ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet59a04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 569 e-159
2gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrins... 454 e-125
3gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 436 e-119
4dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 250 2e-63
5gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 216 3e-53
6gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 214 1e-52
7gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 214 1e-52
8emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri... 210 2e-51
9gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein... 210 2e-51
10gb|AY103580.1| Zea mays PCO072544 mRNA sequence 202 5e-49
11gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 202 5e-49
12emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 192 5e-46
13emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 172 4e-40
14dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 172 4e-40
15dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D... 172 4e-40
16dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D... 172 4e-40
17dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 4e-40
18dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 4e-40
19dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 172 4e-40
20emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 170 2e-39
21dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
22dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 157 3e-35
23gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 155 1e-34
24emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein 149 6e-33
25gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co... 149 6e-33
26dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
27dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
28dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
29dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
30dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 9e-29
31dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane... 125 9e-26
32gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 125 9e-26
33emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 123 4e-25
34ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 117 2e-23
35gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein... 98 2e-17
36gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp... 90 5e-15
37gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 86 8e-14
38ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA 82 1e-12
39dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D... 82 1e-12
40dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 1e-12
41gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic pro... 80 5e-12
42dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 80 5e-12
43dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran... 76 7e-11
44gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 74 3e-10
45emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl... 70 5e-09
46dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in... 68 2e-08
47dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra... 68 2e-08
48gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 66 7e-08
49gb|AF145707.1|AF145707 Lotus japonicus clone LJ-AQP1 plasma memb... 66 7e-08
50dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ... 66 7e-08
51gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat... 64 3e-07
52gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma... 64 3e-07
53gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds 64 3e-07
54gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl... 60 4e-06
55dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3... 60 4e-06
56dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds 60 4e-06
57ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 58 2e-05
58emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 58 2e-05
59emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 58 2e-05
60emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 58 2e-05
61gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 58 2e-05
62gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 58 2e-05
63emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
64gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali... 58 2e-05
65gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 58 2e-05
66gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 58 2e-05
67gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR... 56 7e-05
68gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 52 0.001
69dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 52 0.001
70dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 52 0.001
71ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 50 0.004
72emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 50 0.004
73gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.004
74emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 50 0.004
75dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ... 50 0.004
76emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 48 0.017
77gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 48 0.017
78gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protei... 48 0.017
79gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co... 48 0.017
80dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 46 0.066
81gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 46 0.066
82dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 46 0.066
83gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 44 0.26
84emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 44 0.26
85emb|AJ251105.1|ETE251105 Echinops telfairi partial aqp2 gene for... 44 0.26
86emb|AJ251104.1|TEC251104 Tenrec ecaudatus partial aqp2 gene for ... 44 0.26
87emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ... 44 0.26
88dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.26
89dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.26
90dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.26
91gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 44 0.26
92ref|XM_526747.1| PREDICTED: Pan troglodytes similar to hypotheti... 42 1.0
93gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 42 1.0
94gb|AC108477.5| Homo sapiens BAC clone RP11-499F19 from 4, comple... 42 1.0
95emb|BX029520.1|CNS08UXW Single read from an extremity of a full-... 42 1.0
96gb|AE012531.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 1.0
97gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat... 42 1.0
98gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 1.0
99gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 42 1.0
100gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 42 1.0
101gb|AC095057.3| Homo sapiens BAC clone RP11-395I6 from 4, complet... 42 1.0
102emb|AL079303.3|CNS00M8O Human chromosome 14 DNA sequence BAC R-9... 42 1.0
103emb|AL928567.6| Mouse DNA sequence from clone RP23-296K20 on chr... 42 1.0
104dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote... 42 1.0
105ref|XM_462670.1| Oryza sativa (japonica cultivar-group), predic... 40 4.1
106ref|NM_192161.1| Oryza sativa (japonica cultivar-group), predic... 40 4.1
107ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 40 4.1
108gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 4.1
109gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 4.1
110ref|XM_430201.1| PREDICTED: Gallus gallus hypothetical gene supp... 40 4.1
111gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, com... 40 4.1
112gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome... 40 4.1
113gb|AC152166.4| Mus musculus BAC clone RP23-425A3 from chromosome... 40 4.1
114gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, c... 40 4.1
115gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 4.1
116gb|AC124680.10| Mus musculus chromosome 14, clone RP23-383A19, c... 40 4.1
117gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds 40 4.1
118emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in l... 40 4.1
119gb|AC124345.4| Mus musculus BAC clone RP24-459N19 from chromosom... 40 4.1
120gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, comple... 40 4.1
121emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chr... 40 4.1
122emb|AL359963.29| Human DNA sequence from clone RP11-18A3 on chro... 40 4.1
123emb|BX072361.1|CNS09RZX Single read from an extremity of a full-... 40 4.1
124emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-... 40 4.1
125emb|BX068379.1|CNS09OXB Single read from an extremity of a full-... 40 4.1
126emb|BX068378.1|CNS09OXA Single read from an extremity of a full-... 40 4.1
127emb|BX067609.1|CNS09OBX Single read from an extremity of a full-... 40 4.1
128emb|BX067608.1|CNS09OBW Single read from an extremity of a full-... 40 4.1
129emb|BX061944.1|CNS09JYK Single read from an extremity of a full-... 40 4.1
130emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-... 40 4.1
131emb|BX056299.1|CNS09FLR Single read from an extremity of a full-... 40 4.1
132emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-... 40 4.1
133emb|BX055253.1|CNS09ESP Single read from an extremity of a full-... 40 4.1
134emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-... 40 4.1
135emb|BX049557.1|CNS09AEH Single read from an extremity of a full-... 40 4.1
136emb|BX049556.1|CNS09AEG Single read from an extremity of a full-... 40 4.1
137emb|BX049060.1|CNS09A0O Single read from an extremity of a full-... 40 4.1
138emb|BX046605.1|CNS0984H Single read from an extremity of a full-... 40 4.1
139emb|BX046604.1|CNS0984G Single read from an extremity of a full-... 40 4.1
140emb|BX041706.1|CNS094CE Single read from an extremity of a full-... 40 4.1
141emb|BX041977.1|CNS094JX Single read from an extremity of a full-... 40 4.1
142emb|BX041661.1|CNS094B5 Single read from an extremity of a full-... 40 4.1
143emb|BX041260.1|CNS09400 Single read from an extremity of a full-... 40 4.1
144emb|BX039117.1|CNS092CH Single read from an extremity of a full-... 40 4.1
145emb|BX039116.1|CNS092CG Single read from an extremity of a full-... 40 4.1
146emb|BX038773.1|CNS0922X Single read from an extremity of a full-... 40 4.1
147emb|BX038772.1|CNS0922W Single read from an extremity of a full-... 40 4.1
148emb|BX038693.1|CNS0920P Single read from an extremity of a full-... 40 4.1
149emb|BX038692.1|CNS0920O Single read from an extremity of a full-... 40 4.1
150emb|BX038208.1|CNS091N8 Single read from an extremity of a full-... 40 4.1
151emb|BX038207.1|CNS091N7 Single read from an extremity of a full-... 40 4.1
152emb|BX038039.1|CNS091IJ Single read from an extremity of a full-... 40 4.1
153emb|BX038038.1|CNS091II Single read from an extremity of a full-... 40 4.1
154emb|BX037613.1|CNS0916P Single read from an extremity of a full-... 40 4.1
155emb|BX037612.1|CNS0916O Single read from an extremity of a full-... 40 4.1
156emb|BX037577.1|CNS0915P Single read from an extremity of a full-... 40 4.1
157emb|BX037488.1|CNS09138 Single read from an extremity of a full-... 40 4.1
158emb|BX037487.1|CNS09137 Single read from an extremity of a full-... 40 4.1
159emb|BX036984.1|CNS090P8 Single read from an extremity of a full-... 40 4.1
160emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-... 40 4.1
161emb|BX028080.1|CNS08TTW Single read from an extremity of a full-... 40 4.1
162emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-... 40 4.1
163emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-... 40 4.1
164emb|BX024766.1|CNS08R9U Single read from an extremity of a full-... 40 4.1
165emb|BX019545.1|CNS08N8T Single read from an extremity of a full-... 40 4.1
166emb|BX019544.1|CNS08N8S Single read from an extremity of a full-... 40 4.1
167emb|BX021590.1|CNS08OTM Single read from an extremity of a full-... 40 4.1
168emb|BX021589.1|CNS08OTL Single read from an extremity of a full-... 40 4.1
169emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-... 40 4.1
170emb|BX020809.1|CNS08O7X Single read from an extremity of a full-... 40 4.1
171emb|BX012334.1|CNS08HOI Single read from an extremity of a full-... 40 4.1
172emb|BX008016.1|CNS08ECK Single read from an extremity of a full-... 40 4.1
173emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-... 40 4.1
174gb|AC151907.5| Mus musculus BAC clone RP23-163E23 from chromosom... 40 4.1
175gb|AE005794.1| Caulobacter crescentus CB15 section 120 of 359 of... 40 4.1
176gb|AE012270.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 4.1
177gb|AC004034.2| Homo sapiens chromosome 16 clone LA16c-321D4, com... 40 4.1
178ref|XM_686756.1| PREDICTED: Danio rerio similar to Solute carrie... 40 4.1
179gb|AF393807.1|AF393807 Apium graveolens aquaporine PIP3-like pro... 40 4.1
180dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
181dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
182gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complet... 40 4.1
183dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.1
184dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 4.1
185ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913 ... 40 4.1
186gb|AY108280.1| Zea mays PCO132931 mRNA sequence 40 4.1
187gb|AY106483.1| Zea mays PCO145034 mRNA sequence 40 4.1
188emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (my... 40 4.1
189emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4,... 40 4.1
190gb|AC135113.4| Mus musculus BAC clone RP24-63N7 from 15, complet... 40 4.1
191gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com... 40 4.1
192gb|AC113930.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.1
193dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ... 40 4.1
194dbj|AB032059.1| Mesembryanthemum crystallinum McMipA gene for PI... 40 4.1

