| Clone Name | baet57b07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC021810.7|AC021810 Homo sapiens chromosome 18, clone RP11-82K14, complete sequence Length = 192100 Score = 42.1 bits (21), Expect = 0.70 Identities = 21/21 (100%) Strand = Plus / Minus Query: 46 gaagctgcagaaatttctgtg 66 ||||||||||||||||||||| Sbjct: 128418 gaagctgcagaaatttctgtg 128398
>ref|NM_118666.2| Arabidopsis thaliana FK506 binding / peptidyl-prolyl cis-trans isomerase AT4G25340 mRNA, complete cds Length = 1716 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 cgaagctgcagaaatttctg 64 |||||||||||||||||||| Sbjct: 1093 cgaagctgcagaaatttctg 1112
>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete sequence Length = 174754 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 108 aagccccctagctgcaccccaccgcacc 135 |||||| |||||||||||||||| |||| Sbjct: 126335 aagcccactagctgcaccccaccccacc 126362
>ref|XM_659377.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6865.2), mRNA Length = 873 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 ctctcccccctcgcccaact 40 |||||||||||||||||||| Sbjct: 379 ctctcccccctcgcccaact 398
>gb|AY143978.1| Arabidopsis thaliana At4g25340/T30C3_20 mRNA, complete cds Length = 1434 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 cgaagctgcagaaatttctg 64 |||||||||||||||||||| Sbjct: 1026 cgaagctgcagaaatttctg 1045
>emb|AL079350.1|ATT30C3 Arabidopsis thaliana DNA chromosome 4, BAC clone T30C3 (ESSA project) Length = 77793 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 45 cgaagctgcagaaatttctg 64 |||||||||||||||||||| Sbjct: 10085 cgaagctgcagaaatttctg 10066
>emb|AL161563.2|ATCHRIV63 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 63 Length = 198777 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 45 cgaagctgcagaaatttctg 64 |||||||||||||||||||| Sbjct: 42966 cgaagctgcagaaatttctg 42947
>gb|AY057543.1| Arabidopsis thaliana AT4g25340/T30C3_20 mRNA, complete cds Length = 1716 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 cgaagctgcagaaatttctg 64 |||||||||||||||||||| Sbjct: 1093 cgaagctgcagaaatttctg 1112
>gb|AF133241.1|AF133241 Emericella nidulans chorismate mutase (aroC) gene, complete cds Length = 3167 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 ctctcccccctcgcccaact 40 |||||||||||||||||||| Sbjct: 2749 ctctcccccctcgcccaact 2730
>emb|X00332.1|DVP161B Drosophila virilis simple DNA sequence (pDv-161) Length = 387 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 aatcatcgccgccgctggag 179 |||||||||||||||||||| Sbjct: 382 aatcatcgccgccgctggag 363 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,428,387 Number of Sequences: 3902068 Number of extensions: 1428387 Number of successful extensions: 99245 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 99234 Number of HSP's gapped (non-prelim): 11 length of query: 218 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 196 effective length of database: 17,147,199,772 effective search space: 3360851155312 effective search space used: 3360851155312 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)