Clone Name	baet52d03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds	494	e-137
2	gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrins...	379	e-102
3	gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com...	361	7e-97
4	dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds	212	4e-52
5	emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri...	200	2e-48
6	gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein...	200	2e-48
7	gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-...	178	6e-42
8	gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein...	176	2e-41
9	gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein...	176	2e-41
10	gb|AY103580.1| Zea mays PCO072544 mRNA sequence	172	4e-40
11	gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN...	172	4e-40
12	emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein	155	9e-35
13	emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein	153	3e-34
14	emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet...	149	5e-33
15	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	149	5e-33
16	dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D...	149	5e-33
17	dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D...	149	5e-33
18	dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	5e-33
19	dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	5e-33
20	dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon...	149	5e-33
21	dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon...	141	1e-30
22	dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ...	133	3e-28
23	gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence	117	2e-23
24	emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein	117	2e-23
25	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	117	2e-23
26	dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	117	2e-23
27	dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon...	117	2e-23
28	dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon...	117	2e-23
29	gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co...	117	2e-23
30	dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	1e-21
31	emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,...	109	5e-21
32	ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic...	103	3e-19
33	dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane...	101	1e-18
34	gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ...	101	1e-18
35	gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein...	82	1e-12
36	gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic pro...	74	3e-10
37	ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA	72	1e-09
38	dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D...	72	1e-09
39	dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	1e-09
40	gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp...	66	6e-08
41	gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c...	64	2e-07
42	dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra...	62	1e-06
43	gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds	60	4e-06
44	ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0...	58	1e-05
45	emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins...	58	1e-05
46	emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B	58	1e-05
47	gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr...	58	1e-05
48	gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl...	58	1e-05
49	emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co...	58	1e-05
50	gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thali...	58	1e-05
51	dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra...	58	1e-05
52	gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr...	58	1e-05
53	dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran...	58	1e-05
54	dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3...	56	6e-05
55	dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds	56	6e-05
56	emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel...	52	0.001
57	emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl...	52	0.001
58	gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ...	52	0.001
59	dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ...	52	0.001
60	gb|AF145707.1|AF145707 Lotus japonicus clone LJ-AQP1 plasma memb...	50	0.004
61	gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot...	48	0.014
62	emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp...	48	0.014
63	emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel...	46	0.057
64	gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ...	46	0.057
65	gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, compl...	46	0.057
66	dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ...	46	0.057
67	emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p...	44	0.22
68	gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR...	44	0.22
69	gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins...	44	0.22
70	ref|XM_526747.1| PREDICTED: Pan troglodytes similar to hypotheti...	42	0.88
71	gb|AC108477.5| Homo sapiens BAC clone RP11-499F19 from 4, comple...	42	0.88
72	emb|BX029520.1|CNS08UXW Single read from an extremity of a full-...	42	0.88
73	gb|AE012531.1| Xanthomonas campestris pv. campestris str. ATCC 3...	42	0.88
74	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	42	0.88
75	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	42	0.88
76	gb|AC095057.3| Homo sapiens BAC clone RP11-395I6 from 4, complet...	42	0.88
77	dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D...	42	0.88
78	dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D...	42	0.88
79	gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protei...	42	0.88
80	gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co...	42	0.88
81	emb|AL928567.6| Mouse DNA sequence from clone RP23-296K20 on chr...	42	0.88
82	ref|XM_462670.1| Oryza sativa (japonica cultivar-group), predic...	40	3.5
83	ref|NM_192161.1| Oryza sativa (japonica cultivar-group), predic...	40	3.5
84	ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA	40	3.5
85	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	40	3.5
86	gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome...	40	3.5
87	gb|AC152166.4| Mus musculus BAC clone RP23-425A3 from chromosome...	40	3.5
88	gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, c...	40	3.5
89	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	3.5
90	gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds	40	3.5
91	gb|AC124345.4| Mus musculus BAC clone RP24-459N19 from chromosom...	40	3.5
92	gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, comple...	40	3.5
93	emb|AL359963.29| Human DNA sequence from clone RP11-18A3 on chro...	40	3.5
94	emb|BX072361.1|CNS09RZX Single read from an extremity of a full-...	40	3.5
95	emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-...	40	3.5
96	emb|BX068379.1|CNS09OXB Single read from an extremity of a full-...	40	3.5
97	emb|BX068378.1|CNS09OXA Single read from an extremity of a full-...	40	3.5
98	emb|BX067609.1|CNS09OBX Single read from an extremity of a full-...	40	3.5
99	emb|BX067608.1|CNS09OBW Single read from an extremity of a full-...	40	3.5
100	emb|BX061944.1|CNS09JYK Single read from an extremity of a full-...	40	3.5
101	emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-...	40	3.5
102	emb|BX056299.1|CNS09FLR Single read from an extremity of a full-...	40	3.5
103	emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-...	40	3.5
104	emb|BX055253.1|CNS09ESP Single read from an extremity of a full-...	40	3.5
105	emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-...	40	3.5
106	emb|BX049557.1|CNS09AEH Single read from an extremity of a full-...	40	3.5
107	emb|BX049556.1|CNS09AEG Single read from an extremity of a full-...	40	3.5
108	emb|BX049060.1|CNS09A0O Single read from an extremity of a full-...	40	3.5
109	emb|BX046605.1|CNS0984H Single read from an extremity of a full-...	40	3.5
110	emb|BX046604.1|CNS0984G Single read from an extremity of a full-...	40	3.5
111	emb|BX041706.1|CNS094CE Single read from an extremity of a full-...	40	3.5
112	emb|BX041977.1|CNS094JX Single read from an extremity of a full-...	40	3.5
113	emb|BX041661.1|CNS094B5 Single read from an extremity of a full-...	40	3.5
114	emb|BX041260.1|CNS09400 Single read from an extremity of a full-...	40	3.5
115	emb|BX039117.1|CNS092CH Single read from an extremity of a full-...	40	3.5
116	emb|BX039116.1|CNS092CG Single read from an extremity of a full-...	40	3.5
117	emb|BX038773.1|CNS0922X Single read from an extremity of a full-...	40	3.5
118	emb|BX038772.1|CNS0922W Single read from an extremity of a full-...	40	3.5
119	emb|BX038693.1|CNS0920P Single read from an extremity of a full-...	40	3.5
120	emb|BX038692.1|CNS0920O Single read from an extremity of a full-...	40	3.5
121	emb|BX038208.1|CNS091N8 Single read from an extremity of a full-...	40	3.5
122	emb|BX038207.1|CNS091N7 Single read from an extremity of a full-...	40	3.5
123	emb|BX038039.1|CNS091IJ Single read from an extremity of a full-...	40	3.5
124	emb|BX038038.1|CNS091II Single read from an extremity of a full-...	40	3.5
125	emb|BX037613.1|CNS0916P Single read from an extremity of a full-...	40	3.5
126	emb|BX037612.1|CNS0916O Single read from an extremity of a full-...	40	3.5
127	emb|BX037577.1|CNS0915P Single read from an extremity of a full-...	40	3.5
128	emb|BX037488.1|CNS09138 Single read from an extremity of a full-...	40	3.5
129	emb|BX037487.1|CNS09137 Single read from an extremity of a full-...	40	3.5
130	emb|BX036984.1|CNS090P8 Single read from an extremity of a full-...	40	3.5
131	emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-...	40	3.5
132	emb|BX028080.1|CNS08TTW Single read from an extremity of a full-...	40	3.5
133	emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-...	40	3.5
134	emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-...	40	3.5
135	emb|BX024766.1|CNS08R9U Single read from an extremity of a full-...	40	3.5
136	emb|BX019545.1|CNS08N8T Single read from an extremity of a full-...	40	3.5
137	emb|BX019544.1|CNS08N8S Single read from an extremity of a full-...	40	3.5
138	emb|BX021590.1|CNS08OTM Single read from an extremity of a full-...	40	3.5
139	emb|BX021589.1|CNS08OTL Single read from an extremity of a full-...	40	3.5
140	emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-...	40	3.5
141	emb|BX020809.1|CNS08O7X Single read from an extremity of a full-...	40	3.5
142	emb|BX012334.1|CNS08HOI Single read from an extremity of a full-...	40	3.5
143	emb|BX008016.1|CNS08ECK Single read from an extremity of a full-...	40	3.5
144	emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-...	40	3.5
145	gb|AE005794.1| Caulobacter crescentus CB15 section 120 of 359 of...	40	3.5
146	gb|AE012270.1| Xanthomonas campestris pv. campestris str. ATCC 3...	40	3.5
147	gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat...	40	3.5
148	gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat...	40	3.5
149	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	3.5
150	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	40	3.5
151	dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in...	40	3.5
152	gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complet...	40	3.5
153	dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic D...	40	3.5
154	gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma...	40	3.5
155	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	3.5
156	ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913 ...	40	3.5
157	gb|AY108280.1| Zea mays PCO132931 mRNA sequence	40	3.5
158	gb|AY106483.1| Zea mays PCO145034 mRNA sequence	40	3.5
159	emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (my...	40	3.5
160	emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4,...	40	3.5
161	emb|CR391944.10| Zebrafish DNA sequence from clone CH211-95K19 i...	40	3.5
162	gb|AC113930.2| Oryza sativa (japonica cultivar-group) chromosome...	40	3.5