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  569 bits (287), Expect = e-159
 Identities = 293/295 (99%)
 Strand = Plus / Plus

                                                                       
Query: 14  tcacacccacacccatcttctcctcctaacaaccgagccaggctcaagcggcggcgatgg 73
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22  tcacacccacacccatcttctcctcctaacaaccgagccaggctcaagcggcggcgatgg 81

                                                                       
Query: 74  agggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcg 133
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  agggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcg 141

                                                                       
Query: 134 gcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccggccc 193
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccggccc 201

                                                                       
Query: 194 ccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgccgagt 253
           |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 202 ccttcttcgaggccggggagctcacctcctggtccttctaccgggcagggatcgccgagt 261

                                                                  
Query: 254 tcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgtggt 308
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 262 tcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgtggt 316



to top

>gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrinsic protein 3 (PIP3) mRNA,
           complete cds
          Length = 1271

 Score =  454 bits (229), Expect = e-125
 Identities = 241/245 (98%)
 Strand = Plus / Plus

                                                                       
Query: 64  gcggcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcac 123
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 68  gcggccatggagggcaaggaggaggacgtgcggctgggcgcgaaccgctactcggagcac 127

                                                                       
Query: 124 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 183
           |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct: 128 cagcccatcggcacggcggcgcagggcggcggcgcggacgagaaggactacaaggagccg 187

                                                                       
Query: 184 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 243
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 188 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 247

                                                                       
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggc 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 248 atcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggc 307

                
Query: 304 gtggt 308
           |||||
Sbjct: 308 gtggt 312



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  436 bits (220), Expect = e-119
 Identities = 238/244 (97%)
 Strand = Plus / Plus

                                                                       
Query: 65  cggcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcacc 124
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 58  cggccatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcacc 117

                                                                       
Query: 125 agcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgc 184
           ||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||||
Sbjct: 118 agcccatcggcacggcggcgcagggcggcggcgcggacaaaaaggactacaaggagccgc 177

                                                                       
Query: 185 ccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggca 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 ccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggca 237

                                                                       
Query: 245 tcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcg 304
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 238 tcgccgagttcctggccactttcctcttcctctacatctcggtgctcaccgtgatgggcg 297

               
Query: 305 tggt 308
           ||||
Sbjct: 298 tggt 301



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  250 bits (126), Expect = 2e-63
 Identities = 209/236 (88%), Gaps = 3/236 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| |||||||| ||| | ||||||||||  ||||||
Sbjct: 83  atggaggggaaggaggaggacgtgcggctgggcgccaacaggtactcggagcggcagccc 142

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||||||||| | ||||   |||||||||||||||||||| |||
Sbjct: 143 atcgggacggcggcgcagggcggcggggacgac---aaggactacaaggagccgccgccg 199

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  |||||||| ||||||||||||  ||||||||||||||||| ||||||||||||
Sbjct: 200 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgcc 259

                                                                   
Query: 250 gagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt 305
           |||||| | ||||||||||||||||||||| || | ||||||||||| ||||||||
Sbjct: 260 gagttcatcgccaccttcctcttcctctacgtcaccgtgctcaccgtcatgggcgt 315



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  216 bits (109), Expect = 3e-53
 Identities = 204/236 (86%), Gaps = 6/236 (2%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| |||||||||||||| ||||||||||| |||   | |||||||| |||||||
Sbjct: 1   atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccagccc 60

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           |||||||||||||||||||||       | ||||| ||||||||||||||||| || |||
Sbjct: 61  atcggcacggcggcgcagggca------cggacgacaaggactacaaggagcccccgccg 114

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  |||||||| ||||||||||||  ||||||||||||||||| ||||||||||||
Sbjct: 115 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgcc 174

                                                                   
Query: 250 gagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt 305
           |||||| | ||||||||||||||||||||||||||  | |||||||| ||||||||
Sbjct: 175 gagttcgtcgccaccttcctcttcctctacatctccatcctcaccgtcatgggcgt 230



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  214 bits (108), Expect = 1e-52
 Identities = 209/243 (86%), Gaps = 6/243 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| |||||||||||||||||||||||||| |||   | ||||||||  |||||
Sbjct: 100 gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 159

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggagcc 182
           ||||||||||||||||||||||| ||| ||||      |||| |||||||||||||||||
Sbjct: 160 catcggcacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggagcc 219

                                                                       
Query: 183 gcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccgg 242
            || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || ||
Sbjct: 220 cccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcggg 279

                                                                       
Query: 243 catcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||||||||| | |||||||||||||||||||||||| | || |||||||| |||||
Sbjct: 280 catcgccgagttcgtcgccaccttcctcttcctctacatcaccgtcctcaccgtcatggg 339

              
Query: 303 cgt 305
           |||
Sbjct: 340 cgt 342



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  214 bits (108), Expect = 1e-52
 Identities = 209/243 (86%), Gaps = 6/243 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| |||||||||||||||||||||||||| |||   | ||||||||  |||||
Sbjct: 95  gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 154

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggagcc 182
           ||||||||||||||||||||||| ||| ||||      |||| |||||||||||||||||
Sbjct: 155 catcggcacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggagcc 214

                                                                       
Query: 183 gcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccgg 242
            || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || ||
Sbjct: 215 cccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcggg 274

                                                                       
Query: 243 catcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||||||||| | |||||||||||||||||||||||| | || |||||||| |||||
Sbjct: 275 catcgccgagttcgtcgccaccttcctcttcctctacatcaccgtcctcaccgtcatggg 334

              
Query: 303 cgt 305
           |||
Sbjct: 335 cgt 337



to top

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  210 bits (106), Expect = 2e-51
 Identities = 188/214 (87%), Gaps = 6/214 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           |||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||
Sbjct: 81  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 140

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||  |||||     |||||||||||||||||||| || ||
Sbjct: 141 aatcggcacggcggcgcagggc-acggag-----gagaaggactacaaggagcctccgcc 194

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||||| | |||||| || || |||||||||||||||||||| |||||
Sbjct: 195 ggcgccgctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgc 254

                                             
Query: 249 cgagttcctggccaccttcctcttcctctacatc 282
           ||||||| ||||||||||||| ||||| ||||||
Sbjct: 255 cgagttcgtggccaccttcctgttcctgtacatc 288



to top

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  210 bits (106), Expect = 2e-51
 Identities = 188/214 (87%), Gaps = 6/214 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           |||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||
Sbjct: 72  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 131

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||  |||||     |||||||||||||||||||| || ||
Sbjct: 132 aatcggcacggcggcgcagggc-acggag-----gagaaggactacaaggagcctccgcc 185

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||||| | |||||| || || |||||||||||||||||||| |||||
Sbjct: 186 ggcgccgctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgc 245

                                             
Query: 249 cgagttcctggccaccttcctcttcctctacatc 282
           ||||||| ||||||||||||| ||||| ||||||
Sbjct: 246 cgagttcgtggccaccttcctgttcctgtacatc 279



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  202 bits (102), Expect = 5e-49
 Identities = 203/236 (86%), Gaps = 3/236 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| || ||||||||||||||||||||||| |||   | |||||||| |||||||
Sbjct: 434 atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 493

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||||| ||   | ||||| ||||||||||||||||| || |||
Sbjct: 494 atcgggacggcggcgcagggcgccg---ctgacgacaaggactacaaggagcccccgccg 550

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| ||||||||||||  ||||||||||||||||| || |||||||||
Sbjct: 551 gcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgcc 610

                                                                   
Query: 250 gagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt 305
           |||||| | |||||||||||||||||||||||| |  | |||||||| ||||||||
Sbjct: 611 gagttcgtcgccaccttcctcttcctctacatcaccatcctcaccgtcatgggcgt 666



