ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet57d11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 54 1e-04
2emb|AL353786.16| Human DNA sequence from clone RP5-1175B15 on ch... 44 0.095
3emb|AL162171.4|CNS01RHP Human chromosome 14 DNA sequence BAC R-5... 44 0.095
4dbj|AB079894.1| Sus scrofa gene for T-cell receptor beta-chain, ... 44 0.095
5dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 42 0.38
6ref|XM_591416.2| PREDICTED: Bos taurus hypothetical LOC513688 (L... 40 1.5
7gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 1.5
8emb|AL356464.15| Human DNA sequence from clone RP11-38O23 on chr... 40 1.5
9dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 40 1.5
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.5
11gb|AF339312.1|AF339312 Hepatitis C virus isolate HCP98 polyprote... 40 1.5
12gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033... 40 1.5
13dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 1.5
14emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on ... 40 1.5
15gb|AY634220.1| Oikopleura dioica transposon LTR retrotransposon ... 38 5.9
16gb|AF276886.1| Homo sapiens GABA A receptor B3 subunit (GABRB3) ... 38 5.9
17gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosom... 38 5.9
18gb|AC163679.3| Mus musculus BAC clone RP24-104E24 from chromosom... 38 5.9
19gb|AC108813.8| Mus musculus chromosome 1, clone RP23-320P13, com... 38 5.9
20gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 38 5.9
21gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, c... 38 5.9
22gb|AC124386.4| Mus musculus BAC clone RP24-422C24 from chromosom... 38 5.9
23gb|AC102692.6| Mus musculus chromosome 18, clone RP24-491K18, co... 38 5.9
24gb|AC104296.4| Mus Musculus Strain 129S6/SvEvTac chromosome 2 BA... 38 5.9
25gb|AC133339.3| Oryza sativa chromosome 3 BAC OSJNBa0078D06 genom... 38 5.9
26gb|AC162904.4| Mus musculus BAC clone RP24-152H15 from chromosom... 38 5.9
27gb|AC104569.7| Homo sapiens chromosome 15, clone RP11-147D1, com... 38 5.9
28gb|AC108714.3| Homo sapiens 3p BAC RP11-146G16 (Roswell Park Can... 38 5.9
29dbj|AK131654.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 38 5.9
30gb|AY055726.2| Mus musculus synovial sarcoma associated SS18 (Ss... 38 5.9
31gb|AC133778.4| Oryza sativa chromosome 3 BAC OSJNBb0027B08 genom... 38 5.9
32gb|AF256078.1|AF256078 Drosophila simulans strain sim8 cut prote... 38 5.9
33gb|AF256077.1|AF256077 Drosophila simulans strain sim7 cut prote... 38 5.9
34gb|AF256076.1|AF256076 Drosophila simulans strain sim5 cut prote... 38 5.9
35gb|AF256075.1|AF256075 Drosophila simulans strain sim4 cut prote... 38 5.9
36gb|AF256074.1|AF256074 Drosophila simulans strain sim3 cut prote... 38 5.9
37gb|AF256073.1|AF256073 Drosophila simulans strain sim2 cut prote... 38 5.9
38emb|BX511004.9| Zebrafish DNA sequence from clone RP71-45K5 in l... 38 5.9
39gb|AC130723.4| Mus musculus BAC clone RP24-409P7 from 8, complet... 38 5.9
40emb|AL929158.8| Mouse DNA sequence from clone RP23-92O15 on chro... 38 5.9
41gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosom... 38 5.9
42emb|AL844481.5| Mouse DNA sequence from clone RP23-44H23 on chro... 38 5.9 
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 58  caatggcggcaacgaccatgtccctctcttccccagcctttgccggcaagg 108
           ||||||||||| | |||||||||||||| ||| |  |||||||||||||||
Sbjct: 8   caatggcggcagccaccatgtccctctcctcctcgacctttgccggcaagg 58
to top
>emb|AL353786.16| Human DNA sequence from clone RP5-1175B15 on chromosome X Contains the
              gene for a protein similar to rat fertility related protein
              WMP1, the 3' end of the PTPN21 gene for protein tyrosine
              phosphatase non-receptor type 21 and CpG islands, complete
              sequence
          Length = 139565