---

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  494 bits (249), Expect = e-137
 Identities = 255/257 (99%)
 Strand = Plus / Plus

                                                                       
Query: 13  tcacacccacacccatcttctcctcctaacaaccgagccaggctcaagcggcggcgatgg 72
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22  tcacacccacacccatcttctcctcctaacaaccgagccaggctcaagcggcggcgatgg 81

                                                                       
Query: 73  agggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcg 132
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 82  agggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcg 141

                                                                       
Query: 133 gcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccggccc 192
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 gcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccggccc 201

                                                                       
Query: 193 ccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgccgagt 252
           |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 202 ccttcttcgaggccggggagctcacctcctggtccttctaccgggcagggatcgccgagt 261

                            
Query: 253 tcctggccaccttcctc 269
           |||||||||||||||||
Sbjct: 262 tcctggccaccttcctc 278

---

>gb|AF139816.1|AF139816 Triticum aestivum plasma membrane intrinsic protein 3 (PIP3) mRNA,
           complete cds
          Length = 1271

 Score =  379 bits (191), Expect = e-102
 Identities = 203/207 (98%)
 Strand = Plus / Plus

                                                                       
Query: 63  gcggcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcac 122
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 68  gcggccatggagggcaaggaggaggacgtgcggctgggcgcgaaccgctactcggagcac 127

                                                                       
Query: 123 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 182
           |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct: 128 cagcccatcggcacggcggcgcagggcggcggcgcggacgagaaggactacaaggagccg 187

                                                                       
Query: 183 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 242
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 188 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 247

                                      
Query: 243 atcgccgagttcctggccaccttcctc 269
           |||||||||||||||||||||||||||
Sbjct: 248 atcgccgagttcctggccaccttcctc 274

---

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score =  361 bits (182), Expect = 7e-97
 Identities = 200/206 (97%)
 Strand = Plus / Plus

                                                                       
Query: 64  cggcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcacc 123
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 58  cggccatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcacc 117

                                                                       
Query: 124 agcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgc 183
           ||||||||||||||||||||||||||||||| || ||| | |||||||||||||||||||
Sbjct: 118 agcccatcggcacggcggcgcagggcggcggcgcggacaaaaaggactacaaggagccgc 177

                                                                       
Query: 184 ccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggca 243
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 178 ccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggca 237

                                     
Query: 244 tcgccgagttcctggccaccttcctc 269
           ||||||||||||||||||| ||||||
Sbjct: 238 tcgccgagttcctggccactttcctc 263

---

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score =  212 bits (107), Expect = 4e-52
 Identities = 178/201 (88%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| |||||||| ||| | ||||||||||  ||||||
Sbjct: 83  atggaggggaaggaggaggacgtgcggctgggcgccaacaggtactcggagcggcagccc 142

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           ||||| |||||||||||||||||||| | ||||   |||||||||||||||||||| |||
Sbjct: 143 atcgggacggcggcgcagggcggcggggacgac---aaggactacaaggagccgccgccg 199