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  202 bits (102), Expect = 5e-49
 Identities = 203/236 (86%), Gaps = 3/236 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| || ||||||||||||||||||||||| |||   | |||||||| |||||||
Sbjct: 61  atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 120

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||||| ||   | ||||| ||||||||||||||||| || |||
Sbjct: 121 atcgggacggcggcgcagggcgccg---ctgacgacaaggactacaaggagcccccgccg 177

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| ||||||||||||  ||||||||||||||||| || |||||||||
Sbjct: 178 gcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgcc 237

                                                                   
Query: 250 gagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt 305
           |||||| | |||||||||||||||||||||||| |  | |||||||| ||||||||
Sbjct: 238 gagttcgtcgccaccttcctcttcctctacatcaccatcctcaccgtcatgggcgt 293



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  192 bits (97), Expect = 5e-46
 Identities = 201/236 (85%), Gaps = 6/236 (2%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| |||||||||||||| ||||||||||| |||   | |||||||| |||  ||
Sbjct: 61  atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccacgcc 120

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           |||||||||||||||||||||       | ||||| ||||||||||||||||| || |||
Sbjct: 121 atcggcacggcggcgcagggca------cggacgacaaggactacaaggagcccccgccg 174

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  |||||||| ||||||||||||  |||||||||||||||||  |||||||||||
Sbjct: 175 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgccccggcatcgcc 234

                                                                   
Query: 250 gagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatgggcgt 305
           |||||| | ||||||||||||||||||||||||||  | |||||||| ||||||||
Sbjct: 235 gagttcgtcgccaccttcctcttcctctacatctccatcctcaccgtcatgggcgt 290



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 25  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 84

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 85  atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 141

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 142 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 201

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 202 gagttcgtcgccaccttcctcttcctctacatc 234



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                            
Query: 70       atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
                |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 27062945 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 27063004

                                                                            
Query: 130      atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
                || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 27063005 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 27063061

                                                                            
Query: 190      gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
                || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 27063062 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 27063121

                                                 
Query: 250      gagttcctggccaccttcctcttcctctacatc 282
                |||||| | ||||||||||||||||||||||||
Sbjct: 27063122 gagttcgtcgccaccttcctcttcctctacatc 27063154



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 171/213 (80%), Gaps = 6/213 (2%)
 Strand = Plus / Plus

                                                                            
Query: 70       atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
                |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 35368315 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 35368374

                                                                            
Query: 130      atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
                ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 35368375 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 35368428

                                                                            
Query: 190      gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
                || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 35368429 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 35368488

                                                 
Query: 250      gagttcctggccaccttcctcttcctctacatc 282
                |||||| |||| || ||||| ||||| ||||||
Sbjct: 35368489 gagttcgtggcgacgttcctgttcctgtacatc 35368521



to top

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                         
Query: 70    atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
             |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 34594 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 34653

                                                                         
Query: 130   atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
             || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 34654 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 34710

                                                                         
Query: 190   gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
             || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 34711 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 34770

                                              
Query: 250   gagttcctggccaccttcctcttcctctacatc 282
             |||||| | ||||||||||||||||||||||||
Sbjct: 34771 gagttcgtcgccaccttcctcttcctctacatc 34803



to top

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                          
Query: 70     atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
              |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 116147 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 116206

                                                                          
Query: 130    atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
              || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 116207 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 116263

                                                                          
Query: 190    gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
              || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 116264 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 116323

                                               
Query: 250    gagttcctggccaccttcctcttcctctacatc 282
              |||||| | ||||||||||||||||||||||||
Sbjct: 116324 gagttcgtcgccaccttcctcttcctctacatc 116356



to top

>dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-G11, full
           insert sequence
          Length = 1128

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctcttcctctacatc 267



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctcttcctctacatc 267



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  172 bits (87), Expect = 4e-40
 Identities = 182/213 (85%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 113 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 172

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 173 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 229

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 230 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 289

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 290 gagttcgtcgccaccttcctcttcctctacatc 322



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  170 bits (86), Expect = 2e-39
 Identities = 181/213 (84%), Gaps = 6/213 (2%)
 Strand = Plus / Plus

                                                                       
Query: 67  gcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccag 126
           |||||||||||||||||||||||||||||||| || ||||||   ||||||||||  || 
Sbjct: 68  gcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcac 127

                                                                       
Query: 127 cccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccc 186
            ||||||||||||||||||||||        |||| || ||||||||||||||||| || 
Sbjct: 128 gccatcggcacggcggcgcaggggt------ccgaggacaaggactacaaggagcccccg 181

                                                                       
Query: 187 ccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatc 246
           ||||| ||  | |||||| |||| |||||||  || |||||||||||||| |||||||||
Sbjct: 182 ccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatc 241

                                            
Query: 247 gccgagttcctggccaccttcctcttcctctac 279
           ||||||||| |||||||||||||||||||||||
Sbjct: 242 gccgagttcatggccaccttcctcttcctctac 274



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  165 bits (83), Expect = 1e-37
 Identities = 181/213 (84%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   | ||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcggccg 117

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctcttcctctacatc 267



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  157 bits (79), Expect = 3e-35
 Identities = 180/213 (84%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||||||||| | | | |||||| | |||||||||   ||||| 
Sbjct: 56  atggaggggaaggaggaggacgtgcggccgcgggcgaacaggtactcggagaggcagccg 115

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 116 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 172

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 173 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 232

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| | ||||||||||||||||||||||||
Sbjct: 233 gagttcgtcgccaccttcctcttcctctacatc 265



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  155 bits (78), Expect = 1e-34
 Identities = 158/185 (85%), Gaps = 6/185 (3%)
 Strand = Plus / Plus

                                                                       
Query: 127 cccatcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggag 180
           |||||||| |||||||||||||||| ||| ||||      |||| |||||||||||||||
Sbjct: 8   cccatcggtacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggag 67

                                                                       
Query: 181 ccgcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggcc 240
           || || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || 
Sbjct: 68  cccccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcg 127

                                                                       
Query: 241 ggcatcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatg 300
           ||||||||||||||| | |||||||||||||||||||||||| | || |||||||| |||
Sbjct: 128 ggcatcgccgagttcgtcgccaccttcctcttcctctacatcaccgtcctcaccgtcatg 187

                
Query: 301 ggcgt 305
           |||||
Sbjct: 188 ggcgt 192



to top

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score =  149 bits (75), Expect = 6e-33
 Identities = 194/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 125 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 178

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 179 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 238

                                                                 
Query: 249 cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||| |||||||||||||||||||||||||| | || |||||||| |||||
Sbjct: 239 cgagttcatggccaccttcctcttcctctacatcaccgtcctcaccgtcatggg 292



to top

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score =  149 bits (75), Expect = 6e-33
 Identities = 194/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 125 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 178

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 179 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 238

                                                                 
Query: 249 cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||| |||||||||||||||||||||||||| | || |||||||| |||||
Sbjct: 239 cgagttcatggccaccttcctcttcctctacatcaccgtcctcaccgtcatggg 292



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  141 bits (71), Expect = 2e-30
 Identities = 193/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                            
Query: 69       gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
                ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 28019923 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 28019982

                                                                            
Query: 129      catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
                 |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 28019983 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 28020036

                                                                            
Query: 189      ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
                ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 28020037 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 28020096

                                                                      
Query: 249      cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
                ||||||| ||||||||||||||||||| |||||| | || |||||||| |||||
Sbjct: 28020097 cgagttcatggccaccttcctcttcctttacatcaccgtcctcaccgtcatggg 28020150



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                             
Query: 244      atcgccgagttcctggccaccttcctcttcctctacatctcggtg 288
                |||||||||||| |||||||  | ||||||||||||||| |||||
Sbjct: 26072906 atcgccgagttcgtggccacgctgctcttcctctacatcacggtg 26072950



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 136      acggcggcgcagggcggcgg 155
                ||||||||||||||||||||
Sbjct: 22386761 acggcggcgcagggcggcgg 22386742



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  141 bits (71), Expect = 2e-30
 Identities = 193/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 59  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 118

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 119 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 172

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 173 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 232

                                                                 
Query: 249 cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||| ||||||||||||||||||| |||||| | || |||||||| |||||
Sbjct: 233 cgagttcatggccaccttcctcttcctttacatcaccgtcctcaccgtcatggg 286



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  141 bits (71), Expect = 2e-30
 Identities = 193/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 60  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 119

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 120 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 173

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 174 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 233

                                                                 
Query: 249 cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||| ||||||||||||||||||| |||||| | || |||||||| |||||
Sbjct: 234 cgagttcatggccaccttcctcttcctttacatcaccgtcctcaccgtcatggg 287



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
           insert sequence
          Length = 1462

 Score =  141 bits (71), Expect = 2e-30
 Identities = 193/234 (82%), Gaps = 6/234 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 358 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 417

