Clone Name	baet58a04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clon...	291	7e-76
2	dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clon...	291	7e-76
3	dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clon...	291	7e-76
4	dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clon...	291	7e-76
5	dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clon...	291	7e-76
6	ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predic...	285	4e-74
7	gb|BT016485.1| Zea mays clone Contig318 mRNA sequence	280	3e-72
8	gb|BT016521.1| Zea mays clone Contig354 mRNA sequence	258	1e-65
9	gb|AY103617.1| Zea mays PCO143386 mRNA sequence	258	1e-65
10	gb|BT016624.1| Zea mays clone Contig457 mRNA sequence	250	2e-63
11	ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA	236	4e-59
12	ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group...	236	4e-59
13	ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group...	236	4e-59
14	ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group...	236	4e-59
15	dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	4e-59
16	dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	4e-59
17	dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	4e-59
18	dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clon...	236	4e-59
19	dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clon...	220	2e-54
20	dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clon...	220	2e-54
21	dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clon...	220	2e-54
22	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	202	5e-49
23	gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon...	202	5e-49
24	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	202	5e-49
25	gb|AY105034.1| Zea mays PCO130341 mRNA sequence	176	3e-41
26	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	172	5e-40
27	dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic D...	172	5e-40
28	gb|BT016512.1| Zea mays clone Contig345 mRNA sequence	168	7e-39
29	dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clon...	129	6e-27
30	gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p...	125	1e-25
31	gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA	82	1e-12
32	gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence	82	1e-12
33	gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence	82	1e-12
34	emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7	82	1e-12
35	gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ...	82	1e-12
36	gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA	82	1e-12
37	gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA	82	1e-12
38	ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, ...	82	1e-12
39	ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, ...	82	1e-12
40	gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end	82	1e-12
41	ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, ...	82	1e-12
42	gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o...	82	1e-12
43	gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k1...	82	1e-12
44	dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, parti...	82	1e-12
45	dbj|AB032438.1| Drosophila erecta sta gene for stubarista, parti...	80	5e-12
46	gb|AF097522.1|AF097522 Brassica napus laminin receptor-like prot...	72	1e-09
47	dbj|AB032439.1| Drosophila orena sta gene for stubarista, partia...	72	1e-09
48	dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complet...	66	8e-08
49	gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associate...	62	1e-06
50	ref|NM_001036190.1| Arabidopsis thaliana P40; structural constit...	60	5e-06
51	ref|NM_105896.2| Arabidopsis thaliana P40; structural constituen...	60	5e-06
52	gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal prote...	60	5e-06
53	emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue	60	5e-06
54	emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associa...	60	5e-06
55	gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal prote...	60	5e-06
56	gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal prote...	60	5e-06
57	gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	60	5e-06
58	gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal prote...	60	5e-06
59	gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	60	5e-06
60	gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	60	5e-06
61	emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Co...	60	5e-06
62	emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Co...	60	5e-06
63	gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete s...	60	5e-06
64	gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin recep...	60	5e-06
65	gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein m...	54	3e-04
66	gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ...	54	3e-04
67	gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se...	54	3e-04
68	gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein...	52	0.001
69	ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predi...	52	0.001
70	emb|CR938589.1| Single read from an extremity of a full-length c...	52	0.001
71	emb|CR938120.1| Single read from an extremity of a full-length c...	52	0.001
72	emb|CR938108.1| Single read from an extremity of a full-length c...	52	0.001
73	emb|CR937995.1| Single read from an extremity of a full-length c...	52	0.001
74	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	52	0.001
75	emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-...	50	0.005
76	emb|BX053371.1|CNS09DCF Single read from an extremity of a full-...	50	0.005
77	emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-...	50	0.005
78	emb|BX071531.1|CNS09RCV Single read from an extremity of a full-...	50	0.005
79	emb|BX071203.1|CNS09R3R Single read from an extremity of a full-...	50	0.005
80	emb|BX071128.1|CNS09R1O Single read from an extremity of a full-...	50	0.005
81	emb|BX071053.1|CNS09QZL Single read from an extremity of a full-...	50	0.005
82	emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-...	50	0.005
83	emb|BX070730.1|CNS09QQM Single read from an extremity of a full-...	50	0.005
84	emb|BX070261.1|CNS09QDL Single read from an extremity of a full-...	50	0.005
85	emb|BX070237.1|CNS09QCX Single read from an extremity of a full-...	50	0.005
86	emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-...	50	0.005
87	emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-...	50	0.005
88	emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-...	50	0.005
89	emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-...	50	0.005
90	emb|BX068381.1|CNS09OXD Single read from an extremity of a full-...	50	0.005
91	emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-...	50	0.005
92	emb|BX067522.1|CNS09O9I Single read from an extremity of a full-...	50	0.005
93	emb|BX067353.1|CNS09O4T Single read from an extremity of a full-...	50	0.005
94	emb|BX067352.1|CNS09O4S Single read from an extremity of a full-...	50	0.005
95	emb|BX067347.1|CNS09O4N Single read from an extremity of a full-...	50	0.005
96	emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-...	50	0.005
97	emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-...	50	0.005
98	emb|BX067213.1|CNS09O0X Single read from an extremity of a full-...	50	0.005
99	emb|BX066172.1|CNS09N80 Single read from an extremity of a full-...	50	0.005
100	emb|BX065840.1|CNS09MYS Single read from an extremity of a full-...	50	0.005
101	emb|BX065656.1|CNS09MTO Single read from an extremity of a full-...	50	0.005
102	emb|BX065484.1|CNS09MOW Single read from an extremity of a full-...	50	0.005
103	emb|BX065339.1|CNS09MKV Single read from an extremity of a full-...	50	0.005
104	emb|BX064723.1|CNS09M3R Single read from an extremity of a full-...	50	0.005
105	emb|BX064630.1|CNS09M16 Single read from an extremity of a full-...	50	0.005
106	emb|BX064621.1|CNS09M0X Single read from an extremity of a full-...	50	0.005
