>gb|AC023424.7| Homo sapiens BAC clone RP11-555K12 from 4, complete sequence
          Length = 200147

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 3      atgagctttattacacta 20
              ||||||||||||||||||
Sbjct: 108507 atgagctttattacacta 108490

>ref|XM_943707.1| PREDICTED: Homo sapiens hypothetical protein LOC649431 (LOC649431),
           mRNA
          Length = 1026

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   atgagctttattacacta 20
           ||||||||||||||||||
Sbjct: 449 atgagctttattacacta 466

>ref|XM_933849.1| PREDICTED: Homo sapiens hypothetical protein LOC646725 (LOC646725),
           mRNA
          Length = 1026

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 3   atgagctttattacacta 20
           ||||||||||||||||||
Sbjct: 449 atgagctttattacacta 466

>gb|AC092235.1|AC092235 Drosophila melanogaster, chromosome 2L, region 21E-21F, BAC clone
              BACR30G21, complete sequence
          Length = 168370

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      gctttattacactagtaa 24
              ||||||||||||||||||
Sbjct: 130890 gctttattacactagtaa 130873

>gb|AC013467.8| Homo sapiens BAC clone RP11-451F14 from 2, complete sequence
          Length = 172966

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 4      tgagctttattacactagtaag 25
              ||||||||||| ||||||||||
Sbjct: 113559 tgagctttattgcactagtaag 113538

>gb|AE003588.3| Drosophila melanogaster chromosome 2L, section 3 of 83 of the complete
              sequence
          Length = 308447

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      gctttattacactagtaa 24
              ||||||||||||||||||
Sbjct: 168013 gctttattacactagtaa 167996

>gb|AC004420.1|AC004420 Drosophila melanogaster DNA sequence (P1 DS02649 (D132)), complete
             sequence
          Length = 79987

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     gctttattacactagtaa 24
             ||||||||||||||||||
Sbjct: 36461 gctttattacactagtaa 36478

>emb|AL807768.5| Mouse DNA sequence from clone RP23-302D20 on chromosome X, complete
             sequence
          Length = 95261

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 2     catgagctttattacact 19
             ||||||||||||||||||
Sbjct: 61720 catgagctttattacact 61703


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 163,283
Number of Sequences: 3902068
Number of extensions: 163283
Number of successful extensions: 41486
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41473
Number of HSP's gapped (non-prelim): 13
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)