                                                                       
Query: 129 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 418 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 471

                                                                       
Query: 189 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 472 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 531

                                                                 
Query: 249 cgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           ||||||| ||||||||||||||||||| |||||| | || |||||||| |||||
Sbjct: 532 cgagttcatggccaccttcctcttcctttacatcaccgtcctcaccgtcatggg 585



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  135 bits (68), Expect = 9e-29
 Identities = 151/179 (84%), Gaps = 6/179 (3%)
 Strand = Plus / Plus

                                                                       
Query: 124 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 183
           ||||| |||||||||||||||||||||       ||||||| ||||||||||||||||||
Sbjct: 117 cagccgatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccg 170

                                                                       
Query: 184 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 243
           || ||||| ||  | |||||| | ||||||||||  || |||||||||||||| || || 
Sbjct: 171 ccgccggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcaggg 230

                                                                      
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgatggg 302
           |||||||||||| ||||||||||||||||||| |||||| | || |||||||| |||||
Sbjct: 231 atcgccgagttcatggccaccttcctcttcctttacatcaccgtcctcaccgtcatggg 289



to top

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score =  125 bits (63), Expect = 9e-26
 Identities = 102/115 (88%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtc 227
           |||||||||||||||||| ||||| || || |||||| |||| |||||||  || |||||
Sbjct: 186 ggactacaaggagccgccaccggcgccgtttttcgagcccggtgagctcaagtcatggtc 245

                                                                  
Query: 228 cttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||||||| |||||||||||||||||  | ||||||||||||||||||||||||
Sbjct: 246 cttctaccgtgccggcatcgccgagtttgtcgccaccttcctcttcctctacatc 300



 Score = 48.1 bits (24), Expect = 0.017
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 112 tactcggagcaccagcccatcggcacggcggcgcag 147
           ||||||||||  ||||| ||||||||||||||||||
Sbjct: 139 tactcggagcggcagccgatcggcacggcggcgcag 174



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  125 bits (63), Expect = 9e-26
 Identities = 176/213 (82%), Gaps = 3/213 (1%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| |||||||| ||| |||| ||||| |||||| | | ||||||    ||||| 
Sbjct: 53  atggaggggaaggaggaagacttgcggctgggggcgaacaggttctcggaaaggcagccg 112

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           || || |||||||||||||||| ||| | | ||   |||||||||||||||||||| |||
Sbjct: 113 atagggacggcggcgcagggcgccggggacaac---aaggactacaaggagccgccgccg 169

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 170 gcgccgcttttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 229

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           || ||| | ||||||||||||||||||||||||
Sbjct: 230 gatttcgtcgccaccttcctcttcctctacatc 262



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  123 bits (62), Expect = 4e-25
 Identities = 172/209 (82%), Gaps = 6/209 (2%)
 Strand = Plus / Plus

                                                                         
Query: 69    gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 128
             ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 27148 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 27207

                                                                         
Query: 129   catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 188
              |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 27208 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 27261

                                                                         
Query: 189   ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
             ||| ||  | |||||| | ||||||||||  || |||||| ||||||| || || |||||
Sbjct: 27262 ggcgccgctgttcgagccaggggagctcaagtcgtggtccctctaccgcgcagggatcgc 27321

                                          
Query: 249   cgagttcctggccaccttcctcttcctct 277
             ||||||| |||||||||||||||||||||
Sbjct: 27322 cgagttcatggccaccttcctcttcctct 27350



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  117 bits (59), Expect = 2e-23
 Identities = 130/154 (84%), Gaps = 6/154 (3%)
 Strand = Plus / Plus

                                                                       
Query: 124 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 183
           ||||| |||||||||||||||||||||       ||||||| ||||||||||||||||||
Sbjct: 36  cagccgatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccg 89

                                                                       
Query: 184 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 243
           || ||||| ||  | |||||| | ||||||||||  || |||||| ||||||| || || 
Sbjct: 90  ccgccggcgccgctgttcgagccaggggagctcaagtcgtggtccctctaccgcgcaggg 149

                                             
Query: 244 atcgccgagttcctggccaccttcctcttcctct 277
           |||||||||||| |||||||||||||||||||||
Sbjct: 150 atcgccgagttcatggccaccttcctcttcctct 183



to top

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 85/97 (87%)
 Strand = Plus / Plus

                                                                       
Query: 210 ggagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcct 269
           ||||||| |||| |||||||||||||| |||||||||||||||||| ||||||| |||||
Sbjct: 354 ggagctctcctcgtggtccttctaccgcgccggcatcgccgagttcgtggccacgttcct 413

                                                
Query: 270 cttcctctacatctcggtgctcaccgtgatgggcgtg 306
           |||||| ||| |  | ||||| || ||||||||||||
Sbjct: 414 cttcctgtacgtgaccgtgctgacggtgatgggcgtg 450



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 80  aggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcggcacgg 139
           |||| |||||||||||| |||||| | |||| | | ||||||  ||||||||||||||||
Sbjct: 233 aggaagaggacgtgcgcgtgggcgtggaccgtttcccggagcggcagcccatcggcacgg 292

                
Query: 140 cggcg 144
           |||||
Sbjct: 293 cggcg 297



to top

>gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1135

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 99/117 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||| ||||| || || ||||| ||||||||| |||| |||||||  || |||
Sbjct: 128 aaggactacaaagagccacctcccgcccctttcttcgagcccggagagctcaagtcgtgg 187

                                                                    
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||| ||| | || || ||||| || ||| ||||||||||||||||||||||||||
Sbjct: 188 tccttttacagagctggaatcgctgaattcatggccaccttcctcttcctctacatc 244



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 85.7 bits (43), Expect = 8e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 211 gagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcctc 270
           |||||| |||| |||||||| ||||| ||||| |||||||||||| | ||||||||||||
Sbjct: 218 gagctctcctcgtggtccttttaccgcgccggaatcgccgagttcatagccaccttcctc 277

                                              
Query: 271 ttcctctacatctcggtgctcaccgtgatgggcgt 305
           ||||| |||||| |  | |||||||| ||||||||
Sbjct: 278 ttcctttacatcaccattctcaccgtcatgggcgt 312



to top

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 171/213 (80%), Gaps = 6/213 (2%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 153 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 212

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 213 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 266

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 267 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 326

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| |||| || ||||| ||||| ||||||
Sbjct: 327 gagttcgtggcgacgttcctgttcctgtacatc 359



to top

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 171/213 (80%), Gaps = 6/213 (2%)
 Strand = Plus / Plus

                                                                         
Query: 70    atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
             |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 28863 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 28922

                                                                         
Query: 130   atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
             ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 28923 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 28976

                                                                         
Query: 190   gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
             || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 28977 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 29036

                                              
Query: 250   gagttcctggccaccttcctcttcctctacatc 282
             |||||| |||| || ||||| ||||| ||||||
Sbjct: 29037 gagttcgtggcgacgttcctgttcctgtacatc 29069



to top

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 171/213 (80%), Gaps = 6/213 (2%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 152 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 211

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 212 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 265

                                                                       
Query: 190 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 249
           || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 266 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 325

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| |||| || ||||| ||||| ||||||
Sbjct: 326 gagttcgtggcgacgttcctgttcctgtacatc 358



to top

>gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic protein mRNA, partial
           cds
          Length = 604

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| |||||||| ||  |||||||| | || ||||| || || |||
Sbjct: 94  aaggactacaaggagcctcccccggcaccgctcttcgagccaggcgagctgacgtcatgg 153

                                                                   
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacat 281
           || || ||| ||||||| |||||||||||| | |||||||| || || ||||||||
Sbjct: 154 tcgttttacagggccgggatcgccgagttcatcgccacctttctgtttctctacat 209



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 103/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 159 cgacgagaaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcac 218
           ||||| ||||||||||||||| || || || || ||  | |||||| |||| ||||| ||
Sbjct: 174 cgacgggaaggactacaaggaaccaccgcctgctccactgttcgagcccggcgagctgac 233

                                                                       
Query: 219 ctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctcta 278
            || ||||| |||||| ||||||| |||||||||||| | ||||| ||||| ||||||||
Sbjct: 234 gtcatggtcgttctacagggccgggatcgccgagttcatcgccactttcctgttcctcta 293

               
Query: 279 catc 282
           ||||
Sbjct: 294 catc 297



to top

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
           1-1, complete cds
          Length = 1351

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || ||||| ||  | |||||| |||| ||||| || || ||||| 
Sbjct: 321 gactacaaggagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 380

                                                                 
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           || ||| ||||||| |||||||||||| | ||||| ||||| ||||||||||||
Sbjct: 381 ttttacagggccgggatcgccgagttcatcgccactttcctgttcctctacatc 434



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||| |||||| |||| | ||||||||||||| | |||||  |||||||||||||||||
Sbjct: 170 tggtcattctacagggcagtcatcgccgagttcatagccacactcctcttcctctacatc 229

