcttcttcct 36
               |||||||||||||||||||||
Sbjct: 1685713 gcaacatggcttcttcttcct 1685693



to top

>gb|AC140387.2| Mus musculus BAC clone RP24-185D21 from chromosome 9, complete sequence
          Length = 158741

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     cttcttcttcctcctcctttc 45
              |||||||||||||||||||||
Sbjct: 118726 cttcttcttcctcctcctttc 118746



to top

>gb|AC122118.7| Mus musculus chromosome 18, clone RP24-225P17, complete sequence
          Length = 190301

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 48302 tggcttcttcttcctcctcct 48282



to top

>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete
             sequence
          Length = 201051

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 79614 cttcttcttcctcctcctttc 79634



to top

>emb|CT010441.11| Mouse DNA sequence from clone CH29-521N19 on chromosome 17, complete
             sequence
          Length = 235642

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 10615 cttcttcttcctcctcctttc 10595



to top

>gb|AC129078.6| Mus musculus BAC clone RP24-71C5 from chromosome 18, complete sequence
          Length = 215826

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 51528 tggcttcttcttcctcctcct 51548



to top

>gb|AC106705.7| Homo sapiens 3 BAC RP11-262L17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 100464

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 53905 cttcttcttcctcctcctttc 53885



to top

>gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, complete sequence
          Length = 199519

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 35179 cttcttcttcctcctcctttc 35199



to top

>gb|AC121972.2| Mus musculus BAC clone RP24-276H18 from 2, complete sequence
          Length = 193641

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     cttcttcttcctcctcctttc 45
              |||||||||||||||||||||
Sbjct: 140672 cttcttcttcctcctcctttc 140692



to top

>gb|AC025540.7| Homo sapiens BAC clone RP11-295N22 from 7, complete sequence
          Length = 160896

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 29028 tggcttcttcttcctcctcct 29048



to top

>gb|AC157942.7| Mus musculus BAC clone RP24-118E2 from chromosome 13, complete sequence
          Length = 173717

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 22     tggcttcttcttcctcctcct 42
              |||||||||||||||||||||
Sbjct: 133467 tggcttcttcttcctcctcct 133487



to top

>gb|AC111648.6| Rattus norvegicus 2 BAC CH230-103N18 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 235343

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 26947 tggcttcttcttcctcctcct 26967



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 59      cttggccgcgctgctggcggc 79
               |||||||||||||||||||||
Sbjct: 2671106 cttggccgcgctgctggcggc 2671086



to top

>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16
          Length = 348706

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 61     tggccgcgctgctggcggccg 81
              |||||||||||||||||||||
Sbjct: 185237 tggccgcgctgctggcggccg 185257



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     gccgcgctgctggcggccg 81
              |||||||||||||||||||
Sbjct: 247469 gccgcgctgctggcggccg 247487



to top

>emb|BX640431.1| Bordetella parapertussis strain 12822, complete genome; segment 9/14
          Length = 347894

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 61     tggccgcgctgctggcggccg 81
              |||||||||||||||||||||
Sbjct: 111202 tggccgcgctgctggcggccg 111182



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     gccgcgctgctggcggccg 81
              |||||||||||||||||||
Sbjct: 319156 gccgcgctgctggcggccg 319174



to top

>emb|AL939131.1|SCO939131 Streptomyces coelicolor A3(2) complete genome; segment 28/29
          Length = 303550

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 61    tggccgcgctgctggcggccg 81
             |||||||||||||||||||||
Sbjct: 96748 tggccgcgctgctggcggccg 96728



to top

>emb|AL161492.2|ATCHRIV4 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 4
          Length = 198697

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 43599 cttcttcttcctcctcctttc 43619



to top

>emb|AL669827.5| Mouse DNA sequence from clone RP23-350D17 on chromosome 11 Contains a
            PDZ domain containing guanine (Pdzgef1) pseudogene, a
            tubulin alpha 4 (Tuba4) pseudogene , an olfactory
            receptor pseudogene, a novel pseudogene and the 3' end of
            a novel gene, complete sequence
          Length = 108424

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 21   atggcttcttcttcctcctcc 41
            |||||||||||||||||||||
Sbjct: 9271 atggcttcttcttcctcctcc 9291



to top

>gb|AC161757.5| Mus musculus BAC clone RP24-87P2 from chromosome 5, complete sequence
          Length = 193583

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 44648 tggcttcttcttcctcctcct 44668



to top

>gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 241211

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 26274 tggcttcttcttcctcctcct 26254



to top

>gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, complete sequence
          Length = 206004

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 25     cttcttcttcctcctcctttc 45
              |||||||||||||||||||||
Sbjct: 102206 cttcttcttcctcctcctttc 102186



to top

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 26      ttcttcttcctcctcctttcg 46
               |||||||||||||||||||||
Sbjct: 1427660 ttcttcttcctcctcctttcg 1427640



to top

>gb|AC006592.6| Arabidopsis thaliana chromosome 2 clone F14M13 map mi238, complete
             sequence
          Length = 106949

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 14032 tggcttcttcttcctcctcct 14012



to top

>gb|AC159825.2| Mus musculus BAC clone RP23-100J21 from chromosome 9, complete sequence
          Length = 209633

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 57527 tggcttcttcttcctcctcct 57547



to top

>gb|AC122406.5| Mus musculus BAC clone RP24-126L14 from chromosome 17, complete
             sequence
          Length = 161377

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 22812 cttcttcttcctcctcctttc 22832



to top

>emb|BX816419.1|CNS0ABKT Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH47ZD04 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 1648

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 20 catggcttcttcttcctcctc 40
          |||||||||||||||||||||
Sbjct: 8  catggcttcttcttcctcctc 28



to top

>emb|BX842456.1|CNS0A915 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH84ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1363

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 267 tggcttcttcttcctcctcct 287



to top

>emb|BX842440.1|CNS0A8OH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH56ZH06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1341

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 240 tggcttcttcttcctcctcct 260



to top

>emb|BX842431.1|CNS0A8GM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS10ZE07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1390

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 351 tggcttcttcttcctcctcct 371



to top

>gb|AE009471.1| Brucella melitensis 16M chromosome I, section 28 of 195 of the
            complete sequence
          Length = 10783

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 16   gcaacatggcttcttcttcct 36
            |||||||||||||||||||||
Sbjct: 9402 gcaacatggcttcttcttcct 9422



to top

>gb|AF211171.1|AF211171 Arabidopsis thaliana short vegetative phase protein (SVP) mRNA,
           complete cds
          Length = 1518