107	emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-...	50	0.005
108	emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-...	50	0.005
109	emb|BX063172.1|CNS09KWO Single read from an extremity of a full-...	50	0.005
110	emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-...	50	0.005
111	emb|BX062255.1|CNS09K77 Single read from an extremity of a full-...	50	0.005
112	emb|BX062254.1|CNS09K76 Single read from an extremity of a full-...	50	0.005
113	emb|BX062187.1|CNS09K5B Single read from an extremity of a full-...	50	0.005
114	emb|BX061828.1|CNS09JVC Single read from an extremity of a full-...	50	0.005
115	emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-...	50	0.005
116	emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-...	50	0.005
117	emb|BX061413.1|CNS09JJT Single read from an extremity of a full-...	50	0.005
118	emb|BX061395.1|CNS09JJB Single read from an extremity of a full-...	50	0.005
119	emb|BX060764.1|CNS09J1S Single read from an extremity of a full-...	50	0.005
120	emb|BX060566.1|CNS09IWA Single read from an extremity of a full-...	50	0.005
121	emb|BX060291.1|CNS09ION Single read from an extremity of a full-...	50	0.005
122	emb|BX060009.1|CNS09IGT Single read from an extremity of a full-...	50	0.005
123	emb|BX059650.1|CNS09I6U Single read from an extremity of a full-...	50	0.005
124	emb|BX059559.1|CNS09I4B Single read from an extremity of a full-...	50	0.005
125	emb|BX059479.1|CNS09I23 Single read from an extremity of a full-...	50	0.005
126	emb|BX059203.1|CNS09HUF Single read from an extremity of a full-...	50	0.005
127	emb|BX059202.1|CNS09HUE Single read from an extremity of a full-...	50	0.005
128	emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-...	50	0.005
129	emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-...	50	0.005
130	emb|BX058368.1|CNS09H78 Single read from an extremity of a full-...	50	0.005
131	emb|BX058299.1|CNS09H5B Single read from an extremity of a full-...	50	0.005
132	emb|BX058273.1|CNS09H4L Single read from an extremity of a full-...	50	0.005
133	emb|BX058144.1|CNS09H10 Single read from an extremity of a full-...	50	0.005
134	emb|BX058069.1|CNS09GYX Single read from an extremity of a full-...	50	0.005
135	emb|BX056716.1|CNS09FXC Single read from an extremity of a full-...	50	0.005
136	emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-...	50	0.005
137	emb|BX057691.1|CNS09GOF Single read from an extremity of a full-...	50	0.005
138	emb|BX057689.1|CNS09GOD Single read from an extremity of a full-...	50	0.005
139	emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-...	50	0.005
140	emb|BX057084.1|CNS09G7K Single read from an extremity of a full-...	50	0.005
141	emb|BX056920.1|CNS09G30 Single read from an extremity of a full-...	50	0.005
142	emb|BX056570.1|CNS09FTA Single read from an extremity of a full-...	50	0.005
143	emb|BX056337.1|CNS09FMT Single read from an extremity of a full-...	50	0.005
144	emb|BX056336.1|CNS09FMS Single read from an extremity of a full-...	50	0.005
145	emb|BX056269.1|CNS09FKX Single read from an extremity of a full-...	50	0.005
146	emb|BX056116.1|CNS09FGO Single read from an extremity of a full-...	50	0.005
147	emb|BX056090.1|CNS09FFY Single read from an extremity of a full-...	50	0.005
148	emb|BX055751.1|CNS09F6J Single read from an extremity of a full-...	50	0.005
149	emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-...	50	0.005
150	emb|BX054928.1|CNS09EJO Single read from an extremity of a full-...	50	0.005
151	emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-...	50	0.005
152	emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-...	50	0.005
153	emb|BX053590.1|CNS09DII Single read from an extremity of a full-...	50	0.005
154	emb|BX052800.1|CNS09CWK Single read from an extremity of a full-...	50	0.005
155	emb|BX052798.1|CNS09CWI Single read from an extremity of a full-...	50	0.005
156	emb|BX052551.1|CNS09CPN Single read from an extremity of a full-...	50	0.005
157	emb|BX052477.1|CNS09CNL Single read from an extremity of a full-...	50	0.005
158	emb|BX052476.1|CNS09CNK Single read from an extremity of a full-...	50	0.005
159	emb|BX051837.1|CNS09C5T Single read from an extremity of a full-...	50	0.005
160	emb|BX051209.1|CNS09BOD Single read from an extremity of a full-...	50	0.005
161	emb|BX049918.1|CNS09AOI Single read from an extremity of a full-...	50	0.005
162	emb|BX049879.1|CNS09ANF Single read from an extremity of a full-...	50	0.005
163	emb|BX049604.1|CNS09AFS Single read from an extremity of a full-...	50	0.005
164	emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-...	50	0.005
165	emb|BX049364.1|CNS09A94 Single read from an extremity of a full-...	50	0.005
166	emb|BX049219.1|CNS09A53 Single read from an extremity of a full-...	50	0.005
167	emb|BX049063.1|CNS09A0R Single read from an extremity of a full-...	50	0.005
168	emb|BX048945.1|CNS099XH Single read from an extremity of a full-...	50	0.005
169	emb|BX048268.1|CNS099EO Single read from an extremity of a full-...	50	0.005
170	emb|BX047396.1|CNS098QG Single read from an extremity of a full-...	50	0.005
171	emb|BX046740.1|CNS09888 Single read from an extremity of a full-...	50	0.005
172	emb|BX046217.1|CNS097TP Single read from an extremity of a full-...	50	0.005
173	emb|BX046120.1|CNS097R0 Single read from an extremity of a full-...	50	0.005
174	emb|BX045820.1|CNS097IO Single read from an extremity of a full-...	50	0.005
175	emb|BX045707.1|CNS097FJ Single read from an extremity of a full-...	50	0.005
176	emb|BX044948.1|CNS096UG Single read from an extremity of a full-...	50	0.005
177	emb|BX044495.1|CNS096HV Single read from an extremity of a full-...	50	0.005
178	emb|BX043740.1|CNS095WW Single read from an extremity of a full-...	50	0.005
179	emb|BX043445.1|CNS095OP Single read from an extremity of a full-...	50	0.005
180	emb|BX043330.1|CNS095LI Single read from an extremity of a full-...	50	0.005
181	emb|BX042876.1|CNS0958W Single read from an extremity of a full-...	50	0.005
182	emb|BX042850.1|CNS09586 Single read from an extremity of a full-...	50	0.005
183	emb|BX042652.1|CNS0952O Single read from an extremity of a full-...	50	0.005
184	emb|BX042358.1|CNS094UI Single read from an extremity of a full-...	50	0.005
185	emb|BX042337.1|CNS094TX Single read from an extremity of a full-...	50	0.005
186	emb|BX041420.1|CNS0944G Single read from an extremity of a full-...	50	0.005
187	emb|BX041297.1|CNS09411 Single read from an extremity of a full-...	50	0.005
188	emb|BX039405.1|CNS092KH Single read from an extremity of a full-...	50	0.005
189	emb|BX039319.1|CNS092I3 Single read from an extremity of a full-...	50	0.005
190	emb|BX037243.1|CNS090WF Single read from an extremity of a full-...	50	0.005
191	emb|BX036479.1|CNS090B7 Single read from an extremity of a full-...	50	0.005
192	emb|BX036426.1|CNS0909Q Single read from an extremity of a full-...	50	0.005
193	emb|BX036415.1|CNS0909F Single read from an extremity of a full-...	50	0.005
194	emb|BX036246.1|CNS0904Q Single read from an extremity of a full-...	50	0.005
195	emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-...	50	0.005
196	emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-...	50	0.005
197	emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-...	50	0.005
198	emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-...	50	0.005
199	emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-...	50	0.005
200	emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-...	50	0.005
201	emb|BX034628.1|CNS08YVS Single read from an extremity of a full-...	50	0.005
202	emb|BX034627.1|CNS08YVR Single read from an extremity of a full-...	50	0.005
203	emb|BX034339.1|CNS08YNR Single read from an extremity of a full-...	50	0.005
204	emb|BX034214.1|CNS08YKA Single read from an extremity of a full-...	50	0.005