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 75     atgtccctctcttccccagcct 96
              ||||||||||||||||||||||
Sbjct: 102165 atgtccctctcttccccagcct 102186
to top
>emb|AL162171.4|CNS01RHP Human chromosome 14 DNA sequence BAC R-507K2 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 197550

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 75     atgtccctctcttccccagcct 96
              ||||||||||||||||||||||
Sbjct: 178932 atgtccctctcttccccagcct 178911
to top
>dbj|AB079894.1| Sus scrofa gene for T-cell receptor beta-chain, Dbeta-1 to 3' End Vbeta
             region
          Length = 34575

 Score = 44.1 bits (22), Expect = 0.095
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 75    atgtccctctcttccccagcctttgc 100
             |||||||| |||||||||||||||||
Sbjct: 29286 atgtccctttcttccccagcctttgc 29261
to top
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 42.1 bits (21), Expect = 0.38
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 72  accatgtccctctcttccccagcctttgccggcaaggtagtgaag 116
           |||||| | |||||||||||| |  |||||||||||| |||||||
Sbjct: 60  accatggctctctcttccccatctcttgccggcaaggcagtgaag 104
to top
>ref|XM_591416.2| PREDICTED: Bos taurus hypothetical LOC513688 (LOC513688), mRNA
          Length = 2194

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 94   cctttgccggcaaggtagtgaaggactc 121
            ||||||| |||||| |||||||||||||
Sbjct: 1315 cctttgctggcaagttagtgaaggactc 1288
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 48       ccatcgacaacaatggcggc 67
                ||||||||||||||||||||
Sbjct: 28525526 ccatcgacaacaatggcggc 28525545



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 45       cctccatcgacaacaatggcggc 67
                ||||||||||| |||||||||||
Sbjct: 34588168 cctccatcgacgacaatggcggc 34588146
to top
>emb|AL356464.15| Human DNA sequence from clone RP11-38O23 on chromosome Xp11.23-11.4
             Contains the 3'end of the SSX6 gene for synovial sarcoma X
             breakpoint 6, a novel gene similar to lysozyme C
             (1,4-beta-N-acetylmuramidase), a zinc finger protein 21
             (ZNF21) pseudogene, an ornithine aminotransferase (gyrate
             atrophy) (OAT) pseudogene, a SSX2 pseudogene (psiSSX2), a
             S100 calcium binding protein A11 (calgizzarin)(S100A11)
             pseudogene, the 5'end of the SSX5 gene for synovial
             sarcoma X breakpoint 5 and one CpG island, complete
             sequence
          Length = 73851

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    accatgtccctctcttcccc 91
             ||||||||||||||||||||
Sbjct: 15180 accatgtccctctcttcccc 15199
to top
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 88      ccccagcctttgccggcaag 107
               ||||||||||||||||||||
Sbjct: 5609702 ccccagcctttgccggcaag 5609683
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 48       ccatcgacaacaatggcggc 67
                ||||||||||||||||||||
Sbjct: 28616850 ccatcgacaacaatggcggc 28616869



 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 45       cctccatcgacaacaatggcggc 67
                ||||||||||| |||||||||||
Sbjct: 34678240 cctccatcgacgacaatggcggc 34678218
to top
>gb|AF339312.1|AF339312 Hepatitis C virus isolate HCP98 polyprotein gene, E2 protein PePHD
           region, partial cds
          Length = 333

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 99  gccggcaaggtagtgaagga 118
           ||||||||||||||||||||
Sbjct: 140 gccggcaaggtagtgaagga 121
to top
>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete
              sequence
          Length = 143681