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 367 tggcttcttcttcctcctcct 387



to top

>gb|AF096370.1|F11O4 Arabidopsis thaliana BAC F11O4
          Length = 72872

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 59978 cttcttcttcctcctcctttc 59958



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 16      gcaacatggcttcttcttcct 36
               |||||||||||||||||||||
Sbjct: 1702635 gcaacatggcttcttcttcct 1702615



to top

>dbj|AK176273.1| Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-18-N15
          Length = 1797

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 20 catggcttcttcttcctcctc 40
          |||||||||||||||||||||
Sbjct: 63 catggcttcttcttcctcctc 83



to top

>dbj|AK175241.1| Arabidopsis thaliana mRNA for short vegegative phase protein (SVP),
           complete cds, clone: RAFL21-66-O07
          Length = 1492

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 22  tggcttcttcttcctcctcct 42
           |||||||||||||||||||||
Sbjct: 379 tggcttcttcttcctcctcct 399



to top

>emb|BX537257.4| Mouse DNA sequence from clone RP23-89C2 on chromosome 2, complete
             sequence
          Length = 79633

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 43153 cttcttcttcctcctcctttc 43133



to top

>gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 197401

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 69893 tggcttcttcttcctcctcct 69913



to top

>emb|BX545905.9| Mouse DNA sequence from clone RP23-339J7 on chromosome 2, complete
             sequence
          Length = 128574

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 86005 cttcttcttcctcctcctttc 86025



to top

>emb|BX470181.7| Zebrafish DNA sequence from clone CH211-91P22 in linkage group 18,
             complete sequence
          Length = 186084

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 94884 tggcttcttcttcctcctcct 94904



to top

>gb|AC154912.3| Mus musculus BAC clone RP23-23B10 from 17, complete sequence
          Length = 228141

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 91536 cttcttcttcctcctcctttc 91516



to top

>gb|AC154401.2| Mus musculus BAC clone RP23-166O7 from 13, complete sequence
          Length = 199694

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     cttcttcttcctcctcctttc 45
              |||||||||||||||||||||
Sbjct: 175937 cttcttcttcctcctcctttc 175957



to top

>emb|AL929229.6| Zebrafish DNA sequence from clone CH211-1E14 in linkage group 18,
              complete sequence
          Length = 184794

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 22     tggcttcttcttcctcctcct 42
              |||||||||||||||||||||
Sbjct: 166765 tggcttcttcttcctcctcct 166745



to top

>gb|AC008017.2|AC008017 Arabidopsis thaliana chromosome I BAC F3N23 genomic sequence, complete
             sequence
          Length = 116944

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 20    catggcttcttcttcctcctc 40
             |||||||||||||||||||||
Sbjct: 23657 catggcttcttcttcctcctc 23677



to top

>gb|AC141642.4| Mus musculus BAC clone RP23-274K4 from chromosome 12, complete sequence
          Length = 175025

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 25     cttcttcttcctcctcctttc 45
              |||||||||||||||||||||
Sbjct: 139477 cttcttcttcctcctcctttc 139497



to top

>gb|AC134555.4| Mus musculus BAC clone RP24-320K4 from 17, complete sequence
          Length = 174388

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 23716 cttcttcttcctcctcctttc 23696



to top

>gb|AC124428.4| Mus musculus BAC clone RP24-239M23 from 5, complete sequence
          Length = 167334

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 22     tggcttcttcttcctcctcct 42
              |||||||||||||||||||||
Sbjct: 103915 tggcttcttcttcctcctcct 103935



to top

>gb|AC135290.5| Mus musculus BAC clone RP23-58D13 from 18, complete sequence
          Length = 233915

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 22    tggcttcttcttcctcctcct 42
             |||||||||||||||||||||
Sbjct: 22614 tggcttcttcttcctcctcct 22634



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain
               2308
          Length = 2121359

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 16      gcaacatggcttcttcttcct 36
               |||||||||||||||||||||
Sbjct: 1699791 gcaacatggcttcttcttcct 1699771



to top

>emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chromosome 2, complete
             sequence
          Length = 170475

 Score = 42.1 bits (21), Expect = 0.47
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 25    cttcttcttcctcctcctttc 45
             |||||||||||||||||||||
Sbjct: 64662 cttcttcttcctcctcctttc 64642



to top

>gb|AC153899.3| Mus musculus  BAC RP23-128C4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 164582

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 50864 cttcttcttcctcctccttt 50883



to top

>ref|NM_125889.1| Arabidopsis thaliana unknown protein AT5G64905 mRNA, complete cds
          Length = 486

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 256 cttcttcttcctcctccttt 237



to top

>gb|AC161519.11| Mus musculus chromosome 18, clone RP24-83L9, complete sequence
          Length = 233631

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 161143 cttcttcttcctcctccttt 161162



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 74229 cttcttcttcctcctccttt 74248



to top

>gb|AC163661.4| Mus musculus BAC clone RP23-288B18 from chromosome 10, complete sequence
          Length = 210846

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     ttcttcttcctcctcctttc 45
              ||||||||||||||||||||
Sbjct: 149600 ttcttcttcctcctcctttc 149619



to top

>ref|NM_194553.1| Oryza sativa (japonica cultivar-group) putative peroxidase
           (OSJNBa0015O22.19), mRNA
          Length = 1011

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 120 ctgtgcgtggactactactactgcacgtgccc 151
           ||||||| ||| |||||| |||||||||||||
Sbjct: 97  ctgtgcgaggagtactacgactgcacgtgccc 128



to top

>ref|XM_516401.1| PREDICTED: Pan troglodytes similar to Zinc finger protein 35 (Zinc
           finger protein HF.10) (LOC460308), mRNA
          Length = 1291

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 290 cttcttcttcctcctccttt 271



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 159556 cttcttcttcctcctccttt 159575



to top

>gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, complete sequence
          Length = 148387

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 90967 cttcttcttcctcctccttt 90986



to top

>gb|AC138382.10| Mus musculus chromosome 1, clone RP24-400E14, complete sequence
          Length = 136819

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 104921 cttcttcttcctcctccttt 104940



to top

>gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, complete sequence
          Length = 237945

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ggcttcttcttcctcctcct 42
             ||||||||||||||||||||
Sbjct: 36596 ggcttcttcttcctcctcct 36615



to top

>ref|XM_421780.1| PREDICTED: Gallus gallus similar to RIKEN cDNA 6430537H07 gene
            (LOC423918), mRNA
          Length = 2494