205	emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-...	50	0.005
206	emb|BX033175.1|CNS08XRF Single read from an extremity of a full-...	50	0.005
207	emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-...	50	0.005
208	emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-...	50	0.005
209	emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-...	50	0.005
210	emb|BX032290.1|CNS08X2U Single read from an extremity of a full-...	50	0.005
211	emb|BX032289.1|CNS08X2T Single read from an extremity of a full-...	50	0.005
212	emb|BX032041.1|CNS08WVX Single read from an extremity of a full-...	50	0.005
213	emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-...	50	0.005
214	emb|BX031898.1|CNS08WRY Single read from an extremity of a full-...	50	0.005
215	emb|BX031717.1|CNS08WMX Single read from an extremity of a full-...	50	0.005
216	emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-...	50	0.005
217	emb|BX031483.1|CNS08WGF Single read from an extremity of a full-...	50	0.005
218	emb|BX031337.1|CNS08WCD Single read from an extremity of a full-...	50	0.005
219	emb|BX031303.1|CNS08WBF Single read from an extremity of a full-...	50	0.005
220	emb|BX030674.1|CNS08VTY Single read from an extremity of a full-...	50	0.005
221	emb|BX031154.1|CNS08W7A Single read from an extremity of a full-...	50	0.005
222	emb|BX031118.1|CNS08W6A Single read from an extremity of a full-...	50	0.005
223	emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-...	50	0.005
224	emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-...	50	0.005
225	emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-...	50	0.005
226	emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-...	50	0.005
227	emb|BX029939.1|CNS08V9J Single read from an extremity of a full-...	50	0.005
228	emb|BX029906.1|CNS08V8M Single read from an extremity of a full-...	50	0.005
229	emb|BX029898.1|CNS08V8E Single read from an extremity of a full-...	50	0.005
230	emb|BX029447.1|CNS08UVV Single read from an extremity of a full-...	50	0.005
231	emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-...	50	0.005
232	emb|BX028713.1|CNS08UBH Single read from an extremity of a full-...	50	0.005
233	emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-...	50	0.005
234	emb|BX028388.1|CNS08U2G Single read from an extremity of a full-...	50	0.005
235	emb|BX028172.1|CNS08TWG Single read from an extremity of a full-...	50	0.005
236	emb|BX027823.1|CNS08TMR Single read from an extremity of a full-...	50	0.005
237	emb|BX027638.1|CNS08THM Single read from an extremity of a full-...	50	0.005
238	emb|BX027470.1|CNS08TCY Single read from an extremity of a full-...	50	0.005
239	emb|BX026965.1|CNS08SYX Single read from an extremity of a full-...	50	0.005
240	emb|BX026808.1|CNS08SUK Single read from an extremity of a full-...	50	0.005
241	emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-...	50	0.005
242	emb|BX026536.1|CNS08SN0 Single read from an extremity of a full-...	50	0.005
243	emb|BX026482.1|CNS08SLI Single read from an extremity of a full-...	50	0.005
244	emb|BX026481.1|CNS08SLH Single read from an extremity of a full-...	50	0.005
245	emb|BX025854.1|CNS08S42 Single read from an extremity of a full-...	50	0.005
246	emb|BX025749.1|CNS08S15 Single read from an extremity of a full-...	50	0.005
247	emb|BX025670.1|CNS08RYY Single read from an extremity of a full-...	50	0.005
248	emb|BX025450.1|CNS08RSU Single read from an extremity of a full-...	50	0.005
249	emb|BX025107.1|CNS08RJB Single read from an extremity of a full-...	50	0.005
250	emb|BX025103.1|CNS08RJ7 Single read from an extremity of a full-...	50	0.005
251	emb|BX024846.1|CNS08RC2 Single read from an extremity of a full-...	50	0.005
252	emb|BX024832.1|CNS08RBO Single read from an extremity of a full-...	50	0.005
253	emb|BX024754.1|CNS08R9I Single read from an extremity of a full-...	50	0.005
254	emb|BX024652.1|CNS08R6O Single read from an extremity of a full-...	50	0.005
255	emb|BX024344.1|CNS08QY4 Single read from an extremity of a full-...	50	0.005
256	emb|BX024069.1|CNS08QQH Single read from an extremity of a full-...	50	0.005
257	emb|BX023999.1|CNS08QOJ Single read from an extremity of a full-...	50	0.005
258	emb|BX023956.1|CNS08QNC Single read from an extremity of a full-...	50	0.005
259	emb|BX023909.1|CNS08QM1 Single read from an extremity of a full-...	50	0.005
260	emb|BX023824.1|CNS08QJO Single read from an extremity of a full-...	50	0.005
261	emb|BX023742.1|CNS08QHE Single read from an extremity of a full-...	50	0.005
262	emb|BX023643.1|CNS08QEN Single read from an extremity of a full-...	50	0.005
263	emb|BX023296.1|CNS08Q50 Single read from an extremity of a full-...	50	0.005
264	emb|BX023108.1|CNS08PZS Single read from an extremity of a full-...	50	0.005
265	emb|BX022975.1|CNS08PW3 Single read from an extremity of a full-...	50	0.005
266	emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-...	50	0.005
267	emb|BX021908.1|CNS08P2G Single read from an extremity of a full-...	50	0.005
268	emb|BX021737.1|CNS08OXP Single read from an extremity of a full-...	50	0.005
269	emb|BX021571.1|CNS08OT3 Single read from an extremity of a full-...	50	0.005
270	emb|BX021462.1|CNS08OQ2 Single read from an extremity of a full-...	50	0.005
271	emb|BX021331.1|CNS08OMF Single read from an extremity of a full-...	50	0.005
272	emb|BX020818.1|CNS08O86 Single read from an extremity of a full-...	50	0.005
273	emb|BX020770.1|CNS08O6U Single read from an extremity of a full-...	50	0.005
274	emb|BX020718.1|CNS08O5E Single read from an extremity of a full-...	50	0.005
275	emb|BX020438.1|CNS08NXM Single read from an extremity of a full-...	50	0.005
276	emb|BX019922.1|CNS08NJA Single read from an extremity of a full-...	50	0.005
277	emb|BX019254.1|CNS08N0Q Single read from an extremity of a full-...	50	0.005
278	emb|BX019220.1|CNS08MZS Single read from an extremity of a full-...	50	0.005
279	emb|BX018801.1|CNS08MO5 Single read from an extremity of a full-...	50	0.005
280	emb|BX018535.1|CNS08MGR Single read from an extremity of a full-...	50	0.005
281	emb|BX017379.1|CNS08LKN Single read from an extremity of a full-...	50	0.005
282	emb|BX017311.1|CNS08LIR Single read from an extremity of a full-...	50	0.005
283	emb|BX017271.1|CNS08LHN Single read from an extremity of a full-...	50	0.005
284	emb|BX017270.1|CNS08LHM Single read from an extremity of a full-...	50	0.005
285	emb|BX016954.1|CNS08L8U Single read from an extremity of a full-...	50	0.005
286	emb|BX016896.1|CNS08L78 Single read from an extremity of a full-...	50	0.005
287	emb|BX016856.1|CNS08L64 Single read from an extremity of a full-...	50	0.005
288	emb|BX016665.1|CNS08L0T Single read from an extremity of a full-...	50	0.005
289	emb|BX015859.1|CNS08KEF Single read from an extremity of a full-...	50	0.005
290	emb|BX015858.1|CNS08KEE Single read from an extremity of a full-...	50	0.005
291	emb|BX015795.1|CNS08KCN Single read from an extremity of a full-...	50	0.005
292	emb|BX015743.1|CNS08KB7 Single read from an extremity of a full-...	50	0.005
293	emb|BX016230.1|CNS08KOQ Single read from an extremity of a full-...	50	0.005
294	emb|BX015945.1|CNS08KGT Single read from an extremity of a full-...	50	0.005
295	emb|BX015925.1|CNS08KG9 Single read from an extremity of a full-...	50	0.005
296	emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-...	50	0.005
297	emb|BX015611.1|CNS08K7J Single read from an extremity of a full-...	50	0.005
298	emb|BX014926.1|CNS08JOI Single read from an extremity of a full-...	50	0.005
299	emb|BX014301.1|CNS08J75 Single read from an extremity of a full-...	50	0.005
300	emb|BX013989.1|CNS08IYH Single read from an extremity of a full-...	50	0.005
301	emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-...	50	0.005
302	emb|BX013507.1|CNS08IL3 Single read from an extremity of a full-...	50	0.005
303	emb|BX013495.1|CNS08IKR Single read from an extremity of a full-...	50	0.005