                            
Query: 283 tcggtgctcaccgtgat 299
            | ||||||||||||||
Sbjct: 230 accgtgctcaccgtgat 246



to top

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtc 227
           ||||||||||||||||||||| || ||  | |  ||| | || ||||||| ||| |||||
Sbjct: 103 ggactacaaggagccgcccccagctcctctgtatgagccaggagagctcatctcatggtc 162

                                                                  
Query: 228 cttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||||| |||| || || || |||||| |||| |||||||| ||||||||||||
Sbjct: 163 cttctacagggctggtatagcagagttcatggcgaccttcctattcctctacatc 217



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 69 gatggagggcaaggaggagga 89
          |||||||||||||||||||||
Sbjct: 10 gatggagggcaaggaggagga 30



to top

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||||||| | |||| ||| ||||||||| | |||||| |||||||||||||||||
Sbjct: 149 tggtccttctacagagccgtcattgccgagttcgtcgccaccctcctcttcctctacatc 208

                         
Query: 283 tcggtgctcaccgt 296
            | || ||||||||
Sbjct: 209 actgtcctcaccgt 222



to top

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 94/114 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||| ||||| || ||||| ||  | |||||| |||| ||||| || || ||||| 
Sbjct: 180 gactacaaagagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 239

                                                                 
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||| ||||||| |||||||||||| | ||||| ||||| || |||||||||
Sbjct: 240 ttctacagggccgggatcgccgagttcatcgccactttcctgtttctctacatc 293



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 114/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 104 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 163

                                                                       
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatctcg 285
           |||||||   | ||||| |||||||||||| | ||||| || || ||||| |||||| | 
Sbjct: 164 tccttctggagagccggtatcgccgagttcatcgccacgtttctgttcctatacatcacc 223

                                
Query: 286 gtgctcaccgtgatgggcgtg 306
           ||| | ||||| |||||||||
Sbjct: 224 gtgttgaccgtcatgggcgtg 244



to top

>gb|AF145707.1|AF145707 Lotus japonicus clone LJ-AQP1 plasma membrane intrinsic protein
           homolog (PIP) mRNA, partial cds
          Length = 527

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 210 ggagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||||||||| |||||||||||| | ||||| || ||||||||  | |||||||| ||
Sbjct: 15  ggagctcacctcatggtccttctacagagccggtattgccgagtttgttgccacctttct 74

                        
Query: 270 cttcctctacatc 282
            ||||||||||||
Sbjct: 75  gttcctctacatc 87



to top

>dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane aquaporin 1c,
           complete cds
          Length = 1074

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 114/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 111 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 170

                                                                       
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatctcg 285
           |||||||   | ||||| |||||||||||| | ||||| || || ||||| |||||| | 
Sbjct: 171 tccttctggagagccggtatcgccgagttcatcgccacgtttctgttcctttacatcacc 230

                                
Query: 286 gtgctcaccgtgatgggcgtg 306
           ||| | ||||| |||||||||
Sbjct: 231 gtgttgaccgtcatgggcgtg 251



to top

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 247 gccgagttcctggccaccttcctcttcctctacatc 282
           ||||||||| ||||||||||||||||||||||||||
Sbjct: 228 gccgagttcatggccaccttcctcttcctctacatc 263



to top

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 247 gccgagttcctggccaccttcctcttcctctacatc 282
           ||||||||| ||||||||||||||||||||||||||
Sbjct: 220 gccgagttcatggccaccttcctcttcctctacatc 255



to top

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 178 gagccgcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgg 237
           |||||||| ||||| || || || ||| |||| ||||| | ||| ||||| |||||||| 
Sbjct: 185 gagccgccaccggcaccgttgtttgagcccggcgagctgagctcgtggtctttctaccgc 244

                                                       
Query: 238 gccggcatcgccgagttcctggccaccttcctcttcctctacat 281
           |||||||||||||||||| | || ||||| || ||||| |||||
Sbjct: 245 gccggcatcgccgagttcatagctacctttcttttcctgtacat 288



to top

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           ||||||||||||||||| || || || || |||||| |||| |||||  | || ||||||
Sbjct: 106 gactacaaggagccgcctcctgcgccgttgttcgagcccggcgagcttgcgtcgtggtcc 165

                                                                 
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||   | ||||| |||||||||||| | ||||| || |||||||| ||||||
Sbjct: 166 ttctggagagccggaatcgccgagttcatcgccacgtttctcttcctttacatc 219



to top

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 171/214 (79%), Gaps = 8/214 (3%)
 Strand = Plus / Plus

                                                                        
Query: 70   atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
            |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 3820 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 3879

                                                                        
Query: 130  atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
            ||||| |||||||||||||| |||||||     ||||||||||||  ||||||| |  ||
Sbjct: 3880 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccg-cggcg 3932

                                                                        
Query: 190  gcccccttcttcga-ggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
            || ||  | ||||| ||| | |||||| || || ||||| ||||||||||| || |||||
Sbjct: 3933 gcgccggtgttcgacggcggaggagctgacgtcgtggtcgttctaccgggcggggatcgc 3992

                                              
Query: 249  cgagttcctggccaccttcctcttcctctacatc 282
             |||||| |||| || ||||| ||||| ||||||
Sbjct: 3993 ggagttcgtggcgacgttcctgttcctgtacatc 4026



to top

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 171/214 (79%), Gaps = 8/214 (3%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 129
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 133 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 192

                                                                       
Query: 130 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 189
           ||||| |||||||||||||| |||||||     ||||||||||||  ||||||| |  ||
Sbjct: 193 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccg-cggcg 245

                                                                       
Query: 190 gcccccttcttcga-ggccggggagctcacctcctggtccttctaccgggccggcatcgc 248
           || ||  | ||||| ||| | |||||| || || ||||| ||||||||||| || |||||
Sbjct: 246 gcgccggtgttcgacggcggaggagctgacgtcgtggtcgttctaccgggcggggatcgc 305

                                             
Query: 249 cgagttcctggccaccttcctcttcctctacatc 282
            |||||| |||| || ||||| ||||| ||||||
Sbjct: 306 ggagttcgtggcgacgttcctgttcctgtacatc 339



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 214 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 273

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 274 ttctacagagccggaatcgccgagttcatagccaccttcct 314



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 103 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 162

                                                                    
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||   | ||||| |||||||||||| | ||||| || || ||||| ||||||
Sbjct: 163 tccttctggagagccggtatcgccgagttcatcgccacgtttctgttcctttacatc 219



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 120 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 179

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 180 ttctacagagccggaatcgccgagttcatagccaccttcct 220



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 101 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 160

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 161 ttctacagagccggaatcgccgagttcatagccaccttcct 201



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 142 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 201

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 202 ttctacagagccggaatcgccgagttcatagccaccttcct 242



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 88  gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 147

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 148 ttctacagagccggaatcgccgagttcatagccaccttcct 188



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 132 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 191

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 192 ttctacagagccggaatcgccgagttcatagccaccttcct 232



to top

>gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 66131

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                         
Query: 169   gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
             |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 64196 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 64137

                                                      
Query: 229   ttctaccgggccggcatcgccgagttcctggccaccttcct 269
             |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 64136 ttctacagagccggaatcgccgagttcatagccaccttcct 64096



to top

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 218 cctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctct 277
           ||||||||||  ||||||| |||| ||||||||||||| | |||||  | ||||||||||
Sbjct: 178 cctcctggtcgctctaccgcgccgtcatcgccgagttcatcgccacgctgctcttcctct 237

                
Query: 278 acatc 282
           |||||
Sbjct: 238 acatc 242



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 88  gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 147

                                                    
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcct 269
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 148 ttctacagagccggaatcgccgagttcatagccaccttcct 188



to top

>gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mRNA, complete cds
          Length = 1136

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 94/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || || || || ||| | || |||||||  || |||
Sbjct: 147 aaggactacaaggagccaccaccagctcctttgtttgagcctggtgagctcaaatcatgg 206

                                                                   
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacat 281
           ||||||||| |||| || || || |||||  ||||||||||| | |||||||||||
Sbjct: 207 tccttctacagggctgggattgctgagtttgtggccaccttcttgttcctctacat 262



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 89/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || ||||| ||  | |||||  |||| |||||  |||| |||
Sbjct: 107 aaggactacaaggagccaccaccggcaccgcttttcgatcccggtgagctgtcctcatgg 166

                                                             
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcct 275
           || |||||| | || ||||| ||||||||| | ||||| ||||| |||||
Sbjct: 167 tcgttctacagagctggcatagccgagttcatagccactttcctgttcct 216



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 tcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgccgagttcc 256
           ||||||| |||| ||||||||||   |||||| | ||||| || |  |||||||||||| 
Sbjct: 153 tcttcgacgccgaggagctcaccaagtggtccctgtaccgcgcggtgatcgccgagttcg 212