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 1429 cttcttcttcctcctccttt 1410



to top

>gb|AC110381.5| Mus musculus BAC clone RP24-198I16 from chromosome 10, complete sequence
          Length = 166554

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     tggcttcttcttcctcctcc 41
              ||||||||||||||||||||
Sbjct: 113710 tggcttcttcttcctcctcc 113691



to top

>ref|NM_003420.2| Homo sapiens zinc finger protein 35 (ZNF35), mRNA
          Length = 2658

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 278 cttcttcttcctcctccttt 259



to top

>gb|BC013597.1| Homo sapiens zinc finger protein 35 (clone HF.10), mRNA (cDNA clone
           MGC:17095 IMAGE:4186299), complete cds
          Length = 2658

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 278 cttcttcttcctcctccttt 259



to top

>ref|XM_712010.1| Candida albicans SC5314 hypothetical protein (CaO19_5299), mRNA
          Length = 594

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 520 cttcttcttcctcctccttt 501



to top

>gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosome 1, complete sequence
          Length = 188928

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 168811 cttcttcttcctcctccttt 168792



to top

>gb|AC141426.3| Mus musculus BAC clone RP23-280I14 from chromosome 12, complete
             sequence
          Length = 227835

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 93316 cttcttcttcctcctccttt 93335



to top

>gb|AC160517.3| Mus musculus chromosome 8, clone RP23-279A11, complete sequence
          Length = 169477

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 159559 cttcttcttcctcctccttt 159578



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 47      ggtggccgccaccttggccgcgctgctg 74
               ||||||||||||| ||| ||||||||||
Sbjct: 1245220 ggtggccgccaccgtggtcgcgctgctg 1245247



to top

>gb|AC068241.7| Mus musculus chromosome 10, clone RP23-48L1, complete sequence
          Length = 218191

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 16723 cttcttcttcctcctccttt 16742



to top

>gb|AC116111.17| Mus musculus chromosome 10, clone RP23-23B18, complete sequence
          Length = 211888

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 118495 cttcttcttcctcctccttt 118514



to top

>gb|AY386265.1| Bovine papular stomatitis virus strain BV-AR02, complete genome
          Length = 134431

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    gccgcgctgctggcggccgt 82
             ||||||||||||||||||||
Sbjct: 68564 gccgcgctgctggcggccgt 68583



to top

>gb|AY512913.1| Mus musculus clone NIA:K0221A09 unknown mRNA
          Length = 1628

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 23 cttcttcttcctcctccttt 4



to top

>gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome 10, complete sequence
          Length = 232473

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     tggcttcttcttcctcctcc 41
              ||||||||||||||||||||
Sbjct: 206614 tggcttcttcttcctcctcc 206595



to top

>gb|AC141563.3| Mus musculus BAC clone RP23-410M22 from chromosome 6, complete sequence
          Length = 186983

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 30350 cttcttcttcctcctccttt 30369



to top

>gb|AC129013.3| Mus musculus BAC clone RP24-550P17 from chromosome 6, complete sequence
          Length = 169094

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 112617 cttcttcttcctcctccttt 112598



to top

>gb|DQ483819.1| Gymnogyps californianus clone 242F microsatellite sequence
          Length = 551

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 354 cttcttcttcctcctccttt 335



to top

>gb|DQ483785.1| Gymnogyps californianus clone 208F microsatellite sequence
          Length = 564

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 184 cttcttcttcctcctccttt 203



to top

>gb|DQ483551.1| Gymnogyps californianus clone 110D microsatellite sequence
          Length = 579

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 355 cttcttcttcctcctccttt 336



to top

>gb|DQ483458.1| Gymnogyps californianus clone 17D microsatellite sequence
          Length = 344

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 92  cttcttcttcctcctccttt 111



to top

>gb|DQ484033.1| Gymnogyps californianus clone 199G microsatellite sequence
          Length = 1541

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 829 cttcttcttcctcctccttt 810



to top

>gb|DQ484027.1| Gymnogyps californianus clone 193G microsatellite sequence
          Length = 349

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 94  cttcttcttcctcctccttt 113



to top

>gb|DQ483993.1| Gymnogyps californianus clone 159G microsatellite sequence
          Length = 541

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 355 cttcttcttcctcctccttt 336



to top

>gb|DQ483980.1| Gymnogyps californianus clone 146G microsatellite sequence
          Length = 558

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 205 cttcttcttcctcctccttt 224



to top

>gb|DQ483845.1| Gymnogyps californianus clone 11G microsatellite sequence
          Length = 653

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 430 cttcttcttcctcctccttt 411



to top

>gb|DQ483838.1| Gymnogyps californianus clone 4G microsatellite sequence
          Length = 791

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 206 cttcttcttcctcctccttt 225



to top

>gb|DQ483428.1| Gymnogyps californianus clone 131H microsatellite sequence
          Length = 349

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 256 cttcttcttcctcctccttt 237



to top

>gb|DQ483424.1| Gymnogyps californianus clone 127H microsatellite sequence
          Length = 1202

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 201 cttcttcttcctcctccttt 220



to top

>gb|DQ483419.1| Gymnogyps californianus clone 122H microsatellite sequence
          Length = 786

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 603 cttcttcttcctcctccttt 584



to top

>gb|DQ483406.1| Gymnogyps californianus clone 109H microsatellite sequence
          Length = 480

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 330 cttcttcttcctcctccttt 311



to top

>gb|DQ483399.1| Gymnogyps californianus clone 102H microsatellite sequence
          Length = 446

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 356 cttcttcttcctcctccttt 337



to top

>gb|DQ483359.1| Gymnogyps californianus clone 62H microsatellite sequence
          Length = 346

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 94  cttcttcttcctcctccttt 113



to top

>gb|DQ483303.1| Gymnogyps californianus clone 6H microsatellite sequence
          Length = 387

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 136 cttcttcttcctcctccttt 155



to top

>ref|XM_824533.1| Trypanosoma brucei TREU927 hypothetical protein (Tb11.01.7330)
            partial mRNA
          Length = 3030

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 1573 cttcttcttcctcctccttt 1554



to top

>ref|XM_540368.2| PREDICTED: Canis familiaris similar to POU domain, class 6,
            transcription factor 2 (Retina-derived POU-domain
            factor-1) (RPF-1) (LOC483249), mRNA
          Length = 1869