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  |||||||| ||||||||||||  ||||||||||||||||| ||||||||||||
Sbjct: 200 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgcc 259

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 260 gagttcatcgccaccttcctc 280

---

>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene)
          Length = 1364

 Score =  200 bits (101), Expect = 2e-48
 Identities = 177/201 (88%), Gaps = 6/201 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           |||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||
Sbjct: 81  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 140

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||  |||||     |||||||||||||||||||| || ||
Sbjct: 141 aatcggcacggcggcgcagggc-acggag-----gagaaggactacaaggagcctccgcc 194

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||||| | |||||| || || |||||||||||||||||||| |||||
Sbjct: 195 ggcgccgctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgc 254

                                
Query: 248 cgagttcctggccaccttcct 268
           ||||||| |||||||||||||
Sbjct: 255 cgagttcgtggccaccttcct 275

---

>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete
           cds
          Length = 1338

 Score =  200 bits (101), Expect = 2e-48
 Identities = 177/201 (88%), Gaps = 6/201 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           |||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||
Sbjct: 72  gatggagggcaaggaggaggacgttcgcctgggcgccaaccgctactcggagcgccagcc 131

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||  |||||     |||||||||||||||||||| || ||
Sbjct: 132 aatcggcacggcggcgcagggc-acggag-----gagaaggactacaaggagcctccgcc 185

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||||| | |||||| || || |||||||||||||||||||| |||||
Sbjct: 186 ggcgccgctgttcgaggcggaggagctgacgtcgtggtccttctaccgggccgggatcgc 245

                                
Query: 248 cgagttcctggccaccttcct 268
           ||||||| |||||||||||||
Sbjct: 246 cgagttcgtggccaccttcct 266

---

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score =  178 bits (90), Expect = 6e-42
 Identities = 173/201 (86%), Gaps = 6/201 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| |||||||||||||| ||||||||||| |||   | |||||||| |||||||
Sbjct: 1   atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccagccc 60

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           |||||||||||||||||||||       | ||||| ||||||||||||||||| || |||
Sbjct: 61  atcggcacggcggcgcagggca------cggacgacaaggactacaaggagcccccgccg 114

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  |||||||| ||||||||||||  ||||||||||||||||| ||||||||||||
Sbjct: 115 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgcgccggcatcgcc 174

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 175 gagttcgtcgccaccttcctc 195

---

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score =  176 bits (89), Expect = 2e-41
 Identities = 178/208 (85%), Gaps = 6/208 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| |||||||||||||||||||||||||| |||   | ||||||||  |||||
Sbjct: 100 gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 159

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggagcc 181
           ||||||||||||||||||||||| ||| ||||      |||| |||||||||||||||||
Sbjct: 160 catcggcacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggagcc 219

                                                                       
Query: 182 gcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccgg 241
            || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || ||
Sbjct: 220 cccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcggg 279

                                       
Query: 242 catcgccgagttcctggccaccttcctc 269
           ||||||||||||| | ||||||||||||
Sbjct: 280 catcgccgagttcgtcgccaccttcctc 307

---

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score =  176 bits (89), Expect = 2e-41
 Identities = 178/208 (85%), Gaps = 6/208 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| |||||||||||||||||||||||||| |||   | ||||||||  |||||
Sbjct: 95  gatggaggggaaggaggaggacgtgcgcctgggcgccaacaagttctcggagcggcagcc 154

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggagcc 181
           ||||||||||||||||||||||| ||| ||||      |||| |||||||||||||||||
Sbjct: 155 catcggcacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggagcc 214

                                                                       
Query: 182 gcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccgg 241
            || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || ||
Sbjct: 215 cccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcggg 274

                                       
Query: 242 catcgccgagttcctggccaccttcctc 269
           ||||||||||||| | ||||||||||||
Sbjct: 275 catcgccgagttcgtcgccaccttcctc 302

---

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score =  172 bits (87), Expect = 4e-40
 Identities = 173/201 (86%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| || ||||||||||||||||||||||| |||   | |||||||| |||||||
Sbjct: 434 atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 493

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           ||||| |||||||||||||||| ||   | ||||| ||||||||||||||||| || |||
Sbjct: 494 atcgggacggcggcgcagggcgccg---ctgacgacaaggactacaaggagcccccgccg 550

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| ||||||||||||  ||||||||||||||||| || |||||||||
Sbjct: 551 gcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgcc 610

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 611 gagttcgtcgccaccttcctc 631

---

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score =  172 bits (87), Expect = 4e-40
 Identities = 173/201 (86%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| || ||||||||||||||||||||||| |||   | |||||||| |||||||
Sbjct: 61  atggaggggaaagaggaggacgtgcgcctgggcgccaacaagttctcggagcgccagccc 120

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           ||||| |||||||||||||||| ||   | ||||| ||||||||||||||||| || |||
Sbjct: 121 atcgggacggcggcgcagggcgccg---ctgacgacaaggactacaaggagcccccgccg 177

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| ||||||||||||  ||||||||||||||||| || |||||||||
Sbjct: 178 gcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcgggcatcgcc 237

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 238 gagttcgtcgccaccttcctc 258

---

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score =  155 bits (78), Expect = 9e-35
 Identities = 170/201 (84%), Gaps = 6/201 (2%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| |||||||||||||| ||||||||||| |||   | |||||||| |||  ||
Sbjct: 61  atggaggggaaggaggaggacgtccgcctgggcgccaacaagttctcggagcgccacgcc 120

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           |||||||||||||||||||||       | ||||| ||||||||||||||||| || |||
Sbjct: 121 atcggcacggcggcgcagggca------cggacgacaaggactacaaggagcccccgccg 174

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  |||||||| ||||||||||||  |||||||||||||||||  |||||||||||
Sbjct: 175 gcgccgctcttcgagcccggggagctcaagtcctggtccttctaccgccccggcatcgcc 234

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctc 255

---

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  153 bits (77), Expect = 3e-34
 Identities = 172/204 (84%), Gaps = 6/204 (2%)
 Strand = Plus / Plus