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     ccatcgacaacaatggcggc 67
              ||||||||||||||||||||
Sbjct: 119656 ccatcgacaacaatggcggc 119675
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 52      cgacaacaatggcggcaacg 71
               ||||||||||||||||||||
Sbjct: 3533888 cgacaacaatggcggcaacg 3533869
to top
>emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on chromosome Xp11.1-11.3
              Contains the 5' end of the SSX6 gene for synovial sarcoma X
              breakpoint 6, two novel genes similar to a C2H2 type zinc
              finger protein, a novel gene, a novel gene similar to
              lysozyme C (1,4-beta-N-acetylmuramidase), the ZNF81 gene
              for zinc finger protein 81 (HFZ20) and three CpG islands,
              complete sequence
          Length = 209618

 Score = 40.1 bits (20), Expect = 1.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     accatgtccctctcttcccc 91
              ||||||||||||||||||||
Sbjct: 107790 accatgtccctctcttcccc 107771
to top
>gb|AY634220.1| Oikopleura dioica transposon LTR retrotransposon Tor4a, partial
           sequence
          Length = 6823

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 51  tcgacaacaatggcggcaacgac 73
           |||||||| ||||||||||||||
Sbjct: 589 tcgacaacgatggcggcaacgac 611
to top
>gb|AF276886.1| Homo sapiens GABA A receptor B3 subunit (GABRB3) gene, intron 3
          Length = 6949

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 16   ttggagaacaaaatacggc 34
            |||||||||||||||||||
Sbjct: 1948 ttggagaacaaaatacggc 1966
to top
>gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosome 14, complete
             sequence
          Length = 219723

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 5     actcctcattcttggagaacaaa 27
             |||||||||||||| ||||||||
Sbjct: 68425 actcctcattcttgtagaacaaa 68447
to top
>gb|AC163679.3| Mus musculus BAC clone RP24-104E24 from chromosome 16, complete
             sequence
          Length = 193718

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    ttcttggagaacaaaatac 31
             |||||||||||||||||||
Sbjct: 80288 ttcttggagaacaaaatac 80306
to top
>gb|AC108813.8| Mus musculus chromosome 1, clone RP23-320P13, complete sequence
          Length = 198759

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    cctctcttccccagccttt 98
             |||||||||||||||||||
Sbjct: 69473 cctctcttccccagccttt 69455
to top
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      agacctccatcgacaacaa 60
               |||||||||||||||||||
Sbjct: 2187787 agacctccatcgacaacaa 2187769
to top
>gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, complete sequence
          Length = 213423

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 5      actcctcattcttggagaacaaa 27
              |||||||||||||| ||||||||
Sbjct: 140786 actcctcattcttgtagaacaaa 140764
to top
>gb|AC124386.4| Mus musculus BAC clone RP24-422C24 from chromosome 1, complete sequence
          Length = 146080

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    ccatgtccctctcttcccc 91
             |||||||||||||||||||
Sbjct: 45419 ccatgtccctctcttcccc 45401
to top
>gb|AC102692.6| Mus musculus chromosome 18, clone RP24-491K18, complete sequence
          Length = 225042

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 76     tgtccctctcttccccagc 94
              |||||||||||||||||||
Sbjct: 161686 tgtccctctcttccccagc 161704
to top
>gb|AC104296.4| Mus Musculus Strain 129S6/SvEvTac chromosome 2 BAC, RP22-161J17,
             complete sequence
          Length = 161984

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ttcttggagaacaaaatac 31
             |||||||||||||||||||
Sbjct: 37946 ttcttggagaacaaaatac 37928
to top
>gb|AC133339.3| Oryza sativa chromosome 3 BAC OSJNBa0078D06 genomic sequence, complete
             sequence
          Length = 164236

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 45    cctccatcgacaacaatggcggc 67
             ||||||||||| |||||||||||
Sbjct: 45885 cctccatcgacgacaatggcggc 45863
to top
>gb|AC162904.4| Mus musculus BAC clone RP24-152H15 from chromosome 1, complete sequence
          Length = 147442