                                     
Query: 257 tggccaccttcctcttcctctacatc 282
           |||||||  | |||||||||||||||
Sbjct: 213 tggccacgctgctcttcctctacatc 238



to top

>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017,
             complete sequence
          Length = 121127

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                       
Query: 222   ctggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctac 279
             ||||||||||||| | |||  ||| ||||||||| | |||||| ||||||||||||||
Sbjct: 34504 ctggtccttctacagagccctcattgccgagttcatcgccaccctcctcttcctctac 34561



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatctcggtg 288
           |||||||||||| |||||||  | ||||||||||||||| |||||
Sbjct: 133 atcgccgagttcgtggccacgctgctcttcctctacatcacggtg 177



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 94/117 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 122 aaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcgtgg 181

                                                                    
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||   | || || |||||||||||| | ||||| || || ||||| ||||||
Sbjct: 182 tccttctggagagcaggaatcgccgagttcatcgccacgtttctgttcctttacatc 238



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 94/117 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 121 aaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcgtgg 180

                                                                    
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||   | || || |||||||||||| | ||||| || || ||||| ||||||
Sbjct: 181 tccttctggagagcaggaatcgccgagttcatcgccacgtttctgttcctttacatc 237



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                           
Query: 244    atcgccgagttcctggccaccttcctcttcctctacatctcggtg 288
              |||||||||||| |||||||  | ||||||||||||||| |||||
Sbjct: 107233 atcgccgagttcgtggccacgctgctcttcctctacatcacggtg 107277



to top

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 94/117 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 106 aaggactacaaggagccacctcctgcgcccttgttcgagcccggcgagcttgcttcgtgg 165

                                                                    
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||   | ||||| ||||| |||||| | ||||| ||| | ||||| ||||||
Sbjct: 166 tccttctggagagccgggatcgctgagttcatcgccacgttcttgttcctttacatc 222



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctca 217
           |||||||||||||||||||| || || ||||| || ||| |||| |||||||
Sbjct: 76  aaggactacaaggagccgccacctgcgcccttgtttgagcccggtgagctca 127



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||| ||||||| || | ||||||||||||| | |||||  | |||||||||||||||
Sbjct: 186 tggtccctctaccgcgcggtcatcgccgagttcatcgccacgctgctcttcctctacatc 245



to top

>gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protein homolog (pip) mRNA,
           partial cds
          Length = 528

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||| |||||| | ||||| |||||||||||| ||||||| || || ||||| ||||||
Sbjct: 28  tggtcgttctacagagccggtatcgccgagttcgtggccacttttctgttcctgtacatc 87



to top

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           ||||| |||||| | ||||| |||||||||||| ||||||| || || ||||| ||||||
Sbjct: 206 tggtcgttctacagagccggtatcgccgagttcgtggccacttttctgttcctgtacatc 265



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||||||| | |||||  |||||||||||||||||
Sbjct: 259 atcgccgagttcgtcgccacgctcctcttcctctacatc 297



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||||||| | |||||  |||||||||||||||||
Sbjct: 175 atcgccgagttcgtcgccacgctcctcttcctctacatc 213



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 46.1 bits (23), Expect = 0.066
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||||||| | |||||  |||||||||||||||||
Sbjct: 179 atcgccgagttcgtcgccacgctcctcttcctctacatc 217



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 ggagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcct 269
           ||||||||||   |||||| | ||||| || | ||||||||||||| | |||||  | ||
Sbjct: 191 ggagctcacccagtggtccctgtaccgcgcggtcatcgccgagttcatcgccacgctgct 250

                                         
Query: 270 cttcctctacatctcggtgctcaccgtgat 299
           ||||||||||||| | |||  |||||||||
Sbjct: 251 cttcctctacatcaccgtggccaccgtgat 280



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 166 aaggactacaaggagccgcccccggc 191
           ||||||||||||||||| ||||||||
Sbjct: 179 aaggactacaaggagccacccccggc 204



to top

>emb|AJ251105.1|ETE251105 Echinops telfairi partial aqp2 gene for aquaporin 2, exon 1
          Length = 328

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 248 ccgagttcctggccaccttcctcttc 273
           ||||||||||||||||| ||||||||
Sbjct: 30  ccgagttcctggccaccctcctcttc 55



to top

>emb|AJ251104.1|TEC251104 Tenrec ecaudatus partial aqp2 gene for aquaporin 2, exon 1
          Length = 328

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 248 ccgagttcctggccaccttcctcttc 273
           ||||||||||||||||| ||||||||
Sbjct: 30  ccgagttcctggccaccctcctcttc 55



to top

>emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major intrinsic protein PIPb
          Length = 1179

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 91/114 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 228
           |||||||| |||||||| ||||| ||  | |||||| |||| || || |  || ||||| 
Sbjct: 149 gactacaaagagccgccgccggctccactgttcgagcccggcgaactaaagtcatggtct 208

                                                                 
Query: 229 ttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           || ||| |||| || |||||||||||| ||||||| ||| | ||||| ||||||
Sbjct: 209 ttttacagggctggtatcgccgagttcgtggccactttcttgttcctttacatc 262



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                            
Query: 223      tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
                |||||| | ||||| |||| ||||||||||||| |||||||  | || ||||||||| ||
Sbjct: 15315658 tggtccctgtaccgcgccgtcatcgccgagttcgtggccacgctgctgttcctctacgtc 15315717

                      
Query: 283      tcggtg 288
                 |||||
Sbjct: 15315718 acggtg 15315723



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 232      taccgggccggcatcgccgagttcctggccac 263
                ||||| |||| ||||||||||||| |||||||
Sbjct: 15323525 taccgcgccgtcatcgccgagttcgtggccac 15323556



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                         
Query: 223   tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
             |||||| | ||||| |||| ||||||||||||| |||||||  | || ||||||||| ||
Sbjct: 22657 tggtccctgtaccgcgccgtcatcgccgagttcgtggccacgctgctgttcctctacgtc 22716

                   
Query: 283   tcggtg 288
              |||||
Sbjct: 22717 acggtg 22722



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 232   taccgggccggcatcgccgagttcctggccac 263
             ||||| |||| ||||||||||||| |||||||
Sbjct: 30524 taccgcgccgtcatcgccgagttcgtggccac 30555



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                          
Query: 223    tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
              |||||| | ||||| |||| ||||||||||||| |||||||  | || ||||||||| ||
Sbjct: 101671 tggtccctgtaccgcgccgtcatcgccgagttcgtggccacgctgctgttcctctacgtc 101730

                    
Query: 283    tcggtg 288
               |||||
Sbjct: 101731 acggtg 101736



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 232    taccgggccggcatcgccgagttcctggccac 263
              ||||| |||| ||||||||||||| |||||||
Sbjct: 109538 taccgcgccgtcatcgccgagttcgtggccac 109569



to top

>gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipD) mRNA, complete cds
          Length = 1135

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 88/110 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || ||||| ||  | |||||| | |  |||||||  ||||||
Sbjct: 146 aaggactacaaggagccaccaccggcgccgctgttcgagccggatgagctcaagtcctgg 205

                                                             
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcct 275
           || || ||| | || ||  ||||||||||| | ||||||||| |||||||
Sbjct: 206 tcgttttacagagctgggctcgccgagttcatcgccaccttcttcttcct 255



to top

>ref|XM_526747.1| PREDICTED: Pan troglodytes similar to hypothetical protein
           (LOC471365), mRNA
          Length = 5565

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 205 gccggggagctcacctcctggtcct 229
           ||||||| |||||||||||||||||
Sbjct: 152 gccggggggctcacctcctggtcct 176



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatctcggtg 288
           |||||||||||| |||||||  | || |||||||||||| |||||
Sbjct: 121 atcgccgagttcgtggccacgctgcttttcctctacatcacggtg 165



to top

>gb|AC108477.5| Homo sapiens BAC clone RP11-499F19 from 4, complete sequence
          Length = 164194

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 205   gccggggagctcacctcctggtcct 229
             ||||||| |||||||||||||||||
Sbjct: 32406 gccggggggctcacctcctggtcct 32430



to top

>emb|BX029520.1|CNS08UXW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 8   tatctctcacacccacaccca 28
           |||||||||||||||||||||
Sbjct: 495 tatctctcacacccacaccca 475



to top

>gb|AE012531.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 439
            of 460 of the complete genome
          Length = 11870

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 90   cgtgcgcctgggcgcgaaccgctac 114
            |||||||||||||| ||||||||||
Sbjct: 5056 cgtgcgcctgggcgagaaccgctac 5032



to top

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 90/113 (79%)
 Strand = Plus / Plus

                                                                       
Query: 166 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 225
           ||||||||||||||||| || || || ||||| || ||| |||||||| | |  || |||
Sbjct: 141 aaggactacaaggagccaccaccagcacccttgtttgagcccggggagttgaagtcatgg 200