304	emb|BX013299.1|CNS08IFB Single read from an extremity of a full-...	50	0.005
305	emb|BX013295.1|CNS08IF7 Single read from an extremity of a full-...	50	0.005
306	emb|BX013103.1|CNS08I9V Single read from an extremity of a full-...	50	0.005
307	emb|BX012511.1|CNS08HTF Single read from an extremity of a full-...	50	0.005
308	emb|BX012242.1|CNS08HLY Single read from an extremity of a full-...	50	0.005
309	emb|BX012147.1|CNS08HJB Single read from an extremity of a full-...	50	0.005
310	emb|BX012005.1|CNS08HFD Single read from an extremity of a full-...	50	0.005
311	emb|BX011777.1|CNS08H91 Single read from an extremity of a full-...	50	0.005
312	emb|BX011776.1|CNS08H90 Single read from an extremity of a full-...	50	0.005
313	emb|BX011772.1|CNS08H8W Single read from an extremity of a full-...	50	0.005
314	emb|BX011603.1|CNS08H47 Single read from an extremity of a full-...	50	0.005
315	emb|BX011581.1|CNS08H3L Single read from an extremity of a full-...	50	0.005
316	emb|BX011489.1|CNS08H11 Single read from an extremity of a full-...	50	0.005
317	emb|BX011488.1|CNS08H10 Single read from an extremity of a full-...	50	0.005
318	emb|BX011178.1|CNS08GSE Single read from an extremity of a full-...	50	0.005
319	emb|BX010356.1|CNS08G5K Single read from an extremity of a full-...	50	0.005
320	emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-...	50	0.005
321	emb|BX010071.1|CNS08FXN Single read from an extremity of a full-...	50	0.005
322	emb|BX009592.1|CNS08FKC Single read from an extremity of a full-...	50	0.005
323	emb|BX008659.1|CNS08EUF Single read from an extremity of a full-...	50	0.005
324	emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-...	50	0.005
325	emb|BX008395.1|CNS08EN3 Single read from an extremity of a full-...	50	0.005
326	emb|BX008250.1|CNS08EJ2 Single read from an extremity of a full-...	50	0.005
327	emb|BX007865.1|CNS08E8D Single read from an extremity of a full-...	50	0.005
328	emb|BX007549.1|CNS08DZL Single read from an extremity of a full-...	50	0.005
329	emb|BX007204.1|CNS08DQ0 Single read from an extremity of a full-...	50	0.005
330	emb|BX007203.1|CNS08DPZ Single read from an extremity of a full-...	50	0.005
331	emb|BX007147.1|CNS08DOF Single read from an extremity of a full-...	50	0.005
332	emb|BX006304.1|CNS08D10 Single read from an extremity of a full-...	50	0.005
333	emb|BX005921.1|CNS08CQD Single read from an extremity of a full-...	50	0.005
334	emb|BX005588.1|CNS08CH4 Single read from an extremity of a full-...	50	0.005
335	emb|CR938650.1| Single read from an extremity of a full-length c...	50	0.005
336	ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 ...	50	0.005
337	emb|BX041242.1|CNS093ZI Single read from an extremity of a full-...	48	0.018
338	emb|BX023957.1|CNS08QND Single read from an extremity of a full-...	48	0.018
339	emb|BX015037.1|CNS08JRL Single read from an extremity of a full-...	48	0.018
340	emb|BX024000.1|CNS08QOK Single read from an extremity of a full-...	46	0.072
341	emb|BX006256.1|CNS08CZO Single read from an extremity of a full-...	46	0.072
342	emb|BX069252.1|CNS09PLK Single read from an extremity of a full-...	44	0.28
343	emb|BX048785.1|CNS099T1 Single read from an extremity of a full-...	44	0.28
344	emb|BX014555.1|CNS08JE7 Single read from an extremity of a full-...	44	0.28
345	emb|CR938492.1| Single read from an extremity of a full-length c...	44	0.28
346	ref|NM_193932.1| Oryza sativa (japonica cultivar-group), predic...	42	1.1
347	gb|AF101045.1| Oryza sativa (japonica cultivar-group) putative A...	42	1.1
348	gb|U70541.1|OSU70541 Oryza sativa (indica cultivar-group) putati...	42	1.1
349	gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr...	42	1.1
350	ref|XM_572918.1| Cryptococcus neoformans var. neoformans JEC21 4...	42	1.1
351	emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-...	42	1.1
352	emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-...	42	1.1
353	emb|BX059338.1|CNS09HY6 Single read from an extremity of a full-...	42	1.1
354	emb|BX056727.1|CNS09FXN Single read from an extremity of a full-...	42	1.1
355	emb|BX030897.1|CNS08W05 Single read from an extremity of a full-...	42	1.1
356	emb|BX047263.1|CNS098MR Single read from an extremity of a full-...	42	1.1
357	emb|BX045530.1|CNS097AM Single read from an extremity of a full-...	42	1.1
358	emb|BX035678.1|CNS08ZOY Single read from an extremity of a full-...	42	1.1
359	emb|BX035677.1|CNS08ZOX Single read from an extremity of a full-...	42	1.1
360	emb|BX033928.1|CNS08YCC Single read from an extremity of a full-...	42	1.1
361	emb|BX032604.1|CNS08XBK Single read from an extremity of a full-...	42	1.1
362	emb|BX027127.1|CNS08T3F Single read from an extremity of a full-...	42	1.1
363	emb|BX027126.1|CNS08T3E Single read from an extremity of a full-...	42	1.1
364	emb|BX026703.1|CNS08SRN Single read from an extremity of a full-...	42	1.1
365	emb|BX024221.1|CNS08QUP Single read from an extremity of a full-...	42	1.1
366	emb|BX023584.1|CNS08QD0 Single read from an extremity of a full-...	42	1.1
367	emb|BX019733.1|CNS08NE1 Single read from an extremity of a full-...	42	1.1
368	emb|BX021163.1|CNS08OHR Single read from an extremity of a full-...	42	1.1
369	emb|BX020765.1|CNS08O6P Single read from an extremity of a full-...	42	1.1
370	emb|BX020707.1|CNS08O53 Single read from an extremity of a full-...	42	1.1
371	emb|BX018984.1|CNS08MT8 Single read from an extremity of a full-...	42	1.1
372	emb|BX012873.1|CNS08I3H Single read from an extremity of a full-...	42	1.1
373	emb|BX012174.1|CNS08HK2 Single read from an extremity of a full-...	42	1.1
374	emb|BX011604.1|CNS08H48 Single read from an extremity of a full-...	42	1.1
375	emb|BX011136.1|CNS08GR8 Single read from an extremity of a full-...	42	1.1
376	emb|BX007568.1|CNS08E04 Single read from an extremity of a full-...	42	1.1
377	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.1
378	dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.1
379	dbj|AP004317.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.1
380	emb|Y07956.1|OSDIHYFLA O.sativa mRNA for dihydroflavonol reductase	42	1.1
381	dbj|AB003495.1| Oryza sativa (japonica cultivar-group) DNA for d...	42	1.1
382	dbj|AB003496.1| Oryza sativa (japonica cultivar-group) mRNA for ...	42	1.1
383	ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constitu...	40	4.4
384	ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constitu...	40	4.4
385	gb|CP000148.1| Geobacter metallireducens GS-15, complete genome	40	4.4
386	ref|XM_520453.1| PREDICTED: Pan troglodytes similar to GLSR2492 ...	40	4.4
387	ref|XM_468611.1| Oryza sativa (japonica cultivar-group), mRNA	40	4.4
388	ref|XM_953899.1| Neurospora crassa OR74A hypothetical protein (N...	40	4.4
389	ref|XM_331436.1| Neurospora crassa OR74A hypothetical protein (N...	40	4.4
390	gb|BC060578.1| Rattus norvegicus ribosomal protein SA, mRNA (cDN...	40	4.4
391	gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, compl...	40	4.4
392	ref|NM_017138.1| Rattus norvegicus ribosomal protein SA (Rpsa), ...	40	4.4
393	gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal prote...	40	4.4
394	emb|BX029512.1|CNS08UXO Single read from an extremity of a full-...	40	4.4
395	emb|BX022896.1|CNS08PTW Single read from an extremity of a full-...	40	4.4
396	gb|CP000089.1| Dechloromonas aromatica RCB, complete genome	40	4.4
397	gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, com...	40	4.4
398	ref|XM_682448.1| PREDICTED: Danio rerio similar to urotensin 2 r...	40	4.4
399	gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genom...	40	4.4
400	gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete s...	40	4.4
401	gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mR...	40	4.4
402	gb|U02370.1|UCU02370 Urechis caupo 34/67 kD laminin binding prot...	40	4.4
403	dbj|D25224.1|RAT40RP Rat mRNA for 40kDa ribosomal protein, compl...	40	4.4