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 23   ggcttcttcttcctcctcct 42
            ||||||||||||||||||||
Sbjct: 1131 ggcttcttcttcctcctcct 1150



to top

>gb|AC124473.2| Mus musculus BAC clone RP24-86K23 from chromosome 3, complete sequence
          Length = 185436

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 79745 cttcttcttcctcctccttt 79726



to top

>ref|XM_570774.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNE00600) partial mRNA
          Length = 897

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 853 cttcttcttcctcctccttt 834



to top

>gb|AC121842.3| Mus musculus BAC clone RP24-80L24 from chromosome 3, complete sequence
          Length = 173273

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 98855 cttcttcttcctcctccttt 98874



to top

>ref|XM_803101.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053510075.30) partial mRNA
          Length = 5214

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 4880 cttcttcttcctcctccttt 4899



to top

>gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosome 10, complete
             sequence
          Length = 222101

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 22    tggcttcttcttcctcctcc 41
             ||||||||||||||||||||
Sbjct: 40737 tggcttcttcttcctcctcc 40718



to top

>gb|AC115294.5| Mus musculus BAC clone RP23-97A19 from chromosome 3, complete sequence
          Length = 149451

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 146064 cttcttcttcctcctccttt 146045



to top

>gb|BC015892.1| Homo sapiens zinc finger protein 35 (clone HF.10), mRNA (cDNA clone
           IMAGE:3910805), containing frame-shift errors
          Length = 2496

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 277 cttcttcttcctcctccttt 258



to top

>gb|AC125078.2| Mus musculus BAC clone RP23-478C7 from chromosome 6, complete sequence
          Length = 204570

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 99966 ttcttcttcctcctcctttc 99985



to top

>gb|AC121926.3| Mus musculus BAC clone RP24-202B3 from chromosome 10, complete sequence
          Length = 185398

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 75351 ttcttcttcctcctcctttc 75370



to top

>ref|XM_798654.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053508079.10) partial mRNA
          Length = 1676

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   gcttcttcttcctcctcctt 43
            ||||||||||||||||||||
Sbjct: 1255 gcttcttcttcctcctcctt 1236



to top

>gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, complete sequence
          Length = 170072

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 110809 cttcttcttcctcctccttt 110828



to top

>gb|AC098890.3| Mus musculus BAC clone RP23-122P22 from X, complete sequence
          Length = 202740

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 135814 cttcttcttcctcctccttt 135795



to top

>ref|XM_734600.1| Plasmodium chabaudi chabaudi hypothetical protein (PC100079.00.0)
           partial mRNA
          Length = 316

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 250 cttcttcttcctcctccttt 231



to top

>gb|AC102527.6| Mus musculus chromosome 8, clone RP23-29G4, complete sequence
          Length = 197976

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 135412 cttcttcttcctcctccttt 135393



to top

>gb|AC142499.9| Mus musculus strain C57BL/6J clone rp23-333m15, complete sequence
          Length = 215706

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 132206 cttcttcttcctcctccttt 132225



to top

>gb|AC109169.13| Mus musculus chromosome 6, clone RP23-5D6, complete sequence
          Length = 204911

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 156883 cttcttcttcctcctccttt 156902



to top

>gb|AC012397.33| Mus musculus strain 129/Sv clone ct7-369p18 map 6, complete
           sequence
          Length = 140198

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 726 cttcttcttcctcctccttt 707



to top

>gb|AC160032.7| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 200439

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 3378 cttcttcttcctcctccttt 3397



to top

>emb|AL606970.12| Human DNA sequence from clone RP11-503C24 on chromosome 6 Contains the 3'
              end of a novel gene, up to five novel genes, (inclusing
              FLJ31232 and pp13671), a meningioma expressed antigen 6
              (coiled-coil proline-rich) (MGEA6) pseudogene and three CpG
              islands, complete sequence
          Length = 161863

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 120060 cttcttcttcctcctccttt 120079



to top

>ref|XM_793038.1| PREDICTED: Strongylocentrotus purpuratus similar to RAN binding
            protein 2 (LOC593568), mRNA
          Length = 2994

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 2827 cttcttcttcctcctccttt 2808



 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 2713 cttcttcttcctcctccttt 2694



to top

>gb|BC055360.1| Mus musculus cDNA clone IMAGE:30046664, partial cds
          Length = 1653

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 35 cttcttcttcctcctccttt 16



to top

>gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, complete sequence
          Length = 166808

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 101290 cttcttcttcctcctccttt 101309



to top

>gb|AC109542.6| Rattus norvegicus 1 BAC CH230-270O15 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 246913

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 80672 cttcttcttcctcctccttt 80653



to top

>ref|XM_790439.1| PREDICTED: Strongylocentrotus purpuratus similar to Janus kinase 2
            (LOC590852), mRNA
          Length = 1905

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 1861 cttcttcttcctcctccttt 1842



 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 1747 cttcttcttcctcctccttt 1728



to top

>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
              Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 120    ctgtgcgtggactactactactgcacgtgccc 151
              ||||||| ||| |||||| |||||||||||||
Sbjct: 637719 ctgtgcgaggagtactacgactgcacgtgccc 637688



to top

>emb|X07289.1|HSHF10 Human HF.10 gene mRNA
          Length = 1726

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 268 cttcttcttcctcctccttt 249



to top

>gb|AC160970.7| Mus musculus BAC clone RP24-492D11 from chromosome 10, complete
             sequence
          Length = 205283

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 90985 cttcttcttcctcctccttt 91004



to top

>emb|BX640451.1| Bordetella bronchiseptica strain RB50, complete genome; segment 15/16
          Length = 343473

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     caccttggccgcgctgctgg 75
              ||||||||||||||||||||
Sbjct: 323959 caccttggccgcgctgctgg 323940



to top

>emb|BX640436.1| Bordetella parapertussis strain 12822, complete genome; segment 14/14
          Length = 255260

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     caccttggccgcgctgctgg 75
              ||||||||||||||||||||
Sbjct: 116336 caccttggccgcgctgctgg 116317



to top

>emb|AL669822.10| Mouse DNA sequence from clone RP23-47J12 on chromosome 11 Contains the 5'
              end of the Cobl gene for cordon-bleu and a CpG island,
              complete sequence
          Length = 137869