                                                                
Query: 226 tccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctcta 278
           || || ||| | ||||| || || |||||| ||||||| ||||| || |||||
Sbjct: 201 tctttttacagagccgggattgctgagttcatggccactttcctgtttctcta 253



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 90      cgtgcgcctgggcgcgaaccgctac 114
               |||||||||||||| ||||||||||
Sbjct: 4926305 cgtgcgcctgggcgagaaccgctac 4926281



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 61      gcggcggcgatggagggcaa 80
               ||||||||||||||||||||
Sbjct: 3070173 gcggcggcgatggagggcaa 3070154



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 243 catcgccgagttcctggccaccttcctcttcctctacatctcggtgctcaccgtgat 299
           ||||||||||||| | |||||  | ||||||||||||||| | |||  |||||||||
Sbjct: 216 catcgccgagttcatcgccacgctgctcttcctctacatcaccgtggccaccgtgat 272



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 244 atcgccgagttcctggccaccttcctcttcctctacatctcggtg 288
           |||||||||||| |||||||  | || |||||||||||| |||||
Sbjct: 176 atcgccgagttcgtggccacgctgcttttcctctacatcacggtg 220



to top

>gb|AC095057.3| Homo sapiens BAC clone RP11-395I6 from 4, complete sequence
          Length = 163527

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 4     tctctatctctcacacccacacccatctt 32
             ||||| |||||||||| ||||||||||||
Sbjct: 85214 tctctctctctcacacacacacccatctt 85242



to top

>emb|AL079303.3|CNS00M8O Human chromosome 14 DNA sequence BAC R-964E11 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 199891

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 264    cttcctcttcctctacatctc 284
              |||||||||||||||||||||
Sbjct: 160529 cttcctcttcctctacatctc 160549



to top

>emb|AL928567.6| Mouse DNA sequence from clone RP23-296K20 on chromosome 11, complete
             sequence
          Length = 111073

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 9     atctctcacacccacacccat 29
             |||||||||||||||||||||
Sbjct: 12886 atctctcacacccacacccat 12906



to top

>dbj|AB002147.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1112

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 250 gagttcctggccaccttcctcttcctctacatc 282
           |||||| ||||||| ||||||||||| ||||||
Sbjct: 214 gagttcatggccactttcctcttcctttacatc 246



to top

>ref|XM_462670.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 954

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 136 acggcggcgcagggcggcgg 155
           ||||||||||||||||||||
Sbjct: 209 acggcggcgcagggcggcgg 190



to top

>ref|NM_192161.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 792

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 132 cggcacggcggcgcagggcggcgg 155
           ||||||||||||| ||||||||||
Sbjct: 632 cggcacggcggcggagggcggcgg 609



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 232 taccgggccggcatcgccgagttcctggccac 263
           ||||| |||| ||||||||||||| |||||||
Sbjct: 103 taccgcgccgtcatcgccgagttcgtggccac 134



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 239     ccggcatcgccgagttcctg 258
               ||||||||||||||||||||
Sbjct: 2439947 ccggcatcgccgagttcctg 2439928



to top

>gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (PIP2;1) gene,
           complete cds
          Length = 1486

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 223 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctcttcctctacatc 282
           |||||||||||| | |||  ||||||||||||| | ||||| || || ||||| ||||||
Sbjct: 97  tggtccttctacagagccatcatcgccgagttcgtcgccactttgctgttcctgtacatc 156



to top

>ref|XM_430201.1| PREDICTED: Gallus gallus hypothetical gene supported by CR390104
            (LOC424931), mRNA
          Length = 2454

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 260  ccaccttcctcttcctctacatct 283
            |||||||||||||||||| |||||
Sbjct: 1421 ccaccttcctcttcctcttcatct 1398



to top

>gb|AC161197.9| Mus musculus chromosome 7, clone RP23-179K11, complete sequence
          Length = 240657

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 259    gccaccttcctcttcctcta 278
              ||||||||||||||||||||
Sbjct: 170690 gccaccttcctcttcctcta 170671



to top

>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence
          Length = 218640

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     cacacccacacccatcttct 34
              ||||||||||||||||||||
Sbjct: 151385 cacacccacacccatcttct 151366



to top

>gb|AC152166.4| Mus musculus BAC clone RP23-425A3 from chromosome 7, complete sequence
          Length = 216652

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    acccacacccatcttctcct 37
             ||||||||||||||||||||
Sbjct: 80467 acccacacccatcttctcct 80486



to top

>gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, complete sequence
          Length = 214848

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     cacacccacacccatcttct 34
              ||||||||||||||||||||
Sbjct: 145336 cacacccacacccatcttct 145317



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    cgcccccggcccccttcttc 201
              ||||||||||||||||||||
Sbjct: 455052 cgcccccggcccccttcttc 455033



to top

>gb|AC124680.10| Mus musculus chromosome 14, clone RP23-383A19, complete sequence
          Length = 202809

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 265    ttcctcttcctctacatctc 284
              ||||||||||||||||||||
Sbjct: 112082 ttcctcttcctctacatctc 112063



to top

>gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds
          Length = 433

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 78  caaggaggaggacgtgcgcctgggcgcg 105
           |||||||||||||| |||||||| ||||
Sbjct: 316 caaggaggaggacgagcgcctggtcgcg 343



to top

>emb|CR450841.7| Zebrafish DNA sequence from clone DKEY-16N9 in linkage group 11, complete
              sequence
          Length = 263287

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 256    ctggccaccttcctcttcctctac 279
              |||||| |||||||||||||||||
Sbjct: 117776 ctggcctccttcctcttcctctac 117753



to top

>gb|AC124345.4| Mus musculus BAC clone RP24-459N19 from chromosome 15, complete
             sequence
          Length = 184532

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 13    ctcacacccacacccatcttctcc 36
             ||||||| ||||||||||||||||
Sbjct: 34549 ctcacacacacacccatcttctcc 34526



to top

>gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, complete sequence
          Length = 171990

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     cacacccacacccatcttct 34
              ||||||||||||||||||||
Sbjct: 165898 cacacccacacccatcttct 165917



to top

>emb|AL445586.6| Human DNA sequence from clone RP11-352F21 on chromosome 9, complete
             sequence
          Length = 198498

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 264   cttcctcttcctctacatct 283
             ||||||||||||||||||||
Sbjct: 73640 cttcctcttcctctacatct 73621



to top

>emb|AL359963.29| Human DNA sequence from clone RP11-18A3 on chromosome 9 Contains a NADH
             dehydrogenase subunit 2 pseudogene, the 5' end of the
             EPB41L4B gene for erythrocyte membrane protein band 4.1
             like 4B, the 3' end of the PTPN3 gene for protein tyrosine
             phosphatase (non-receptor type 3), and one CpG island,
             complete sequence
          Length = 134979

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ccacacccatcttctcctcc 39
             ||||||||||||||||||||
Sbjct: 55883 ccacacccatcttctcctcc 55864



to top

>emb|BX072361.1|CNS09RZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 141 ggagggcaaggaggaggacg 122



to top

>emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 387 ggagggcaaggaggaggacg 406



to top

>emb|BX068379.1|CNS09OXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX068378.1|CNS09OXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 497 ggagggcaaggaggaggacg 516



to top

>emb|BX067609.1|CNS09OBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 291 ggagggcaaggaggaggacg 272



to top

>emb|BX067608.1|CNS09OBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 489 ggagggcaaggaggaggacg 508



to top

>emb|BX061944.1|CNS09JYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 299 ggagggcaaggaggaggacg 280



to top

>emb|BX056299.1|CNS09FLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 302 ggagggcaaggaggaggacg 283



to top

>emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 239 ggagggcaaggaggaggacg 220



to top

>emb|BX055253.1|CNS09ESP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 484 ggagggcaaggaggaggacg 503



to top

>emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 203 ggagggcaaggaggaggacg 184



to top

>emb|BX049557.1|CNS09AEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 251 ggagggcaaggaggaggacg 232



to top

>emb|BX049556.1|CNS09AEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 468 ggagggcaaggaggaggacg 487



to top

>emb|BX049060.1|CNS09A0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX046605.1|CNS0984H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260



to top

>emb|BX046604.1|CNS0984G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 926 ggagggcaaggaggaggacg 945



to top

>emb|BX041706.1|CNS094CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 253 ggagggcaaggaggaggacg 234



to top

>emb|BX041977.1|CNS094JX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 464 ggagggcaaggaggaggacg 483



to top

>emb|BX041661.1|CNS094B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 483 ggagggcaaggaggaggacg 502



to top

>emb|BX041260.1|CNS09400 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 510 ggagggcaaggaggaggacg 529



to top

>emb|BX039117.1|CNS092CH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 345 ggagggcaaggaggaggacg 326



to top

>emb|BX039116.1|CNS092CG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 513 ggagggcaaggaggaggacg 532



to top

>emb|BX038773.1|CNS0922X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 329 ggagggcaaggaggaggacg 310



to top

>emb|BX038772.1|CNS0922W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 512 ggagggcaaggaggaggacg 531



to top

>emb|BX038693.1|CNS0920P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295



to top

>emb|BX038692.1|CNS0920O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 521 ggagggcaaggaggaggacg 540



to top

>emb|BX038208.1|CNS091N8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 341 ggagggcaaggaggaggacg 322



to top

>emb|BX038207.1|CNS091N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 467 ggagggcaaggaggaggacg 486



to top

>emb|BX038039.1|CNS091IJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 323 ggagggcaaggaggaggacg 304



to top

>emb|BX038038.1|CNS091II Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527



to top

>emb|BX037613.1|CNS0916P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 340 ggagggcaaggaggaggacg 321



to top

>emb|BX037612.1|CNS0916O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 514 ggagggcaaggaggaggacg 533



to top

>emb|BX037577.1|CNS0915P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 318 ggagggcaaggaggaggacg 299



to top

>emb|BX037488.1|CNS09138 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 270 ggagggcaaggaggaggacg 251



to top

>emb|BX037487.1|CNS09137 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 477 ggagggcaaggaggaggacg 496



to top

>emb|BX036984.1|CNS090P8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 366