---

>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full
           insert sequence
          Length = 1310

 Score =  291 bits (147), Expect = 7e-76
 Identities = 207/227 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 308

---

>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full
           insert sequence
          Length = 1276

 Score =  291 bits (147), Expect = 7e-76
 Identities = 207/227 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 308

---

>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full
           insert sequence
          Length = 1223

 Score =  291 bits (147), Expect = 7e-76
 Identities = 207/227 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 308

---

>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full
           insert sequence
          Length = 1320

 Score =  291 bits (147), Expect = 7e-76
 Identities = 207/227 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 92  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 151

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 152 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 211

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 212 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 271

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 272 gagaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 318

---

>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full
           insert sequence
          Length = 1182

 Score =  291 bits (147), Expect = 7e-76
 Identities = 207/227 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 83  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 142

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 202

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 203 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 262

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 263 gagaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 309

---

>ref|XM_470555.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 918

 Score =  285 bits (144), Expect = 4e-74
 Identities = 204/224 (91%)
 Strand = Plus / Plus

                                                                       
Query: 109 atggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgtacag 168
           |||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| |||
Sbjct: 1   atggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtgcag 60

                                                                       
Query: 169 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 228
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 120

                                                                       
Query: 229 tacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgggag 288
           |||| |||||||||||||||||| || ||||||||||||||||| |||||||||||||||
Sbjct: 121 tacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgggag 180

                                                       
Query: 289 aagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           ||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 181 aagctgcagctcgcggcgagggtgattgttgccattgagaaccc 224

---

>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence
          Length = 1267

 Score =  280 bits (141), Expect = 3e-72
 Identities = 183/197 (92%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||
Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| ||||||||||||||||| ||||  ||||||||| |||||||||||
Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||||||||||| ||||||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318

                            
Query: 319 gccatcgagaacccgca 335
           |||||||||||||||||
Sbjct: 319 gccatcgagaacccgca 335

---

>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence
          Length = 1275

 Score =  258 bits (130), Expect = 1e-65
 Identities = 178/194 (91%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 358 gccattgagaaccc 371

---

>gb|AY103617.1| Zea mays PCO143386 mRNA sequence
          Length = 1516

 Score =  258 bits (130), Expect = 1e-65
 Identities = 178/194 (91%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 397 gccattgagaaccc 410

---

>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence
          Length = 1418

 Score =  250 bits (126), Expect = 2e-63
 Identities = 177/194 (91%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacc 201
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 133 ctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggcacc 192

