| Clone Name | baet52g12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_479621.1| Oryza sativa (japonica cultivar-group), mRNA Length = 993 Score = 117 bits (59), Expect = 2e-23 Identities = 113/131 (86%) Strand = Plus / Plus Query: 142 gagagctgcccgagggcggagcagatcgtcaaggagcaggtgaggagcctgtacgaggag 201 ||||| ||||||||||||||| || | || | |||| ||||| |||| |||||||||||| Sbjct: 106 gagaggtgcccgagggcggaggaggtggtgagggaggaggtgcggaggctgtacgaggag 165 Query: 202 cacggcaacacggccgtgtcgtggctccgggccctcttccacgactgcaccgtcaagtcc 261 |||||||||||||| ||||||||| | |||| |||||||||||||||| ||| | ||| Sbjct: 166 cacggcaacacggcggtgtcgtggttgagggcactcttccacgactgcatggtctactcc 225 Query: 262 tgcgacgcctc 272 ||||||||||| Sbjct: 226 tgcgacgcctc 236
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 117 bits (59), Expect = 2e-23 Identities = 113/131 (86%) Strand = Plus / Minus Query: 142 gagagctgcccgagggcggagcagatcgtcaaggagcaggtgaggagcctgtacgaggag 201 ||||| ||||||||||||||| || | || | |||| ||||| |||| |||||||||||| Sbjct: 29508793 gagaggtgcccgagggcggaggaggtggtgagggaggaggtgcggaggctgtacgaggag 29508734 Query: 202 cacggcaacacggccgtgtcgtggctccgggccctcttccacgactgcaccgtcaagtcc 261 |||||||||||||| ||||||||| | |||| |||||||||||||||| ||| | ||| Sbjct: 29508733 cacggcaacacggcggtgtcgtggttgagggcactcttccacgactgcatggtctactcc 29508674 Query: 262 tgcgacgcctc 272 ||||||||||| Sbjct: 29508673 tgcgacgcctc 29508663
>dbj|AP005199.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0627E10 Length = 163388 Score = 117 bits (59), Expect = 2e-23 Identities = 113/131 (86%) Strand = Plus / Minus Query: 142 gagagctgcccgagggcggagcagatcgtcaaggagcaggtgaggagcctgtacgaggag 201 ||||| ||||||||||||||| || | || | |||| ||||| |||| |||||||||||| Sbjct: 35465 gagaggtgcccgagggcggaggaggtggtgagggaggaggtgcggaggctgtacgaggag 35406 Query: 202 cacggcaacacggccgtgtcgtggctccgggccctcttccacgactgcaccgtcaagtcc 261 |||||||||||||| ||||||||| | |||| |||||||||||||||| ||| | ||| Sbjct: 35405 cacggcaacacggcggtgtcgtggttgagggcactcttccacgactgcatggtctactcc 35346 Query: 262 tgcgacgcctc 272 ||||||||||| Sbjct: 35345 tgcgacgcctc 35335
>dbj|AK061013.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-B06, full insert sequence Length = 1084 Score = 117 bits (59), Expect = 2e-23 Identities = 113/131 (86%) Strand = Plus / Plus Query: 142 gagagctgcccgagggcggagcagatcgtcaaggagcaggtgaggagcctgtacgaggag 201 ||||| ||||||||||||||| || | || | |||| ||||| |||| |||||||||||| Sbjct: 3 gagaggtgcccgagggcggaggaggtggtgagggaggaggtgcggaggctgtacgaggag 62 Query: 202 cacggcaacacggccgtgtcgtggctccgggccctcttccacgactgcaccgtcaagtcc 261 |||||||||||||| ||||||||| | |||| |||||||||||||||| ||| | ||| Sbjct: 63 cacggcaacacggcggtgtcgtggttgagggcactcttccacgactgcatggtctactcc 122 Query: 262 tgcgacgcctc 272 ||||||||||| Sbjct: 123 tgcgacgcctc 133
>tpe|BN000645.1| TPA: TPA_inf: Oryza sativa (japonica cultivar-group) prx116 gene for class III peroxidase 116 precursor, exon 1 Length = 993 Score = 117 bits (59), Expect = 2e-23 Identities = 113/131 (86%) Strand = Plus / Plus Query: 142 gagagctgcccgagggcggagcagatcgtcaaggagcaggtgaggagcctgtacgaggag 201 ||||| ||||||||||||||| || | || | |||| ||||| |||| |||||||||||| Sbjct: 106 gagaggtgcccgagggcggaggaggtggtgagggaggaggtgcggaggctgtacgaggag 165 Query: 202 cacggcaacacggccgtgtcgtggctccgggccctcttccacgactgcaccgtcaagtcc 261 |||||||||||||| ||||||||| | |||| |||||||||||||||| ||| | ||| Sbjct: 166 cacggcaacacggcggtgtcgtggttgagggcactcttccacgactgcatggtctactcc 225 Query: 262 tgcgacgcctc 272 ||||||||||| Sbjct: 226 tgcgacgcctc 236
>emb|BX470078.6| Zebrafish DNA sequence from clone DKEYP-8C4 in linkage group 5, complete sequence Length = 184333 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 58 gcactgctgctcctgtgctgctg 80 ||||||||||||||||||||||| Sbjct: 15468 gcactgctgctcctgtgctgctg 15490
>emb|BX294169.10| Zebrafish DNA sequence from clone DKEY-151N15 in linkage group 5, complete sequence Length = 73230 Score = 46.1 bits (23), Expect = 0.057 Identities = 23/23 (100%) Strand = Plus / Plus Query: 58 gcactgctgctcctgtgctgctg 80 ||||||||||||||||||||||| Sbjct: 24863 gcactgctgctcctgtgctgctg 24885
>gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete genome Length = 2314078 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 tggttggaatgctgccgcttc 107 ||||||||||||||||||||| Sbjct: 703601 tggttggaatgctgccgcttc 703621
>gb|AC129195.3| Mus musculus BAC clone RP24-150H14 from chromosome 1, complete sequence Length = 152726 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 tcctgtgctgctgcttcactg 88 ||||||||||||||||||||| Sbjct: 8960 tcctgtgctgctgcttcactg 8940
>ref|XM_544403.2| PREDICTED: Canis familiaris similar to Iroquois related homeobox 3 (LOC487277), mRNA Length = 2198 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Plus Query: 149 gcccgagggcggagcagatcg 169 ||||||||||||||||||||| Sbjct: 1944 gcccgagggcggagcagatcg 1964
>gb|AC117500.13| Homo sapiens 12 BAC RP11-495K9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 180995 Score = 42.1 bits (21), Expect = 0.90 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 gatgggtctgagctcaagcct 41 ||||||||||||||||||||| Sbjct: 60679 gatgggtctgagctcaagcct 60659
>gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosome 10, complete sequence Length = 243006 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 20 agatgggtctgagctcaagcctgg 43 |||||||||||| ||||||||||| Sbjct: 16168 agatgggtctgatctcaagcctgg 16145
>emb|AL590103.12| Human DNA sequence from clone RP11-132G19 on chromosome 1 Contains a novel gene, the 3' end of the HSPG2 gene for heparan sulfate proteoglycan 2 (perlecan), the 5' end of the USP31 gene for ubiquitin specific protease 31 and a CpG island, complete sequence Length = 175162 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 171 caaggagcaggtgaggagcc 190 |||||||||||||||||||| Sbjct: 164868 caaggagcaggtgaggagcc 164849
>emb|AL392111.12| Human DNA sequence from clone RP11-487I5 on chromosome 10 Contains the DUSP13 gene for dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450), the gene for a novel protein (FLJ25082), the 5' end fo the VDAC2 gene for voltage-dependent anion channel 2, a peptidylprolyl isomerase A (cyclophilin A)(PPIA)(CYPA, CYPH) pseudogene, a ribosomal protein S26 (RPS26) pseudogene and two CpG islands, complete sequence Length = 159365 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gctgctcctgtgctgctgct 82 |||||||||||||||||||| Sbjct: 31617 gctgctcctgtgctgctgct 31636
>gb|AC153894.8| Mus musculus 6 BAC RP23-118E20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 216116 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 agcctggtgccagtggcgtctgca 60 ||||||||||||||||| |||||| Sbjct: 130164 agcctggtgccagtggcctctgca 130187
>gb|AC158239.2| Mus musculus BAC clone RP23-48A24 from chromosome 10, complete sequence Length = 256496 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 agatgggtctgagctcaagcctgg 43 |||||||||||| ||||||||||| Sbjct: 72063 agatgggtctgatctcaagcctgg 72086
>emb|AL445799.1|CNS07EDD Homo sapiens (human) Human Heparan Sulfate Proteoglycan (HSPG2) gene, exons 8 and 9 Length = 594 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 caaggagcaggtgaggagcc 190 |||||||||||||||||||| Sbjct: 28 caaggagcaggtgaggagcc 47
>gb|AC140787.4| Mus musculus BAC clone RP23-411H17 from 10, complete sequence Length = 217336 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 agatgggtctgagctcaagcctgg 43 |||||||||||| ||||||||||| Sbjct: 131966 agatgggtctgatctcaagcctgg 131989
>emb|AL627314.6| Mouse DNA sequence from clone RP23-354H24 on chromosome 4, complete sequence Length = 196461 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 218 tgtcgtggctccgggccctcttcc 241 |||||||||||||| ||||||||| Sbjct: 187779 tgtcgtggctccggaccctcttcc 187756 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,054,821 Number of Sequences: 3902068 Number of extensions: 2054821 Number of successful extensions: 40166 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40124 Number of HSP's gapped (non-prelim): 42 length of query: 272 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 250 effective length of database: 17,147,199,772 effective search space: 4286799943000 effective search space used: 4286799943000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)