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     tggcttcttcttcctcctcc 41
              ||||||||||||||||||||
Sbjct: 113431 tggcttcttcttcctcctcc 113450



to top

>gb|BT007738.1| Synthetic construct Homo sapiens zinc finger protein 35 (clone
          HF.10) mRNA, partial cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 55 cttcttcttcctcctccttt 36



to top

>gb|BT006962.1| Homo sapiens zinc finger protein 35 (clone HF.10) mRNA, complete
          cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 55 cttcttcttcctcctccttt 36



to top

>emb|AL805916.7| Mouse DNA sequence from clone RP23-164N15 on chromosome 11 Contains
            the 3' end of a novel gene (4933435A13Rik), the Rel gene
            for reticuloendotheliosis oncogene and a CpG island,
            complete sequence
          Length = 73703

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 4451 cttcttcttcctcctccttt 4470



to top

>emb|AL663082.5| Mouse DNA sequence from clone RP23-327G1 on chromosome 11 Contains the 3'
              end of the Ankfy1 gene for ankyrin repeat and FYVE domain
              containing 1, a new gene, the gene for a novel ZZ type zinc
              finger domain containing protein, the 5' end of the Atp2a3
              gene for ubiquitous Ca++ transporting ATPase and two CpG
              islands, complete sequence
          Length = 243654

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 143592 cttcttcttcctcctccttt 143611



to top

>emb|AL929499.5| Mouse DNA sequence from clone RP23-116K8 on chromosome 4 Contains a
             capping protein alpha 1 (Cappa1) pseudogene, complete
             sequence
          Length = 159369

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 20    catggcttcttcttcctcctcctt 43
             ||||||||||||| ||||||||||
Sbjct: 85650 catggcttcttctgcctcctcctt 85673



to top

>gb|AC119909.12| Mus musculus chromosome 8, clone RP24-241I4, complete sequence
          Length = 150332

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 53312 cttcttcttcctcctccttt 53331



to top

>gb|AC087889.15| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, RP23-337L15, Complete
              Sequence, complete sequence
          Length = 215756

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     tggcttcttcttcctcctcc 41
              ||||||||||||||||||||
Sbjct: 101879 tggcttcttcttcctcctcc 101860



to top

>gb|AC007961.32| Mus musculus strain 129S6/SvEvTac clone rp21-594l4 map 10, complete
              sequence
          Length = 180585

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 163043 cttcttcttcctcctccttt 163062



to top

>gb|AC092046.2| Homo sapiens chromosome 3 clone RP11-189H19, complete sequence
          Length = 170486

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 70281 cttcttcttcctcctccttt 70300



to top

>gb|AC068654.2| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare Clone OSJNBa0015O22 From Chromosome 10, complete
              sequence
          Length = 189349

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 120    ctgtgcgtggactactactactgcacgtgccc 151
              ||||||| ||| |||||| |||||||||||||
Sbjct: 105327 ctgtgcgaggagtactacgactgcacgtgccc 105296



to top

>gb|AC099669.2| Homo sapiens chromosome 3 clone RP11-944L7, complete sequence
          Length = 217035

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 207845 cttcttcttcctcctccttt 207826



to top

>gb|AC007844.32| Mus musculus strain 129/Sv ES cell line CJ7 chromosome 6 clone
              ct7-541l22, complete sequence
          Length = 152316

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 111507 cttcttcttcctcctccttt 111488



to top

>emb|AL732483.8| Mouse DNA sequence from clone RP23-70K10 on chromosome 2, complete
             sequence
          Length = 201542

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 84382 ttcttcttcctcctcctttc 84363



to top

>gb|AC099760.5| Mus musculus BAC clone RP23-122E16 from chromosome 8, complete sequence
          Length = 193884

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     gcttcttcttcctcctcctt 43
              ||||||||||||||||||||
Sbjct: 143423 gcttcttcttcctcctcctt 143404



to top

>gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome 16, complete sequence
          Length = 244730

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 105659 cttcttcttcctcctccttt 105678



to top

>gb|AC101817.13| Mus musculus chromosome 15, clone RP24-359I22, complete sequence
          Length = 149843

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 125354 cttcttcttcctcctccttt 125373



to top

>gb|AC104195.10| Mus musculus chromosome 5, clone RP24-95O4, complete sequence
          Length = 214251

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 199561 cttcttcttcctcctccttt 199542



to top

>emb|BX323875.15| Zebrafish DNA sequence from clone CH211-135L21 in linkage group 17,
             complete sequence
          Length = 173617

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    ggcttcttcttcctcctcct 42
             ||||||||||||||||||||
Sbjct: 59201 ggcttcttcttcctcctcct 59182



to top

>gb|AE008684.1|AE008684 Mus musculus T-cell receptor alpha/delta locus  section 2 of 4 of the
             complete region
          Length = 400099

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 21453 cttcttcttcctcctccttt 21434



to top

>emb|BX935708.2| Gallus gallus finished cDNA, clone ChEST326o24
          Length = 1267

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 205 cttcttcttcctcctccttt 186



to top

>gb|AC159192.2| Mus musculus BAC clone RP24-121M18 from chromosome 13, complete sequence
          Length = 180418

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 24     gcttcttcttcctcctcctt 43
              ||||||||||||||||||||
Sbjct: 147499 gcttcttcttcctcctcctt 147518



to top

>gb|AC152954.1| Mus musculus 6 BAC RP23-296N5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 203474

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    ggcttcttcttcctcctcct 42
             ||||||||||||||||||||
Sbjct: 13442 ggcttcttcttcctcctcct 13423



to top

>dbj|AK017207.1| Mus musculus 11 days pregnant adult female ovary and uterus cDNA,
           RIKEN full-length enriched library, clone:5033430J04
           product:C-type lectin related f, full insert sequence
          Length = 1212

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 29  ttcttcctcctcctttcggg 48
           ||||||||||||||||||||
Sbjct: 589 ttcttcctcctcctttcggg 570



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10,
              complete sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 120    ctgtgcgtggactactactactgcacgtgccc 151
              ||||||| ||| |||||| |||||||||||||
Sbjct: 637719 ctgtgcgaggagtactacgactgcacgtgccc 637688



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 26      ttcttcttcctcctcctttc 45
               ||||||||||||||||||||
Sbjct: 8096472 ttcttcttcctcctcctttc 8096491



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 25       cttcttcttcctcctcctt 43
                |||||||||||||||||||
Sbjct: 24934682 cttcttcttcctcctcctt 24934700



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 23       ggcttcttcttcctcctcct 42
                ||||||||||||||||||||
Sbjct: 21199872 ggcttcttcttcctcctcct 21199891