                                                                       
Query: 202 aagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctac 261
           ||||||||||| ||||||| ||||||||| | ||  |||||||| |||||||||||||||
Sbjct: 193 aagaactgcgatttccagacggagcgctatgtctttaagcgccgttccgacggcatctac 252

                                                                       
Query: 262 atcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcc 321
           |||||||| || |||||||||||||| || |||||||| || |||||||| ||||| |||
Sbjct: 253 atcatcaatcttggcaagacatgggataaactccagcttgcagcgagggttatcgttgcc 312

                         
Query: 322 atcgagaacccgca 335
           ||||||||||||||
Sbjct: 313 atcgagaacccgca 326

---

>ref|XM_479167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1280

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 298

---

>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1298

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 300

---

>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1310

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 301

---

>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1343

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 125 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 184

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 185 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 244

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 245 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 303

---

>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full
           insert sequence
          Length = 1298

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 300

---

>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full
           insert sequence
          Length = 1280

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 298

---

>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full
           insert sequence
          Length = 1342

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 124 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 183

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 243

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 244 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 302

---

>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full
           insert sequence
          Length = 1310

 Score =  236 bits (119), Expect = 4e-59
 Identities = 164/179 (91%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                      
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
           |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 301

---

>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full
           insert sequence
          Length = 1264

 Score =  220 bits (111), Expect = 2e-54
 Identities = 180/203 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 115 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 174

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 175 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 234

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 235 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 294

                                  
Query: 310 gtcatcgtcgccatcgagaaccc 332
           || || || ||||| ||||||||
Sbjct: 295 gtgattgttgccattgagaaccc 317

---

>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full
           insert sequence
          Length = 1176

 Score =  220 bits (111), Expect = 2e-54
 Identities = 180/203 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 118 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 177

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 178 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 237

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 238 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 297

                                  
Query: 310 gtcatcgtcgccatcgagaaccc 332
           || || || ||||| ||||||||
Sbjct: 298 gtgattgttgccattgagaaccc 320

---

>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full
           insert sequence
          Length = 1245

 Score =  220 bits (111), Expect = 2e-54
 Identities = 180/203 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 121 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 180

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 181 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 240

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 241 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 300

                                  
Query: 310 gtcatcgtcgccatcgagaaccc 332
           || || || ||||| ||||||||
Sbjct: 301 gtgattgttgccattgagaaccc 323

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  202 bits (102), Expect = 5e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 106     accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320485 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320426

                                                                           
Query: 166     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320425 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320366

                                         
Query: 226     cgctacgcctacaagcgccgctccga 251
               ||||||| ||||||||||||||||||
Sbjct: 4320365 cgctacgtctacaagcgccgctccga 4320340



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                           
Query: 256     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4319936 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319877

                                
Query: 316     gtcgccatcgagaaccc 332
               || ||||| ||||||||
Sbjct: 4319876 gttgccattgagaaccc 4319860



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 173      tgctcgccgccgacgtccacctcg 196
                ||||||||||||||||| ||||||
Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027

---

>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score =  202 bits (102), Expect = 5e-49
 Identities = 135/146 (92%)
 Strand = Plus / Plus

                                                                          
Query: 106    accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
              ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 106012 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 106071

                                                                          
Query: 166    cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106072 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 106131

                                        
Query: 226    cgctacgcctacaagcgccgctccga 251
              ||||||| ||||||||||||||||||
Sbjct: 106132 cgctacgtctacaagcgccgctccga 106157



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 70/77 (90%)
 Strand = Plus / Plus

                                                                          
Query: 256    atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
              ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 106561 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 106620

                               
Query: 316    gtcgccatcgagaaccc 332
              || ||||| ||||||||
Sbjct: 106621 gttgccattgagaaccc 106637

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  202 bits (102), Expect = 5e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 106     accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320600 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320541

                                                                           
Query: 166     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320540 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320481

                                         
Query: 226     cgctacgcctacaagcgccgctccga 251
               ||||||| ||||||||||||||||||
Sbjct: 4320480 cgctacgtctacaagcgccgctccga 4320455



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 70/77 (90%)
 Strand = Plus / Minus

                                                                           
Query: 256     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4320051 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319992

                                
Query: 316     gtcgccatcgagaaccc 332
               || ||||| ||||||||
Sbjct: 4319991 gttgccattgagaaccc 4319975



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 173      tgctcgccgccgacgtccacctcg 196
                ||||||||||||||||| ||||||
Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660

---

>gb|AY105034.1| Zea mays PCO130341 mRNA sequence
          Length = 1213

 Score =  176 bits (89), Expect = 3e-41
 Identities = 167/193 (86%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 202
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 76  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135

                                                                       
Query: 203 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 262
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || |||||||
Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195

                                                                       
Query: 263 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 322
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255

                        
Query: 323 tcgagaacccgca 335
           | ||||| |||||
Sbjct: 256 ttgagaatccgca 268

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  172 bits (87), Expect = 5e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                            
Query: 136      cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
                |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 25361982 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 25361923

                                                                   
Query: 196      ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
                ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 25361922 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 25361872



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 256      atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
                |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 25361294 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 25361236

---

>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1056G08
          Length = 168173

 Score =  172 bits (87), Expect = 5e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                         
Query: 136   cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
             |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 55072 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 55013

                                                                
Query: 196   ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
             ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 55012 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 54962



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 256   atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcat 314
             |||||||| || ||||| |||||||| ||||||||||||||| | ||||||||||||||
Sbjct: 54384 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcat 54326

---

>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence
          Length = 1208

 Score =  168 bits (85), Expect = 7e-39
 Identities = 166/193 (86%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 202
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 73  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132

                                                                       
Query: 203 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 262
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || ||||| |
Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192

                                                                       
Query: 263 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 322
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252

                        
Query: 323 tcgagaacccgca 335
           | ||||| |||||
Sbjct: 253 ttgagaatccgca 265

---

>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full
           insert sequence
          Length = 1144

 Score =  129 bits (65), Expect = 6e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                       
Query: 228 ctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatggga 287
           ||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225

                                                        
Query: 288 gaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||| |||||||| |||||||| || || ||||| ||||||||
Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaaccc 270



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 89  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 148

                                   
Query: 166 cagatgatgctcgccgccgacgtc 189
           |||||||||||||||||| |||||
Sbjct: 149 cagatgatgctcgccgcctacgtc 172

---

>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds
          Length = 1141

 Score =  125 bits (63), Expect = 1e-25
 Identities = 141/167 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 124 cagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaaatggaa 183

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           || |||  || ||||||||||  |||||| || ||||| || ||||| || ||||| |||
Sbjct: 184 cgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaagacgtgg 243

                                                          
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
           |||||||| ||||| || || ||||| || || || || ||||||||
Sbjct: 244 gagaagcttcagctagcagctagggttatagttgcaattgagaaccc 290