                                                                       
Query: 66  gcgatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccag 125
           |||||||||||||||||||||||||||||||| || ||||||   ||||||||||  || 
Sbjct: 68  gcgatggagggcaaggaggaggacgtgcgcctcggggcgaacaagtactcggagcggcac 127

                                                                       
Query: 126 cccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccc 185
            ||||||||||||||||||||||        |||| || ||||||||||||||||| || 
Sbjct: 128 gccatcggcacggcggcgcaggggt------ccgaggacaaggactacaaggagcccccg 181

                                                                       
Query: 186 ccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatc 245
           ||||| ||  | |||||| |||| |||||||  || |||||||||||||| |||||||||
Sbjct: 182 ccggcgccgctgttcgagcccggcgagctcaagtcgtggtccttctaccgcgccggcatc 241

                                   
Query: 246 gccgagttcctggccaccttcctc 269
           ||||||||| ||||||||||||||
Sbjct: 242 gccgagttcatggccaccttcctc 265

---

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 25  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 84

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 85  atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 141

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 142 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 201

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 202 gagttcgtcgccaccttcctc 222

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                            
Query: 69       atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
                |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 27062945 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 27063004

                                                                            
Query: 129      atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
                || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 27063005 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 27063061

                                                                            
Query: 189      gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
                || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 27063062 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 27063121

                                     
Query: 249      gagttcctggccaccttcctc 269
                |||||| | ||||||||||||
Sbjct: 27063122 gagttcgtcgccaccttcctc 27063142



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 160/200 (80%), Gaps = 6/200 (3%)
 Strand = Plus / Plus

                                                                            
Query: 69       atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
                |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 35368315 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 35368374

                                                                            
Query: 129      atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
                ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 35368375 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 35368428

                                                                            
Query: 189      gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
                || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 35368429 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 35368488

                                    
Query: 249      gagttcctggccaccttcct 268
                |||||| |||| || |||||
Sbjct: 35368489 gagttcgtggcgacgttcct 35368508

---

>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1486_E07
          Length = 110494

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                         
Query: 69    atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
             |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 34594 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 34653

                                                                         
Query: 129   atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
             || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 34654 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 34710

                                                                         
Query: 189   gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
             || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 34711 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 34770

                                  
Query: 249   gagttcctggccaccttcctc 269
             |||||| | ||||||||||||
Sbjct: 34771 gagttcgtcgccaccttcctc 34791

---

>dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461B08
          Length = 153743

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                          
Query: 69     atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
              |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 116147 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 116206

                                                                          
Query: 129    atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
              || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 116207 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 116263

                                                                          
Query: 189    gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
              || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 116264 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 116323

                                   
Query: 249    gagttcctggccaccttcctc 269
              |||||| | ||||||||||||
Sbjct: 116324 gagttcgtcgccaccttcctc 116344

---

>dbj|AK109319.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-G11, full
           insert sequence
          Length = 1128

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctc 255

---

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 117

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctc 255

---

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score =  149 bits (75), Expect = 5e-33
 Identities = 170/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   ||||| 
Sbjct: 113 atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcagccg 172

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 173 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 229

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 230 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 289

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 290 gagttcgtcgccaccttcctc 310

---

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score =  141 bits (71), Expect = 1e-30
 Identities = 169/201 (84%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| ||||| |||||| | |||||||||   | ||| 
Sbjct: 58  atggaggggaaggaggaggacgtgcggctgggggcgaacaggtactcggagaggcggccg 117

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 118 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 174

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 175 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 234

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 235 gagttcgtcgccaccttcctc 255

---

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score =  133 bits (67), Expect = 3e-28
 Identities = 168/201 (83%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||||||||| | | | |||||| | |||||||||   ||||| 
Sbjct: 56  atggaggggaaggaggaggacgtgcggccgcgggcgaacaggtactcggagaggcagccg 115

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | ||||   |||||||||||||||||||| |||
Sbjct: 116 atagggacggcggcgcagggcgccggggacgac---aaggactacaaggagccgccgccg 172

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 173 gcgccgctgttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 232

                                
Query: 249 gagttcctggccaccttcctc 269
           |||||| | ||||||||||||
Sbjct: 233 gagttcgtcgccaccttcctc 253

---

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score =  117 bits (59), Expect = 2e-23
 Identities = 127/150 (84%), Gaps = 6/150 (4%)
 Strand = Plus / Plus

                                                                       
Query: 126 cccatcggcacggcggcgcagggcggcggagccg------acgagaaggactacaaggag 179
           |||||||| |||||||||||||||| ||| ||||      |||| |||||||||||||||
Sbjct: 8   cccatcggtacggcggcgcagggcgccggggccggggacgacgacaaggactacaaggag 67

                                                                       
Query: 180 ccgcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggcc 239
           || || ||||| ||  | |||||| ||||||||||||  ||||||||||||||||| || 
Sbjct: 68  cccccgccggcgccgctgttcgagcccggggagctcaagtcctggtccttctaccgcgcg 127

                                         
Query: 240 ggcatcgccgagttcctggccaccttcctc 269
           ||||||||||||||| | ||||||||||||
Sbjct: 128 ggcatcgccgagttcgtcgccaccttcctc 157

---

>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein
          Length = 1179

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 125 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 178

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 179 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 238

                                 
Query: 248 cgagttcctggccaccttcctc 269
           ||||||| ||||||||||||||
Sbjct: 239 cgagttcatggccaccttcctc 260

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                            
Query: 68       gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
                ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 28019923 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 28019982

                                                                            
Query: 128      catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
                 |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 28019983 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 28020036

                                                                            
Query: 188      ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
                ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 28020037 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 28020096

                                      
Query: 248      cgagttcctggccaccttcctc 269
                ||||||| ||||||||||||||
Sbjct: 28020097 cgagttcatggccaccttcctc 28020118



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 135      acggcggcgcagggcggcgg 154
                ||||||||||||||||||||
Sbjct: 22386761 acggcggcgcagggcggcgg 22386742

---

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 59  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 118

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 119 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 172

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 173 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 232

                                 
Query: 248 cgagttcctggccaccttcctc 269
           ||||||| ||||||||||||||
Sbjct: 233 cgagttcatggccaccttcctc 254

---

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 60  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 119

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 120 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 173