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 73     ccatgtccctctcttcccc 91
              |||||||||||||||||||
Sbjct: 140898 ccatgtccctctcttcccc 140880
to top
>gb|AC104569.7| Homo sapiens chromosome 15, clone RP11-147D1, complete sequence
          Length = 152001

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 16    ttggagaacaaaatacggc 34
             |||||||||||||||||||
Sbjct: 85593 ttggagaacaaaatacggc 85575
to top
>gb|AC108714.3| Homo sapiens 3p BAC RP11-146G16 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 151143

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 13   ttcttggagaacaaaatacggca 35
            |||||||||||||||||| ||||
Sbjct: 2622 ttcttggagaacaaaataaggca 2644
to top
>dbj|AK131654.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
            library, clone:1520403K13 product:unclassifiable, full
            insert sequence
          Length = 3812

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 7    tcctcattcttggagaaca 25
            |||||||||||||||||||
Sbjct: 1926 tcctcattcttggagaaca 1944
to top
>gb|AY055726.2| Mus musculus synovial sarcoma associated SS18 (Ss18) gene, complete
             cds, alternatively spliced
          Length = 64533

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    tgtccctctcttccccagc 94
             |||||||||||||||||||
Sbjct: 38790 tgtccctctcttccccagc 38808
to top
>gb|AC133778.4| Oryza sativa chromosome 3 BAC OSJNBb0027B08 genomic sequence, complete
             sequence
          Length = 129302

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 45    cctccatcgacaacaatggcggc 67
             ||||||||||| |||||||||||
Sbjct: 55165 cctccatcgacgacaatggcggc 55187
to top
>gb|AF256078.1|AF256078 Drosophila simulans strain sim8 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>gb|AF256077.1|AF256077 Drosophila simulans strain sim7 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>gb|AF256076.1|AF256076 Drosophila simulans strain sim5 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>gb|AF256075.1|AF256075 Drosophila simulans strain sim4 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>gb|AF256074.1|AF256074 Drosophila simulans strain sim3 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>gb|AF256073.1|AF256073 Drosophila simulans strain sim2 cut protein (ct) gene, partial cds
          Length = 1090

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 54  acaacaatggcggcaacga 72
           |||||||||||||||||||
Sbjct: 859 acaacaatggcggcaacga 877
to top
>emb|BX511004.9| Zebrafish DNA sequence from clone RP71-45K5 in linkage group 19, complete
              sequence
          Length = 168626

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 45     cctccatcgacaacaatgg 63
              |||||||||||||||||||
Sbjct: 143076 cctccatcgacaacaatgg 143094
to top
>gb|AC130723.4| Mus musculus BAC clone RP24-409P7 from 8, complete sequence
          Length = 197951

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     gtccctctcttccccagcc 95
              |||||||||||||||||||
Sbjct: 103997 gtccctctcttccccagcc 104015
to top
>emb|AL929158.8| Mouse DNA sequence from clone RP23-92O15 on chromosome 2, complete
             sequence
          Length = 125262

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ttcttggagaacaaaatac 31
             |||||||||||||||||||
Sbjct: 33375 ttcttggagaacaaaatac 33357
to top
>gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosome 12, complete sequence
          Length = 193902

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      tcctcattcttggagaaca 25
              |||||||||||||||||||
Sbjct: 131440 tcctcattcttggagaaca 131458
to top
>emb|AL844481.5| Mouse DNA sequence from clone RP23-44H23 on chromosome 2, complete
             sequence
          Length = 109532

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    ttcttggagaacaaaatac 31
             |||||||||||||||||||
Sbjct: 21728 ttcttggagaacaaaatac 21710


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,016,899
Number of Sequences: 3902068
Number of extensions: 1016899
Number of successful extensions: 75816
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75574
Number of HSP's gapped (non-prelim): 242
length of query: 126
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 105
effective length of database: 17,151,101,840
effective search space: 1800865693200
effective search space used: 1800865693200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top