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 24       gcttcttcttcctcctcct 42
                |||||||||||||||||||
Sbjct: 20337869 gcttcttcttcctcctcct 20337887



to top

>gb|AC092608.2| Homo sapiens BAC clone RP11-154F14 from 4, complete sequence
          Length = 196952

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 39052 cttcttcttcctcctccttt 39033



to top

>gb|AF369029.2| White spot syndrome virus, complete genome
          Length = 292967

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     ggcttcttcttcctcctcct 42
              ||||||||||||||||||||
Sbjct: 249770 ggcttcttcttcctcctcct 249751



to top

>dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1064G04
          Length = 186704

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ggcttcttcttcctcctcct 42
             ||||||||||||||||||||
Sbjct: 97381 ggcttcttcttcctcctcct 97400



to top

>emb|BX931778.1| Gallus gallus finished cDNA, clone ChEST797a3
          Length = 1174

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 108 cttcttcttcctcctccttt 89



to top

>gb|AY183422.1| Phytophthora sojae clone 10-11f-MY unknown protein mRNA, complete
          cds
          Length = 460

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 58 ccttggccgcgctgctggcggccg 81
          ||||||| ||||||||||||||||
Sbjct: 37 ccttggcggcgctgctggcggccg 60



to top

>gb|AY087551.1| Arabidopsis thaliana clone 3657 mRNA, complete sequence
          Length = 485

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 257 cttcttcttcctcctccttt 238



to top

>emb|AL772151.17| Mouse DNA sequence from clone RP23-320C6 on chromosome 4, complete
            sequence
          Length = 128073

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 8138 cttcttcttcctcctccttt 8157



to top

>dbj|AP005004.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0503B05
          Length = 156814

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 84665 ttcttcttcctcctcctttc 84684



to top

>gb|AY891687.1| Synthetic construct Homo sapiens clone FLH013101.01L zinc finger
          protein 35 (ZNF35) mRNA, partial cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 55 cttcttcttcctcctccttt 36



to top

>gb|AY889142.1| Synthetic construct Homo sapiens clone FLH013105.01X zinc finger
          protein 35 (ZNF35) mRNA, complete cds
          Length = 1560

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 25 cttcttcttcctcctccttt 44
          ||||||||||||||||||||
Sbjct: 55 cttcttcttcctcctccttt 36



to top

>dbj|AB019236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXK3
          Length = 81494

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 37164 cttcttcttcctcctccttt 37145



to top

>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome
          Length = 307287

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     ggcttcttcttcctcctcct 42
              ||||||||||||||||||||
Sbjct: 234329 ggcttcttcttcctcctcct 234310



to top

>dbj|AK104730.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-C06, full
           insert sequence
          Length = 1447

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 120 ctgtgcgtggactactactactgcacgtgccc 151
           ||||||| ||| |||||| |||||||||||||
Sbjct: 156 ctgtgcgaggagtactacgactgcacgtgccc 187



to top

>dbj|AK104633.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-C08, full
           insert sequence
          Length = 1382

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 120 ctgtgcgtggactactactactgcacgtgccc 151
           ||||||| ||| |||||| |||||||||||||
Sbjct: 91  ctgtgcgaggagtactacgactgcacgtgccc 122



to top

>gb|AC122431.4| Mus musculus BAC clone RP24-176L8 from 6, complete sequence
          Length = 156005

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 96421 ttcttcttcctcctcctttc 96440



to top

>gb|AC152922.5| Mus musculus BAC clone RP24-386D3 from 10, complete sequence
          Length = 191855

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 26   ttcttcttcctcctcctttc 45
            ||||||||||||||||||||
Sbjct: 7986 ttcttcttcctcctcctttc 8005



to top

>dbj|AK061462.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-B11, full
           insert sequence
          Length = 1447

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 120 ctgtgcgtggactactactactgcacgtgccc 151
           ||||||| ||| |||||| |||||||||||||
Sbjct: 156 ctgtgcgaggagtactacgactgcacgtgccc 187



to top

>gb|AC104892.10| Mus musculus chromosome 18, clone RP23-262H4, complete sequence
          Length = 190380

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 145594 cttcttcttcctcctccttt 145575



to top

>tpe|BN000654.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx125 gene
           for class III peroxidase 125 precursor, exons 1-3
          Length = 2806

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 120 ctgtgcgtggactactactactgcacgtgccc 151
           ||||||| ||| |||||| |||||||||||||
Sbjct: 97  ctgtgcgaggagtactacgactgcacgtgccc 128



to top

>emb|CT025599.16| Mouse DNA sequence from clone RP24-254G12 on chromosome 14, complete
             sequence
          Length = 170436

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 64475 ttcttcttcctcctcctttc 64494



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 64653 cttcttcttcctcctcctt 64671



to top

>gb|AC151669.5| Mus musculus chromosome 5, clone RP23-44L13, complete sequence
          Length = 254022

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 163689 cttcttcttcctcctccttt 163708



to top

>gb|AC107808.20| Mus musculus chromosome 9, clone RP23-61B14, complete sequence
          Length = 188589

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 64716 cttcttcttcctcctccttt 64735



to top

>dbj|AP002962.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-652L8, complete
              sequence
          Length = 160222

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 143862 cttcttcttcctcctccttt 143843



to top

>emb|AL805963.23| Mouse DNA sequence from clone RP23-98K7 on chromosome X, complete
              sequence
          Length = 233546

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 151987 cttcttcttcctcctccttt 152006



to top

>emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chromosome 4, complete
             sequence
          Length = 230886

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 47666 cttcttcttcctcctccttt 47685



to top

>gb|AC162863.5| Mus musculus chromosome 15, clone RP23-276I6, complete sequence
          Length = 199969

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 185770 cttcttcttcctcctccttt 185789



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 120    ctgtgcgtggactactactactgcacgtgccc 151
              ||||||| ||| |||||| |||||||||||||
Sbjct: 637716 ctgtgcgaggagtactacgactgcacgtgccc 637685



to top

>gb|AC139241.4| Mus musculus BAC clone RP24-79L4 from 3, complete sequence
          Length = 200361

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 80548 cttcttcttcctcctccttt 80529



to top

>gb|AC140454.4| Mus musculus BAC clone RP24-163I14 from 1, complete sequence
          Length = 171533

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 59502 cttcttcttcctcctccttt 59483



to top

>gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complete sequence
          Length = 222299

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    ttcttcttcctcctcctttc 45
             ||||||||||||||||||||
Sbjct: 78942 ttcttcttcctcctcctttc 78961



to top

>gb|AC003994.1|AC003994 Mouse cosmid ma53a271 from 14D1-D2 (Mouse T-Cell Receptor Alpha
            Locus), complete sequence
          Length = 43576