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 174 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 233

                                 
Query: 248 cgagttcctggccaccttcctc 269
           ||||||| ||||||||||||||
Sbjct: 234 cgagttcatggccaccttcctc 255

---

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
           insert sequence
          Length = 1462

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 358 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 417

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 418 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 471

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 472 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 531

                                 
Query: 248 cgagttcctggccaccttcctc 269
           ||||||| ||||||||||||||
Sbjct: 532 cgagttcatggccaccttcctc 553

---

>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1179

 Score =  117 bits (59), Expect = 2e-23
 Identities = 166/202 (82%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                       
Query: 68  gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
           ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 65  gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 124

                                                                       
Query: 128 catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
            |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 125 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 178

                                                                       
Query: 188 ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
           ||| ||  | |||||| | ||||||||||  || |||||||||||||| || || |||||
Sbjct: 179 ggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcagggatcgc 238

                                 
Query: 248 cgagttcctggccaccttcctc 269
           ||||||| ||||||||||||||
Sbjct: 239 cgagttcatggccaccttcctc 260

---

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score =  111 bits (56), Expect = 1e-21
 Identities = 124/147 (84%), Gaps = 6/147 (4%)
 Strand = Plus / Plus

                                                                       
Query: 123 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 182
           ||||| |||||||||||||||||||||       ||||||| ||||||||||||||||||
Sbjct: 117 cagccgatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccg 170

                                                                       
Query: 183 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 242
           || ||||| ||  | |||||| | ||||||||||  || |||||||||||||| || || 
Sbjct: 171 ccgccggcgccgctgttcgagccaggggagctcaagtcgtggtccttctaccgcgcaggg 230

                                      
Query: 243 atcgccgagttcctggccaccttcctc 269
           |||||||||||| ||||||||||||||
Sbjct: 231 atcgccgagttcatggccaccttcctc 257

---

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score =  109 bits (55), Expect = 5e-21
 Identities = 165/202 (81%), Gaps = 6/202 (2%)
 Strand = Plus / Plus

                                                                         
Query: 68    gatggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcc 127
             ||||||||| ||||||||||| || || ||||| || |||   | |||||||   |||||
Sbjct: 27148 gatggaggggaaggaggaggatgtccggctgggagccaacaagttctcggagaggcagcc 27207

                                                                         
Query: 128   catcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgccccc 187
              |||||||||||||||||||||       ||||||| |||||||||||||||||||| ||
Sbjct: 27208 gatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccgccgcc 27261

                                                                         
Query: 188   ggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgc 247
             ||| ||  | |||||| | ||||||||||  || |||||| ||||||| || || |||||
Sbjct: 27262 ggcgccgctgttcgagccaggggagctcaagtcgtggtccctctaccgcgcagggatcgc 27321

                                   
Query: 248   cgagttcctggccaccttcctc 269
             ||||||| ||||||||||||||
Sbjct: 27322 cgagttcatggccaccttcctc 27343

---

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  103 bits (52), Expect = 3e-19
 Identities = 123/147 (83%), Gaps = 6/147 (4%)
 Strand = Plus / Plus

                                                                       
Query: 123 cagcccatcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccg 182
           ||||| |||||||||||||||||||||       ||||||| ||||||||||||||||||
Sbjct: 36  cagccgatcggcacggcggcgcagggct------ccgacgacaaggactacaaggagccg 89

                                                                       
Query: 183 cccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggc 242
           || ||||| ||  | |||||| | ||||||||||  || |||||| ||||||| || || 
Sbjct: 90  ccgccggcgccgctgttcgagccaggggagctcaagtcgtggtccctctaccgcgcaggg 149

                                      
Query: 243 atcgccgagttcctggccaccttcctc 269
           |||||||||||| ||||||||||||||
Sbjct: 150 atcgccgagttcatggccaccttcctc 176

---

>dbj|AB091106.2| Lilium longiflorum PIP1 mRNA for plasma membrane intrinsic protein,
           complete cds
          Length = 1145

 Score =  101 bits (51), Expect = 1e-18
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                       
Query: 167 ggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtc 226
           |||||||||||||||||| ||||| || || |||||| |||| |||||||  || |||||
Sbjct: 186 ggactacaaggagccgccaccggcgccgtttttcgagcccggtgagctcaagtcatggtc 245

                                                      
Query: 227 cttctaccgggccggcatcgccgagttcctggccaccttcctc 269
           ||||||||| |||||||||||||||||  | ||||||||||||
Sbjct: 246 cttctaccgtgccggcatcgccgagtttgtcgccaccttcctc 288



 Score = 48.1 bits (24), Expect = 0.014
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 111 tactcggagcaccagcccatcggcacggcggcgcag 146
           ||||||||||  ||||| ||||||||||||||||||
Sbjct: 139 tactcggagcggcagccgatcggcacggcggcgcag 174

---

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score =  101 bits (51), Expect = 1e-18
 Identities = 164/201 (81%), Gaps = 3/201 (1%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| |||||||| ||| |||| ||||| |||||| | | ||||||    ||||| 
Sbjct: 53  atggaggggaaggaggaagacttgcggctgggggcgaacaggttctcggaaaggcagccg 112

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           || || |||||||||||||||| ||| | | ||   |||||||||||||||||||| |||
Sbjct: 113 atagggacggcggcgcagggcgccggggacaac---aaggactacaaggagccgccgccg 169

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||| | ||||||||||  || ||||| |||||||||||||| ||||||
Sbjct: 170 gcgccgcttttcgagccaggggagctcaagtcgtggtctttctaccgggccgggatcgcc 229

                                
Query: 249 gagttcctggccaccttcctc 269
           || ||| | ||||||||||||
Sbjct: 230 gatttcgtcgccaccttcctc 250

---

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete
           cds
          Length = 1325

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                       
Query: 209 ggagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcct 268
           ||||||| |||| |||||||||||||| |||||||||||||||||| ||||||| |||||
Sbjct: 354 ggagctctcctcgtggtccttctaccgcgccggcatcgccgagttcgtggccacgttcct 413

