| Clone Name | baet58b05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY112722.1| Bifidobacterium longum strain RW041 plasmid pNAC3, complete sequence Length = 10224 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 154 ctcctcgcccgcgacccgcgccgcc 178 |||||||||||||||| |||||||| Sbjct: 6289 ctcctcgcccgcgaccagcgccgcc 6313
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 157 ctcgcccgcgacccgcgccgc 177 ||||||||||||||||||||| Sbjct: 2542064 ctcgcccgcgacccgcgccgc 2542084
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 aaccgccgcgtcgagcagcg 92 |||||||||||||||||||| Sbjct: 1920434 aaccgccgcgtcgagcagcg 1920453
>emb|CT009567.9| Mouse DNA sequence from clone RP23-50H13 on chromosome 16, complete sequence Length = 213704 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccagcccgctccaacccttg 204 |||||||||||||||||||| Sbjct: 30580 ccagcccgctccaacccttg 30599
>emb|BX842577.1| Mycobacterium tuberculosis H37Rv complete genome; segment 6/13 Length = 347496 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 aaccgccgcgtcgagcagcg 92 |||||||||||||||||||| Sbjct: 198375 aaccgccgcgtcgagcagcg 198394
>emb|BX248340.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 7/14 Length = 291050 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 aaccgccgcgtcgagcagcg 92 |||||||||||||||||||| Sbjct: 973 aaccgccgcgtcgagcagcg 992
>gb|AC090610.6| Homo sapiens chromosome 17, clone RP11-493I24, complete sequence Length = 185980 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 156 cctcgcccgcgacccgcgccgccc 179 ||||||||||| |||||||||||| Sbjct: 63636 cctcgcccgcgccccgcgccgccc 63613
>gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete sequence Length = 96685 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 gccttgagagttgagagact 42 |||||||||||||||||||| Sbjct: 61661 gccttgagagttgagagact 61642
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 cctcgcccgcgacccgcgcc 175 |||||||||||||||||||| Sbjct: 359127 cctcgcccgcgacccgcgcc 359108 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,186,918 Number of Sequences: 3902068 Number of extensions: 1186918 Number of successful extensions: 74243 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 73540 Number of HSP's gapped (non-prelim): 704 length of query: 223 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 201 effective length of database: 17,147,199,772 effective search space: 3446587154172 effective search space used: 3446587154172 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)