| Clone Name | baet57g07 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|CP000089.1| Dechloromonas aromatica RCB, complete genome | 40 | 0.67 | 2 | ref|XM_317196.2| Anopheles gambiae str. PEST ENSANGP00000018305 ... | 38 | 2.6 |
|---|
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 0.67 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 aggctgccggacatgtcgtg 59 |||||||||||||||||||| Sbjct: 166478 aggctgccggacatgtcgtg 166497
>ref|XM_317196.2| Anopheles gambiae str. PEST ENSANGP00000018305 (ENSANGG00000015816), partial mRNA Length = 1608 Score = 38.2 bits (19), Expect = 2.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 41 ggctgccggacatgtcgtgctgg 63 ||||||||||| ||||||||||| Sbjct: 565 ggctgccggacgtgtcgtgctgg 543 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 326,186 Number of Sequences: 3902068 Number of extensions: 326186 Number of successful extensions: 18333 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 18311 Number of HSP's gapped (non-prelim): 22 length of query: 68 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 47 effective length of database: 17,151,101,840 effective search space: 806101786480 effective search space used: 806101786480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)