            
Query: 269 c 269
           |
Sbjct: 414 c 414



 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 79  aggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagcccatcggcacgg 138
           |||| |||||||||||| |||||| | |||| | | ||||||  ||||||||||||||||
Sbjct: 233 aggaagaggacgtgcgcgtgggcgtggaccgtttcccggagcggcagcccatcggcacgg 292

                
Query: 139 cggcg 143
           |||||
Sbjct: 293 cggcg 297

---

>gb|DQ022749.1| Fragaria x ananassa plasma membrane intrinsic protein mRNA, partial
           cds
          Length = 604

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| |||||||| ||  |||||||| | || ||||| || || |||
Sbjct: 94  aaggactacaaggagcctcccccggcaccgctcttcgagccaggcgagctgacgtcatgg 153

                                                    
Query: 225 tccttctaccgggccggcatcgccgagttcctggccacctt 265
           || || ||| ||||||| |||||||||||| | ||||||||
Sbjct: 154 tcgttttacagggccgggatcgccgagttcatcgccacctt 194

---

>ref|XM_468463.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1319

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 160/200 (80%), Gaps = 6/200 (3%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 153 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 212

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 213 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 266

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 267 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 326

                               
Query: 249 gagttcctggccaccttcct 268
           |||||| |||| || |||||
Sbjct: 327 gagttcgtggcgacgttcct 346

---

>dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1136_C04
          Length = 103194

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 160/200 (80%), Gaps = 6/200 (3%)
 Strand = Plus / Plus

                                                                         
Query: 69    atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
             |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 28863 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 28922

                                                                         
Query: 129   atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
             ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 28923 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 28976

                                                                         
Query: 189   gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
             || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 28977 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 29036

                                 
Query: 249   gagttcctggccaccttcct 268
             |||||| |||| || |||||
Sbjct: 29037 gagttcgtggcgacgttcct 29056

---

>dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086K14, full
           insert sequence
          Length = 1318

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 160/200 (80%), Gaps = 6/200 (3%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 152 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 211

                                                                       
Query: 129 atcggcacggcggcgcagggcggcggagccgacgagaaggactacaaggagccgcccccg 188
           ||||| |||||||||||||| |||||||     ||||||||||||  |||||||||  ||
Sbjct: 212 atcgggacggcggcgcaggg-ggcggag-----gagaaggactaccgggagccgccggcg 265

                                                                       
Query: 189 gcccccttcttcgaggccggggagctcacctcctggtccttctaccgggccggcatcgcc 248
           || ||  | |||||||  | |||||| || || ||||| ||||||||||| || ||||| 
Sbjct: 266 gcgccggtgttcgaggtggaggagctgacgtcgtggtcgttctaccgggcggggatcgcg 325

                               
Query: 249 gagttcctggccaccttcct 268
           |||||| |||| || |||||
Sbjct: 326 gagttcgtggcgacgttcct 345

---

>gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1135

 Score = 65.9 bits (33), Expect = 6e-08
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||| ||||| || || ||||| ||||||||| |||| |||||||  || |||
Sbjct: 128 aaggactacaaagagccacctcccgcccctttcttcgagcccggagagctcaagtcgtgg 187

                                                        
Query: 225 tccttctaccgggccggcatcgccgagttcctggccaccttcctc 269
           ||||| ||| | || || ||||| || ||| ||||||||||||||
Sbjct: 188 tccttttacagagctggaatcgctgaattcatggccaccttcctc 232

---

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 210 gagctcacctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcctc 269
           |||||| |||| |||||||| ||||| ||||| |||||||||||| | ||||||||||||
Sbjct: 218 gagctctcctcgtggtccttttaccgcgccggaatcgccgagttcatagccaccttcctc 277

---

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 158 cgacgagaaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcac 217
           ||||| ||||||||||||||| || || || || ||  | |||||| |||| ||||| ||
Sbjct: 174 cgacgggaaggactacaaggaaccaccgcctgctccactgttcgagcccggcgagctgac 233

                                                              
Query: 218 ctcctggtccttctaccgggccggcatcgccgagttcctggccaccttcct 268
            || ||||| |||||| ||||||| |||||||||||| | ||||| |||||
Sbjct: 234 gtcatggtcgttctacagggccgggatcgccgagttcatcgccactttcct 284

---

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 177 gagccgcccccggcccccttcttcgaggccggggagctcacctcctggtccttctaccgg 236
           |||||||| ||||| || || || ||| |||| ||||| | ||| ||||| |||||||| 
Sbjct: 185 gagccgccaccggcaccgttgtttgagcccggcgagctgagctcgtggtctttctaccgc 244

                             
Query: 237 gccggcatcgccgagttc 254
           ||||||||||||||||||
Sbjct: 245 gccggcatcgccgagttc 262

---

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 214 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 273

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 274 ttctacagagccggaatcgccgagttcatagccaccttcct 314

---

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 120 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 179

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 180 ttctacagagccggaatcgccgagttcatagccaccttcct 220

---

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 101 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 160

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 161 ttctacagagccggaatcgccgagttcatagccaccttcct 201

---

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 142 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 201

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 202 ttctacagagccggaatcgccgagttcatagccaccttcct 242

---

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 88  gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 147

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 148 ttctacagagccggaatcgccgagttcatagccaccttcct 188

---

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 132 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 191

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 192 ttctacagagccggaatcgccgagttcatagccaccttcct 232

---

>gb|AC061957.3|F22L4 Sequence of BAC F22L4 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 66131

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                         
Query: 168   gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
             |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 64196 gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 64137

                                                      
Query: 228   ttctaccgggccggcatcgccgagttcctggccaccttcct 268
             |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 64136 ttctacagagccggaatcgccgagttcatagccaccttcct 64096

---

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||| ||||| || ||||| ||  | |||||| |||| ||||| || || ||||| 
Sbjct: 180 gactacaaagagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 239

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| ||||||| |||||||||||| | ||||| |||||
Sbjct: 240 ttctacagggccgggatcgccgagttcatcgccactttcct 280

---

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || || || || || |||||| | || ||||| |  || ||||||
Sbjct: 88  gactacaaggagccaccaccagctccatttttcgagccaggcgagctgagttcgtggtcc 147

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           |||||| | ||||| |||||||||||| | |||||||||||
Sbjct: 148 ttctacagagccggaatcgccgagttcatagccaccttcct 188

