>gb|AC021810.7|AC021810 Homo sapiens chromosome 18, clone RP11-82K14, complete sequence
          Length = 192100

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     gaagctgcagaaatttctgtg 66
              |||||||||||||||||||||
Sbjct: 128418 gaagctgcagaaatttctgtg 128398

>ref|NM_118666.2| Arabidopsis thaliana FK506 binding / peptidyl-prolyl cis-trans
            isomerase AT4G25340 mRNA, complete cds
          Length = 1716

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 45   cgaagctgcagaaatttctg 64
            ||||||||||||||||||||
Sbjct: 1093 cgaagctgcagaaatttctg 1112

>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete
              sequence
          Length = 174754

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 108    aagccccctagctgcaccccaccgcacc 135
              |||||| |||||||||||||||| ||||
Sbjct: 126335 aagcccactagctgcaccccaccccacc 126362

>ref|XM_659377.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6865.2), mRNA
          Length = 873

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 21  ctctcccccctcgcccaact 40
           ||||||||||||||||||||
Sbjct: 379 ctctcccccctcgcccaact 398

>gb|AY143978.1| Arabidopsis thaliana At4g25340/T30C3_20 mRNA, complete cds
          Length = 1434

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 45   cgaagctgcagaaatttctg 64
            ||||||||||||||||||||
Sbjct: 1026 cgaagctgcagaaatttctg 1045

>emb|AL079350.1|ATT30C3 Arabidopsis thaliana DNA chromosome 4, BAC clone T30C3 (ESSA project)
          Length = 77793

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    cgaagctgcagaaatttctg 64
             ||||||||||||||||||||
Sbjct: 10085 cgaagctgcagaaatttctg 10066

>emb|AL161563.2|ATCHRIV63 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 63
          Length = 198777

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    cgaagctgcagaaatttctg 64
             ||||||||||||||||||||
Sbjct: 42966 cgaagctgcagaaatttctg 42947

>gb|AY057543.1| Arabidopsis thaliana AT4g25340/T30C3_20 mRNA, complete cds
          Length = 1716

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 45   cgaagctgcagaaatttctg 64
            ||||||||||||||||||||
Sbjct: 1093 cgaagctgcagaaatttctg 1112

>gb|AF133241.1|AF133241 Emericella nidulans chorismate mutase (aroC) gene, complete cds
          Length = 3167

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 21   ctctcccccctcgcccaact 40
            ||||||||||||||||||||
Sbjct: 2749 ctctcccccctcgcccaact 2730

>emb|X00332.1|DVP161B Drosophila virilis simple DNA sequence (pDv-161)
          Length = 387

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 160 aatcatcgccgccgctggag 179
           ||||||||||||||||||||
Sbjct: 382 aatcatcgccgccgctggag 363


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,428,387
Number of Sequences: 3902068
Number of extensions: 1428387
Number of successful extensions: 99245
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99234
Number of HSP's gapped (non-prelim): 11
length of query: 218
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 196
effective length of database: 17,147,199,772
effective search space: 3360851155312
effective search space used: 3360851155312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)