---

>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA
          Length = 2515

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                        
Query: 212  acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
            |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 1681 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 1740

                                                                        
Query: 272  tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
            |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 1741 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 1800

             
Query: 332  c 332
            |
Sbjct: 1801 c 1801

---

>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence
          Length = 627

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 193

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 194 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 253

            
Query: 332 c 332
           |
Sbjct: 254 c 254

---

>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence
          Length = 579

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 59  acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 118

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 119 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 178

            
Query: 332 c 332
           |
Sbjct: 179 c 179

---

>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7
          Length = 45861

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 212   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 16965 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 16906

                                                                         
Query: 272   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 16905 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 16846

              
Query: 332   c 332
             |
Sbjct: 16845 c 16845

---

>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                          
Query: 212    acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
              |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 159536 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 159477

                                                                          
Query: 272    tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
              |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 159476 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 159417

               
Query: 332    c 332
              |
Sbjct: 159416 c 159416

---

>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA
          Length = 1104

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 332 c 332
           |
Sbjct: 392 c 392

---

>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA
          Length = 964

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 761 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 702

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 701 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 642

            
Query: 332 c 332
           |
Sbjct: 641 c 641

---

>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D
           (sta), mRNA
          Length = 1041

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 221 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 280

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 281 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 340

            
Query: 332 c 332
           |
Sbjct: 341 c 341

---

>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B
           (sta), mRNA
          Length = 1089

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 332 c 332
           |
Sbjct: 392 c 392

---

>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end
          Length = 1272

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 174 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 233

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 234 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 293

            
Query: 332 c 332
           |
Sbjct: 294 c 294

---

>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A
           (sta), mRNA
          Length = 1236

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 419 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 478

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 479 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 538

            
Query: 332 c 332
           |
Sbjct: 539 c 539

---

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 212   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 22120 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 22061

                                                                         
Query: 272   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 22060 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 22001

              
Query: 332   c 332
             |
Sbjct: 22000 c 22000

---

>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds
          Length = 902

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 150

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 151 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 210

            
Query: 332 c 332
           |
Sbjct: 211 c 211

---

>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds
          Length = 1545

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 721 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 780

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 781 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 840

            
Query: 332 c 332
           |
Sbjct: 841 c 841

---

>dbj|AB032438.1| Drosophila erecta sta gene for stubarista, partial cds
          Length = 1532

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 705 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 764

                                       
Query: 272 tgggcaagacatgggagaagctccagct 299
           |||||||||| ||||| ||||| |||||
Sbjct: 765 tgggcaagacctgggaaaagctgcagct 792

---

>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete
           cds
          Length = 1138

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           |||||||| |||||||||||| ||| ||| |||||||| |||| || |||| | |||  |
Sbjct: 118 cacctcggaaccaagaactgcaactaccaaatggagcgttacgtcttcaagagacgcaac 177

                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagct 293
           ||||| || |||||| | ||||| || |||||||||||||||||
Sbjct: 178 gacggtatttacatctttaaccttggaaagacatgggagaagct 221

---

>dbj|AB032439.1| Drosophila orena sta gene for stubarista, partial cds
          Length = 1371

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||| |||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 554 acttccaaatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 613

                                       
Query: 272 tgggcaagacatgggagaagctccagct 299
           | |||||||| ||||||||||| |||||
Sbjct: 614 taggcaagacctgggagaagctgcagct 641

---

>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds
          Length = 1111

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 193 ctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgac 252
           ||||||||||| ||||| || |||||||||||||| || | || |||||||||   ||| 
Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212

                                                    
Query: 253 ggcatctacatcatcaacctgggcaagacatgggagaagct 293
           || || || ||||||||  |||| |||||||||||||||||
Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagct 253

---

>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like
           mRNA, complete cds
          Length = 1106

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 187 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173

                                                          
Query: 247 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 293
             |||||| |||||||| || |||   || ||||||||||| |||||
Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagct 220

---

>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.2 mRNA,
           complete cds
          Length = 1173

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 296 gccattgagaaccc 309

---

>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.1 mRNA,
           complete cds
          Length = 1185

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 296 gccattgagaaccc 309

---

>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1032

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 211 gccattgagaaccc 224

---

>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue
          Length = 1073

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 96  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 216 gccattgagaaccc 229

---

>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40
          Length = 1169

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||| | || ||||| || |||||||| |||||||||||  ||||||||||||||
Sbjct: 120 cagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccagatggag 179

             
Query: 226 cg 227
           ||
Sbjct: 180 cg 181

---

>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1103

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 273 gccattgagaaccc 286

---

>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1042

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 211 gccattgagaaccc 224

---

>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 897

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 211 gccattgagaaccc 224

---

>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370; T10D10.16) mRNA,
           complete cds
          Length = 1151

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 293 gccattgagaaccc 306

---

>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1182

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 296 gccattgagaaccc 309

---

>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1168

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 276 gccattgagaaccc 289

---

>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1096

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 280 gccattgagaaccc 293

---

>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1126

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 266 gccattgagaaccc 279

---

>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence
          Length = 1177

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 293 gccattgagaaccc 306

---

>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA,
           complete cds
          Length = 1137

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 108/134 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264

                         
Query: 319 gccatcgagaaccc 332
           ||||| ||||||||
Sbjct: 265 gccattgagaaccc 278

---

>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds
          Length = 1061

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 187 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162

                                                          
Query: 247 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 293
             |||||| ||||| || || |||   || ||||||||||| |||||
Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagct 209

---

>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 166   cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 224
             ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 42985 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 42927



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 283   tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
             |||||||| || || || ||||| ||||||||||| || |||||||||||
Sbjct: 42208 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaaccc 42159

---

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166  cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 224
            ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 8505 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 8447



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                              
Query: 283  tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaaccc 332
            |||||||| || || || ||||| ||||||||||| || |||||||||||
Sbjct: 7728 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaaccc 7679

---

>gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein SA mRNA, complete
           cds
          Length = 867

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 92  acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 151

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 152 tgggccgcacctgggaaaagctgctgctcgctgc 185

---

>ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predicted mRNA
          Length = 726

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 260 acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 305
           ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 47  acatcatcaacgttggcaagacctgggagaagatccagctggctgc 92

---

>emb|CR938589.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 611

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 158 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 217

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 218 tgggccgcacctgggaaaagctgctgctcgctgc 251

---

>emb|CR938120.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 876

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249

---

>emb|CR938108.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 855

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249

---

>emb|CR937995.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YN23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 757

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 162 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 221

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 222 tgggccgcacctgggaaaagctgctgctcgctgc 255

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                             
Query: 260     acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 305
               ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 1902094 acatcatcaacgttggcaagacctgggagaagatccagctggctgc 1902139

---

>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 272 tgggc 276
           |||||
Sbjct: 163 tgggc 167