---

>dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membrane intrinsic protein
           1-1, complete cds
          Length = 1351

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           |||||||||||||| || ||||| ||  | |||||| |||| ||||| || || ||||| 
Sbjct: 321 gactacaaggagccaccgccggctccactgttcgagcccggtgagctgacgtcatggtcg 380

                                                    
Query: 228 ttctaccgggccggcatcgccgagttcctggccaccttcct 268
           || ||| ||||||| |||||||||||| | ||||| |||||
Sbjct: 381 ttttacagggccgggatcgccgagttcatcgccactttcct 421

---

>dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3, promoter region and
            complete cds
          Length = 5325

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 69   atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
            |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 3820 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 3879

                                
Query: 129  atcggcacggcggcgcaggg 148
            ||||| ||||||||||||||
Sbjct: 3880 atcgggacggcggcgcaggg 3899

---

>dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds
          Length = 1403

 Score = 56.0 bits (28), Expect = 6e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 69  atggagggcaaggaggaggacgtgcgcctgggcgcgaaccgctactcggagcaccagccc 128
           |||||||| ||||||||||| ||| | ||||| |||||| | ||| |||||   ||||| 
Sbjct: 133 atggaggggaaggaggaggatgtgaggctgggggcgaacaggtacacggagaggcagccg 192

                               
Query: 129 atcggcacggcggcgcaggg 148
           ||||| ||||||||||||||
Sbjct: 193 atcgggacggcggcgcaggg 212

---

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 103 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 162

                                         
Query: 225 tccttctaccgggccggcatcgccgagttc 254
           |||||||   | ||||| ||||||||||||
Sbjct: 163 tccttctggagagccggtatcgccgagttc 192

---

>emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative plasma membrane intrinsic
           protein (pip1a gene)
          Length = 1139

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 167 ggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtc 226
           ||||||||||||||||||||| || ||  | |  ||| | || ||||||| ||| |||||
Sbjct: 103 ggactacaaggagccgcccccagctcctctgtatgagccaggagagctcatctcatggtc 162

                                                     
Query: 227 cttctaccgggccggcatcgccgagttcctggccaccttcct 268
           ||||||| |||| || || || |||||| |||| ||||||||
Sbjct: 163 cttctacagggctggtatagcagagttcatggcgaccttcct 204



 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 68 gatggagggcaaggaggagga 88
          |||||||||||||||||||||
Sbjct: 10 gatggagggcaaggaggagga 30

---

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 104 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 163

                                         
Query: 225 tccttctaccgggccggcatcgccgagttc 254
           |||||||   | ||||| ||||||||||||
Sbjct: 164 tccttctggagagccggtatcgccgagttc 193

---

>dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane aquaporin 1c,
           complete cds
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| | || |||||  | ||||||
Sbjct: 111 aaggactacaaggagccacctcctgctcccttgttcgagccaggcgagcttgcttcctgg 170

                                         
Query: 225 tccttctaccgggccggcatcgccgagttc 254
           |||||||   | ||||| ||||||||||||
Sbjct: 171 tccttctggagagccggtatcgccgagttc 200

---

>gb|AF145707.1|AF145707 Lotus japonicus clone LJ-AQP1 plasma membrane intrinsic protein
           homolog (PIP) mRNA, partial cds
          Length = 527

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 209 ggagctcacctcctggtccttctaccgggccggcatcgccgagtt 253
           |||||||||||| |||||||||||| | ||||| || ||||||||
Sbjct: 15  ggagctcacctcatggtccttctacagagccggtattgccgagtt 59

---

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || ||||| ||  | |||||  |||| |||||  |||| |||
Sbjct: 107 aaggactacaaggagccaccaccggcaccgcttttcgatcccggtgagctgtcctcatgg 166

                                                       
Query: 225 tccttctaccgggccggcatcgccgagttcctggccaccttcct 268
           || |||||| | || ||||| ||||||||| | ||||| |||||
Sbjct: 167 tcgttctacagagctggcatagccgagttcatagccactttcct 210

---

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 48.1 bits (24), Expect = 0.014
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                               
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctca 216
           |||||||||||||||||||| || || ||||| || ||| |||| |||||||
Sbjct: 76  aaggactacaaggagccgccacctgcgcccttgtttgagcccggtgagctca 127

---

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 122 aaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcgtgg 181

                  
Query: 225 tccttct 231
           |||||||
Sbjct: 182 tccttct 188

---

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 121 aaggactacaaggagccacctcctgctcccttgttcgagcccggcgagcttgcttcgtgg 180

                  
Query: 225 tccttct 231
           |||||||
Sbjct: 181 tccttct 187

---

>gb|AF004293.1|AF004293 Brassica rapa aquaporin (MOD) mRNA, complete cds
          Length = 900

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 168 gactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctggtcc 227
           ||||||||||||||||| || || || || |||||| |||| |||||  | || ||||||
Sbjct: 106 gactacaaggagccgcctcctgcgccgttgttcgagcccggcgagcttgcgtcgtggtcc 165

                                      
Query: 228 ttctaccgggccggcatcgccgagttc 254
           ||||   | ||||| ||||||||||||
Sbjct: 166 ttctggagagccggaatcgccgagttc 192

---

>dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane aquaporin 1b,
           complete cds
          Length = 1053

 Score = 46.1 bits (23), Expect = 0.057
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || ||||| |||||| |||| |||||  | || |||
Sbjct: 106 aaggactacaaggagccacctcctgcgcccttgttcgagcccggcgagcttgcttcgtgg 165

                  
Query: 225 tccttct 231
           |||||||
Sbjct: 166 tccttct 172

---

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 165 aaggactacaaggagccgcccccggc 190
           ||||||||||||||||| ||||||||
Sbjct: 179 aaggactacaaggagccacccccggc 204

---

>gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mRNA, complete cds
          Length = 1136

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggagctcacctcctgg 224
           ||||||||||||||||| || || || || || || ||| | || |||||||  || |||
Sbjct: 147 aaggactacaaggagccaccaccagctcctttgtttgagcctggtgagctcaaatcatgg 206