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 277 ggagggcaaggaggaggacg 258



to top

>emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>emb|BX028080.1|CNS08TTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 388 ggagggcaaggaggaggacg 407



to top

>emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 292 ggagggcaaggaggaggacg 273



to top

>emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 498 ggagggcaaggaggaggacg 517



to top

>emb|BX024766.1|CNS08R9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 233 ggagggcaaggaggaggacg 214



to top

>emb|BX019545.1|CNS08N8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 248 ggagggcaaggaggaggacg 229



to top

>emb|BX019544.1|CNS08N8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 507 ggagggcaaggaggaggacg 526



to top

>emb|BX021590.1|CNS08OTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 280 ggagggcaaggaggaggacg 261



to top

>emb|BX021589.1|CNS08OTL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 350 ggagggcaaggaggaggacg 369



to top

>emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 304 ggagggcaaggaggaggacg 285



to top

>emb|BX020809.1|CNS08O7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 243 ggagggcaaggaggaggacg 262



to top

>emb|BX012334.1|CNS08HOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 319 ggagggcaaggaggaggacg 300



to top

>emb|BX008016.1|CNS08ECK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 287 ggagggcaaggaggaggacg 268



to top

>emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505



to top

>gb|AC151907.5| Mus musculus BAC clone RP23-163E23 from chromosome 15, complete
             sequence
          Length = 197165

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 2     catctctatctctcacacccacac 25
             ||||||||||||||||| ||||||
Sbjct: 93475 catctctatctctcacagccacac 93498



to top

>gb|AE005794.1| Caulobacter crescentus CB15 section 120 of 359 of the complete genome
          Length = 11475

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 128  ccatcggcacggcggcgcagggcg 151
            |||||||||||||||||| |||||
Sbjct: 2704 ccatcggcacggcggcgctgggcg 2727



to top

>gb|AE012270.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 178
            of 460 of the complete genome
          Length = 10135

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 61   gcggcggcgatggagggcaa 80
            ||||||||||||||||||||
Sbjct: 9243 gcggcggcgatggagggcaa 9262



to top

>gb|AC004034.2| Homo sapiens chromosome 16 clone LA16c-321D4, complete sequence
          Length = 37718

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 255  cctggccaccttcctcttcctcta 278
            |||||||||| |||||||||||||
Sbjct: 9904 cctggccaccatcctcttcctcta 9927



to top

>ref|XM_686756.1| PREDICTED: Danio rerio similar to Solute carrier family 4, sodium
            bicarbonate cotransporter-like, member 10 (LOC563401),
            mRNA
          Length = 1704

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 256  ctggccaccttcctcttcctctac 279
            |||||| |||||||||||||||||
Sbjct: 1477 ctggcctccttcctcttcctctac 1500



to top

>gb|AF393807.1|AF393807 Apium graveolens aquaporine PIP3-like protein mRNA, partial cds
          Length = 270

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 250 gagttcctggccaccttcctcttcctctacat 281
           |||||| | |||||||| ||||||||||||||
Sbjct: 79  gagttcatagccaccttgctcttcctctacat 110



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    cgcccccggcccccttcttc 201
              ||||||||||||||||||||
Sbjct: 455050 cgcccccggcccccttcttc 455031



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 132      cggcacggcggcgcagggcggcgg 155
                ||||||||||||| ||||||||||
Sbjct: 28616742 cggcacggcggcggagggcggcgg 28616765



to top

>gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complete sequence
          Length = 203106

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 13     ctcacacccacacccatcttctcc 36
              ||||||| ||||||||||||||||
Sbjct: 103003 ctcacacacacacccatcttctcc 103026



to top

>dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0034C09
          Length = 170226

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 132    cggcacggcggcgcagggcggcgg 155
              ||||||||||||| ||||||||||
Sbjct: 143181 cggcacggcggcggagggcggcgg 143204



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 132     cggcacggcggcgcagggcggcgg 155
               |||| |||||||||||||||||||
Sbjct: 2626407 cggcgcggcggcgcagggcggcgg 2626430



to top

>ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913
           (ENSANGG00000014424), mRNA
          Length = 817

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  ggagggcaaggaggaggacg 91
           ||||||||||||||||||||
Sbjct: 504 ggagggcaaggaggaggacg 523



to top

>gb|AY108280.1| Zea mays PCO132931 mRNA sequence
          Length = 1372

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 78  caaggaggaggacgtgcgcctgggcgcg 105
           |||||||||||||| |||||||| ||||
Sbjct: 192 caaggaggaggacgagcgcctggtcgcg 219



to top

>gb|AY106483.1| Zea mays PCO145034 mRNA sequence
          Length = 1197

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 60  agcggcggcgatggagggcaagga 83
           ||||| ||||||||||||||||||
Sbjct: 84  agcggtggcgatggagggcaagga 107



to top

>emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (myb31 gene)
          Length = 1264

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 78  caaggaggaggacgtgcgcctgggcgcg 105
           |||||||||||||| |||||||| ||||
Sbjct: 194 caaggaggaggacgagcgcctggtcgcg 221



to top

>emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064H22,
              complete sequence
          Length = 147214

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    acggcggcgcagggcggcgg 155
              ||||||||||||||||||||
Sbjct: 137665 acggcggcgcagggcggcgg 137646



to top

>gb|AC135113.4| Mus musculus BAC clone RP24-63N7 from 15, complete sequence
          Length = 173656

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 2     catctctatctctcacacccacac 25
             ||||||||||||||||| ||||||
Sbjct: 37419 catctctatctctcacagccacac 37396



to top

>gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, complete cds
          Length = 1278

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                       
Query: 197 tcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgccgagttcc 256
           |||| |||||||| ||||| || || ||||| |||||| | || || || || |||||| 
Sbjct: 334 tctttgaggccggcgagctgacgtcatggtcgttctacagagctgggattgctgagttca 393

                                       
Query: 257 tggccaccttcctcttcctctacatctc 284
           | || |||||| | ||||||||||||||
Sbjct: 394 ttgctaccttcttgttcctctacatctc 421



to top

>gb|AC113930.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1384D03,
             complete sequence
          Length = 116214

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   cgcccccggcccccttcttc 201
             ||||||||||||||||||||
Sbjct: 53512 cgcccccggcccccttcttc 53493



to top

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 238 gccggcatcgccgagttcctggccaccttcctcttc 273
           |||| ||||||||||||| | |||||| ||||||||
Sbjct: 149 gccgtcatcgccgagttcgtagccaccctcctcttc 184



to top

>dbj|AB032059.1| Mesembryanthemum crystallinum McMipA gene for PIP aquaporin, promoter
            region and partial cds
          Length = 2438

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 71/88 (80%)
 Strand = Plus / Plus

                                                                        
Query: 197  tcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgccgagttcc 256
            |||| |||||||| ||||| || || ||||| |||||| | || || || || |||||| 
Sbjct: 2292 tctttgaggccggcgagctgacgtcatggtcgttctacagagctgggattgctgagttca 2351

                                        
Query: 257  tggccaccttcctcttcctctacatctc 284
            | || |||||| | ||||||||||||||
Sbjct: 2352 ttgctaccttcttgttcctctacatctc 2379


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,987,745
Number of Sequences: 3902068
Number of extensions: 2987745
Number of successful extensions: 101605
Number of sequences better than 10.0: 194
Number of HSP's better than 10.0 without gapping: 195
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 100670
Number of HSP's gapped (non-prelim): 894
length of query: 311
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 289
effective length of database: 17,147,199,772
effective search space: 4955540734108
effective search space used: 4955540734108
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top