---

>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 272 tgggc 276
           |||||
Sbjct: 193 tgggc 197

---

>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 97  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 156

                
Query: 272 tgggc 276
           |||||
Sbjct: 157 tgggc 161

---

>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 137 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 196

                
Query: 272 tgggc 276
           |||||
Sbjct: 197 tgggc 201

---

>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 114 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 173

                
Query: 272 tgggc 276
           |||||
Sbjct: 174 tgggc 178

---

>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 272 tgggc 276
           |||||
Sbjct: 181 tgggc 185

---

>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 572

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 964 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 905

                
Query: 272 tgggc 276
           |||||
Sbjct: 904 tgggc 900

---

>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 160 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 219

                
Query: 272 tgggc 276
           |||||
Sbjct: 220 tgggc 224

---

>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 272 tgggc 276
           |||||
Sbjct: 194 tgggc 198

---

>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 214

                
Query: 272 tgggc 276
           |||||
Sbjct: 215 tgggc 219

---

>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX062255.1|CNS09K77 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 962 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgaacatcatcaacc 903

                
Query: 272 tgggc 276
           |||||
Sbjct: 902 tgggc 898

---

>emb|BX062254.1|CNS09K76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 272 tgggc 276
           |||||
Sbjct: 196 tgggc 200

---

>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 167 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 226

                
Query: 272 tgggc 276
           |||||
Sbjct: 227 tgggc 231

---

>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 94  acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 153

                
Query: 272 tgggc 276
           |||||
Sbjct: 154 tgggc 158

---

>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 162 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 221

                
Query: 272 tgggc 276
           |||||
Sbjct: 222 tgggc 226

---

>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 272 tgggc 276
           |||||
Sbjct: 196 tgggc 200

---

>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 983 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 924

                
Query: 272 tgggc 276
           |||||
Sbjct: 923 tgggc 919

---

>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 272 tgggc 276
           |||||
Sbjct: 151 tgggc 155

---

>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 129 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 188

                
Query: 272 tgggc 276
           |||||
Sbjct: 189 tgggc 193

---

>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 193

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 95  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 154

                
Query: 272 tgggc 276
           |||||
Sbjct: 155 tgggc 159

---

>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 105 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 164

                
Query: 272 tgggc 276
           |||||
Sbjct: 165 tgggc 169

---

>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 979 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 920

                
Query: 272 tgggc 276
           |||||
Sbjct: 919 tgggc 915

---

>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 272 tgggc 276
           |||||
Sbjct: 187 tgggc 191

---

>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 56  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 115

                
Query: 272 tgggc 276
           |||||
Sbjct: 116 tgggc 120

---

>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 227

                
Query: 272 tgggc 276
           |||||
Sbjct: 228 tgggc 232

---

>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 285

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 227

                
Query: 272 tgggc 276
           |||||
Sbjct: 228 tgggc 232

---

>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 272 tgggc 276
           |||||
Sbjct: 181 tgggc 185

---

>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 272 tgggc 276
           |||||
Sbjct: 163 tgggc 167

---

>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 119 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 178

                
Query: 272 tgggc 276
           |||||
Sbjct: 179 tgggc 183

---

>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 338

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 272 tgggc 276
           |||||
Sbjct: 186 tgggc 190

---

>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 214

                
Query: 272 tgggc 276
           |||||
Sbjct: 215 tgggc 219

---

>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 164 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 223

                
Query: 272 tgggc 276
           |||||
Sbjct: 224 tgggc 228

---

>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 272 tgggc 276
           |||||
Sbjct: 186 tgggc 190

---

>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 272 tgggc 276
           |||||
Sbjct: 180 tgggc 184

---

>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 272 tgggc 276
           |||||
Sbjct: 226 tgggc 230

---

>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 272 tgggc 276
           |||||
Sbjct: 193 tgggc 197

---

>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 81  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 140

                
Query: 272 tgggc 276
           |||||
Sbjct: 141 tgggc 145

---

>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 215

                
Query: 272 tgggc 276
           |||||
Sbjct: 216 tgggc 220

---

>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 272 tgggc 276
           |||||
Sbjct: 180 tgggc 184

---

>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 215

                
Query: 272 tgggc 276
           |||||
Sbjct: 216 tgggc 220

---

>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 80  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 139

                
Query: 272 tgggc 276
           |||||
Sbjct: 140 tgggc 144

---

>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 272 tgggc 276
           |||||
Sbjct: 187 tgggc 191

---

>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1079

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 981 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 922

                
Query: 272 tgggc 276
           |||||
Sbjct: 921 tgggc 917

---

>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 993 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 934

                
Query: 272 tgggc 276
           |||||
Sbjct: 933 tgggc 929

---

>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 986 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 927

                
Query: 272 tgggc 276
           |||||
Sbjct: 926 tgggc 922

---

>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX031154.1|CNS08W7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX031118.1|CNS08W6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 272 tgggc 276
           |||||
Sbjct: 194 tgggc 198

---

>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX029939.1|CNS08V9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX029906.1|CNS08V8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX029898.1|CNS08V8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX029447.1|CNS08UVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX028713.1|CNS08UBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 272 tgggc 276
           |||||
Sbjct: 151 tgggc 155

---

>emb|BX028388.1|CNS08U2G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX028172.1|CNS08TWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 78  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 137

                
Query: 272 tgggc 276
           |||||
Sbjct: 138 tgggc 142

---

>emb|BX027823.1|CNS08TMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 272 tgggc 276
           |||||
Sbjct: 226 tgggc 230

---

>emb|BX027638.1|CNS08THM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX027470.1|CNS08TCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 88  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 147

                
Query: 272 tgggc 276
           |||||
Sbjct: 148 tgggc 152

---

>emb|BX026965.1|CNS08SYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX026808.1|CNS08SUK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX026536.1|CNS08SN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 623

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX026482.1|CNS08SLI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 983 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 924

                
Query: 272 tgggc 276
           |||||
Sbjct: 923 tgggc 919

---

>emb|BX026481.1|CNS08SLH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1040

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX025854.1|CNS08S42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX025749.1|CNS08S15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX025670.1|CNS08RYY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 162 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 221

                
Query: 272 tgggc 276
           |||||
Sbjct: 222 tgggc 226

---

>emb|BX025450.1|CNS08RSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX025107.1|CNS08RJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX025103.1|CNS08RJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,710,715
Number of Sequences: 3902068
Number of extensions: 1710715
Number of successful extensions: 43384
Number of sequences better than 10.0: 403
Number of HSP's better than 10.0 without gapping: 382
Number of HSP's successfully gapped in prelim test: 24
Number of HSP's that attempted gapping in prelim test: 42658
Number of HSP's gapped (non-prelim): 726
length of query: 335
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 313
effective length of database: 17,147,199,772
effective search space: 5367073528636
effective search space used: 5367073528636
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---