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 7578 cttcttcttcctcctccttt 7559



to top

>emb|AL928992.7| Mouse DNA sequence from clone RP23-208O9 on chromosome 2, complete
             sequence
          Length = 136064

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 53177 cttcttcttcctcctccttt 53196



to top

>gb|AC154793.2| Mus musculus BAC clone RP23-88B6 from chromosome 13, complete sequence
          Length = 182356

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    gcttcttcttcctcctcctt 43
             ||||||||||||||||||||
Sbjct: 19725 gcttcttcttcctcctcctt 19744



to top

>gb|M76702.1|HUMZNF35P2 Homo sapiens zinc finger protein 35 (ZNF35) gene, exon 2
          Length = 416

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 25  cttcttcttcctcctccttt 44
           ||||||||||||||||||||
Sbjct: 253 cttcttcttcctcctccttt 234



to top

>gb|AC153971.3| Mus musculus 10 BAC RP24-254O21 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 159743

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 17771 cttcttcttcctcctccttt 17752



to top

>gb|AC153964.3| Mus musculus 10 BAC RP24-399H20 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 173453

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 29626 cttcttcttcctcctccttt 29645



to top

>gb|AC152980.2| Mus musculus 10 BAC RP23-462F3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 165602

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 84024 cttcttcttcctcctccttt 84005



to top

>emb|AL591209.17| Mouse DNA sequence from clone RP23-309H19 on chromosome 11, complete
              sequence
          Length = 199634

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 105650 cttcttcttcctcctccttt 105631



to top

>emb|AL590429.9| Mouse DNA sequence from clone RP23-462O16 on chromosome 2, complete
             sequence
          Length = 190669

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 42262 cttcttcttcctcctccttt 42243



to top

>gb|AC101660.25| Mus musculus chromosome 15, clone RP23-4I22, complete sequence
          Length = 188464

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 2573 cttcttcttcctcctccttt 2592



to top

>gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, complete sequence
          Length = 184908

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 18274 cttcttcttcctcctccttt 18255



to top

>gb|AC166241.7| Mus musculus chromosome 8, clone RP23-125A7, complete sequence
          Length = 208067

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     cttcttcttcctcctccttt 44
              ||||||||||||||||||||
Sbjct: 124368 cttcttcttcctcctccttt 124387



to top

>emb|AL671732.15| Mouse DNA sequence from clone RP23-309O6 on chromosome X, complete
            sequence
          Length = 128748

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   cttcttcttcctcctccttt 44
            ||||||||||||||||||||
Sbjct: 7902 cttcttcttcctcctccttt 7883



to top

>emb|AL831759.5| Mouse DNA sequence from clone RP23-150J13 on chromosome X, complete
             sequence
          Length = 29788

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    catggcttcttcttcctcct 39
             ||||||||||||||||||||
Sbjct: 22817 catggcttcttcttcctcct 22798



to top

>emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chromosome 2, complete
             sequence
          Length = 92562

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cttcttcttcctcctccttt 44
             ||||||||||||||||||||
Sbjct: 48381 cttcttcttcctcctccttt 48362



to top

>emb|AL669925.8| Mouse DNA sequence from clone RP23-174D24 on chromosome 11, complete
             sequence
          Length = 69520

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    ggcttcttcttcctcctcct 42
             ||||||||||||||||||||
Sbjct: 10251 ggcttcttcttcctcctcct 10232



to top

>gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, complete sequence
          Length = 168270

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 26    ttcttcttcctcctccttt 44
             |||||||||||||||||||
Sbjct: 44592 ttcttcttcctcctccttt 44574



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 61      tggccgcgctgctggcggc 79
               |||||||||||||||||||
Sbjct: 3272896 tggccgcgctgctggcggc 3272914



to top

>ref|NM_133433.2| Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript
           variant A, mRNA
          Length = 9717

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  gcttcttcttcctcctcct 42
           |||||||||||||||||||
Sbjct: 136 gcttcttcttcctcctcct 118



to top

>ref|NM_015384.3| Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript
           variant B, mRNA
          Length = 8648

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  gcttcttcttcctcctcct 42
           |||||||||||||||||||
Sbjct: 136 gcttcttcttcctcctcct 118



to top

>ref|NM_114958.2| Arabidopsis thaliana unknown protein AT3G50980 mRNA, complete cds
          Length = 589

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 280 cttcttcttcctcctcctt 262



to top

>ref|NM_105228.2| Arabidopsis thaliana calcium ion binding AT1G65540 mRNA, complete cds
          Length = 2211

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 25   cttcttcttcctcctcctt 43
            |||||||||||||||||||
Sbjct: 1543 cttcttcttcctcctcctt 1525



to top

>ref|NM_105156.1| Arabidopsis thaliana antiporter/ drug transporter AT1G64820 mRNA,
          complete cds
          Length = 1509

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 25 cttcttcttcctcctcctt 43
          |||||||||||||||||||
Sbjct: 46 cttcttcttcctcctcctt 28



to top

>gb|AC119220.11| Mus musculus chromosome 1, clone RP24-201K16, complete sequence
          Length = 162827

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     cttcttcttcctcctcctt 43
              |||||||||||||||||||
Sbjct: 150541 cttcttcttcctcctcctt 150523



to top

>ref|NM_118905.1| Arabidopsis thaliana unknown protein AT4G27660 mRNA, complete cds
          Length = 627

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 112 cttcttcttcctcctcctt 94



to top

>ref|NM_128655.3| Arabidopsis thaliana ATP binding / kinase/ protein kinase/
          protein serine/threonine kinase/ protein-tyrosine
          kinase AT2G31010 mRNA, complete cds
          Length = 3023

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 25 cttcttcttcctcctcctt 43
          |||||||||||||||||||
Sbjct: 25 cttcttcttcctcctcctt 43



to top

>gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome 7, complete sequence
          Length = 172958

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 23736 cttcttcttcctcctcctt 23718



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 23357 cttcttcttcctcctcctt 23339



to top

>gb|AC147806.5| Mus musculus chromosome 1, clone RP23-6O16, complete sequence
          Length = 229200

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 41247 cttcttcttcctcctcctt 41265



to top

>gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, complete sequence
          Length = 211052

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     cttcttcttcctcctcctt 43
              |||||||||||||||||||
Sbjct: 107400 cttcttcttcctcctcctt 107382



to top

>gb|AC159312.2| Mus musculus BAC clone RP23-156N21 from chromosome 12, complete sequence
          Length = 205080

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 25     cttcttcttcctcctcctt 43
              |||||||||||||||||||
Sbjct: 198760 cttcttcttcctcctcctt 198778



to top

>gb|AC158357.4| Mus musculus BAC clone RP23-434L22 from chromosome 8, complete sequence
          Length = 217671

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     cttcttcttcctcctcctt 43
              |||||||||||||||||||
Sbjct: 139896 cttcttcttcctcctcctt 139878



to top

>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence
          Length = 174746

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    tcttcttcctcctcctttc 45
             |||||||||||||||||||
Sbjct: 55913 tcttcttcctcctcctttc 55895



to top

>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence
          Length = 182658

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 26009 cttcttcttcctcctcctt 25991



to top

>gb|AC165224.9| Mus musculus chromosome 5, clone RP24-389L10, complete sequence
          Length = 155046

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    tcttcttcctcctcctttc 45
             |||||||||||||||||||
Sbjct: 66409 tcttcttcctcctcctttc 66391



to top

>gb|AY355461.1| Homo sapiens MNK1-like kinase 1b (MNK1B) mRNA, complete cds
          Length = 1238

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 24 gcttcttcttcctcctcct 42
          |||||||||||||||||||
Sbjct: 94 gcttcttcttcctcctcct 76



to top

>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence
          Length = 172348

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 21328 cttcttcttcctcctcctt 21346



to top

>ref|XM_521135.1| PREDICTED: Pan troglodytes similar to cysteine-rich hydrophobic 1
           (CHIC1) protein (LOC465715), mRNA
          Length = 579

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  gcttcttcttcctcctcct 42
           |||||||||||||||||||
Sbjct: 221 gcttcttcttcctcctcct 203



to top

>gb|AC155825.2| Mus musculus BAC clone RP23-54D15 from chromosome 16, complete sequence
          Length = 192183

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    gcttcttcttcctcctcct 42
             |||||||||||||||||||
Sbjct: 25209 gcttcttcttcctcctcct 25191



to top

>gb|AC135668.5| Mus musculus BAC clone RP23-280P7 from chromosome 6, complete
            sequence
          Length = 207975

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 25   cttcttcttcctcctcctt 43
            |||||||||||||||||||
Sbjct: 1760 cttcttcttcctcctcctt 1778



to top

>gb|AC161342.10| Mus musculus chromosome 1, clone RP23-313K17, complete sequence
          Length = 181572

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 25     cttcttcttcctcctcctt 43
              |||||||||||||||||||
Sbjct: 176755 cttcttcttcctcctcctt 176773



to top

>gb|AC169209.2| Mus musculus chromosome 7, clone wi1-98D1, complete sequence
          Length = 36694

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 25   cttcttcttcctcctcctt 43
            |||||||||||||||||||
Sbjct: 3219 cttcttcttcctcctcctt 3237



to top

>ref|XM_483507.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1950

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 157 cttcttcttcctcctcctt 175



to top

>ref|XM_507598.1| PREDICTED Oryza sativa (japonica cultivar-group), P0702E04.39 mRNA
          Length = 1988

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 215 cttcttcttcctcctcctt 233



to top

>ref|XM_507306.1| PREDICTED Oryza sativa (japonica cultivar-group), P0702E04.39 mRNA
          Length = 1988

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 215 cttcttcttcctcctcctt 233



to top

>ref|XM_474057.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 465

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 139 cttcttcttcctcctcctt 121



to top

>ref|XM_520459.1| PREDICTED: Pan troglodytes similar to SWI/SNF-related
            matrix-associated actin-dependent regulator of chromatin
            a2 isoform b; SNF2-alpha; SNF2-like 2; SNF2/SWI2-like
            protein 2; sucrose nonfermenting 2-like protein 2; global
            transcription activator homologous sequence ...
            (LOC464965), mRNA
          Length = 4418

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 25   cttcttcttcctcctcctt 43
            |||||||||||||||||||
Sbjct: 1850 cttcttcttcctcctcctt 1832



to top

>gb|AC162898.10| Mus musculus chromosome 5, clone RP23-391P21, complete sequence
          Length = 202279

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 17    caacatggcttcttcttcctcct 39
             ||||||||||||||| |||||||
Sbjct: 38335 caacatggcttcttcctcctcct 38357



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 65      cgcgctgctggcggccgtc 83
               |||||||||||||||||||
Sbjct: 3397825 cgcgctgctggcggccgtc 3397843



 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 63     gccgcgctgctggcggccg 81
              |||||||||||||||||||
Sbjct: 877531 gccgcgctgctggcggccg 877549



to top

>gb|AC102638.13| Mus musculus chromosome 3, clone RP23-406D2, complete sequence
          Length = 172817

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cttcttcttcctcctcctt 43
             |||||||||||||||||||
Sbjct: 94237 cttcttcttcctcctcctt 94255



to top

>ref|NM_193355.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1440

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  gcttcttcttcctcctcct 42
           |||||||||||||||||||
Sbjct: 137 gcttcttcttcctcctcct 119



to top

>ref|XM_469232.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 384

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 24  gcttcttcttcctcctcct 42
           |||||||||||||||||||
Sbjct: 253 gcttcttcttcctcctcct 235



to top

>gb|AC158121.12| Mus musculus chromosome 5, clone RP23-440H19, complete sequence
          Length = 202895

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 24     gcttcttcttcctcctcct 42
              |||||||||||||||||||
Sbjct: 191103 gcttcttcttcctcctcct 191085



to top

>ref|XM_525881.1| PREDICTED: Pan troglodytes similar to Ubiquinol-cytochrome C
           reductase complex 11 kDa protein, mitochondrial
           precursor (Mitochondrial hinge protein) (Cytochrome C1,
           nonheme 11 kDa protein) (Complex III subunit VIII)
           (LOC470500), mRNA
          Length = 327

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  cttcttcttcctcctcctt 43
           |||||||||||||||||||
Sbjct: 106 cttcttcttcctcctcctt 88


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,740,138
Number of Sequences: 3902068
Number of extensions: 1740138
Number of successful extensions: 239028
Number of sequences better than 10.0: 788
Number of HSP's better than 10.0 without gapping: 799
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 229462
Number of HSP's gapped (non-prelim): 9516
length of query: 153
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 132
effective length of database: 17,151,101,840
effective search space: 2263945442880
effective search space used: 2263945442880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top