                                                     
Query: 225 tccttctaccgggccggcatcgccgagttcctggccaccttc 266
           ||||||||| |||| || || || |||||  |||||||||||
Sbjct: 207 tccttctacagggctgggattgctgagtttgtggccaccttc 248

---

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 217 cctcctggtccttctaccgggccggcatcgccgagttc 254
           ||||||||||  ||||||| |||| |||||||||||||
Sbjct: 178 cctcctggtcgctctaccgcgccgtcatcgccgagttc 215

---

>ref|XM_526747.1| PREDICTED: Pan troglodytes similar to hypothetical protein
           (LOC471365), mRNA
          Length = 5565

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 204 gccggggagctcacctcctggtcct 228
           ||||||| |||||||||||||||||
Sbjct: 152 gccggggggctcacctcctggtcct 176

---

>gb|AC108477.5| Homo sapiens BAC clone RP11-499F19 from 4, complete sequence
          Length = 164194

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 204   gccggggagctcacctcctggtcct 228
             ||||||| |||||||||||||||||
Sbjct: 32406 gccggggggctcacctcctggtcct 32430

---

>emb|BX029520.1|CNS08UXW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 7   tatctctcacacccacaccca 27
           |||||||||||||||||||||
Sbjct: 495 tatctctcacacccacaccca 475

---

>gb|AE012531.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 439
            of 460 of the complete genome
          Length = 11870

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 89   cgtgcgcctgggcgcgaaccgctac 113
            |||||||||||||| ||||||||||
Sbjct: 5056 cgtgcgcctgggcgagaaccgctac 5032

---

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 89      cgtgcgcctgggcgcgaaccgctac 113
               |||||||||||||| ||||||||||
Sbjct: 4926305 cgtgcgcctgggcgagaaccgctac 4926281



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 60      gcggcggcgatggagggcaa 79
               ||||||||||||||||||||
Sbjct: 3070173 gcggcggcgatggagggcaa 3070154

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                         
Query: 222      tggtccttctaccgggccggcatcgccgagttcctggccac 262
                |||||| | ||||| |||| ||||||||||||| |||||||
Sbjct: 15315658 tggtccctgtaccgcgccgtcatcgccgagttcgtggccac 15315698



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 231      taccgggccggcatcgccgagttcctggccac 262
                ||||| |||| ||||||||||||| |||||||
Sbjct: 15323525 taccgcgccgtcatcgccgagttcgtggccac 15323556

---

>gb|AC095057.3| Homo sapiens BAC clone RP11-395I6 from 4, complete sequence
          Length = 163527

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 3     tctctatctctcacacccacacccatctt 31
             ||||| |||||||||| ||||||||||||
Sbjct: 85214 tctctctctctcacacacacacccatctt 85242

---

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 222   tggtccttctaccgggccggcatcgccgagttcctggccac 262
             |||||| | ||||| |||| ||||||||||||| |||||||
Sbjct: 22657 tggtccctgtaccgcgccgtcatcgccgagttcgtggccac 22697



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 231   taccgggccggcatcgccgagttcctggccac 262
             ||||| |||| ||||||||||||| |||||||
Sbjct: 30524 taccgcgccgtcatcgccgagttcgtggccac 30555

---

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 222    tggtccttctaccgggccggcatcgccgagttcctggccac 262
              |||||| | ||||| |||| ||||||||||||| |||||||
Sbjct: 101671 tggtccctgtaccgcgccgtcatcgccgagttcgtggccac 101711



 Score = 40.1 bits (20), Expect = 3.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 231    taccgggccggcatcgccgagttcctggccac 262
              ||||| |||| ||||||||||||| |||||||
Sbjct: 109538 taccgcgccgtcatcgccgagttcgtggccac 109569

---

>gb|AF145706.1|AF145706 Zea mays plasma membrane intrinsic protein homolog (pip) mRNA,
           partial cds
          Length = 528

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 222 tggtccttctaccgggccggcatcgccgagttcctggccac 262
           ||||| |||||| | ||||| |||||||||||| |||||||
Sbjct: 28  tggtcgttctacagagccggtatcgccgagttcgtggccac 68

---

>gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1298

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 222 tggtccttctaccgggccggcatcgccgagttcctggccac 262
           ||||| |||||| | ||||| |||||||||||| |||||||
Sbjct: 206 tggtcgttctacagagccggtatcgccgagttcgtggccac 246

---

>emb|AL928567.6| Mouse DNA sequence from clone RP23-296K20 on chromosome 11, complete
             sequence
          Length = 111073

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     atctctcacacccacacccat 28
             |||||||||||||||||||||
Sbjct: 12886 atctctcacacccacacccat 12906

---

>ref|XM_462670.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 954

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 135 acggcggcgcagggcggcgg 154
           ||||||||||||||||||||
Sbjct: 209 acggcggcgcagggcggcgg 190

---

>ref|NM_192161.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 792

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 131 cggcacggcggcgcagggcggcgg 154
           ||||||||||||| ||||||||||
Sbjct: 632 cggcacggcggcggagggcggcgg 609

---

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 231 taccgggccggcatcgccgagttcctggccac 262
           ||||| |||| ||||||||||||| |||||||
Sbjct: 103 taccgcgccgtcatcgccgagttcgtggccac 134

---

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 238     ccggcatcgccgagttcctg 257
               ||||||||||||||||||||
Sbjct: 2439947 ccggcatcgccgagttcctg 2439928

---

>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence
          Length = 218640

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     cacacccacacccatcttct 33
              ||||||||||||||||||||
Sbjct: 151385 cacacccacacccatcttct 151366

---

>gb|AC152166.4| Mus musculus BAC clone RP23-425A3 from chromosome 7, complete sequence
          Length = 216652

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    acccacacccatcttctcct 36
             ||||||||||||||||||||
Sbjct: 80467 acccacacccatcttctcct 80486

---

>gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, complete sequence
          Length = 214848

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     cacacccacacccatcttct 33
              ||||||||||||||||||||
Sbjct: 145336 cacacccacacccatcttct 145317

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    cgcccccggcccccttcttc 200
              ||||||||||||||||||||
Sbjct: 455052 cgcccccggcccccttcttc 455033

---

>gb|AF470087.1| Zea mays R2R3 Myb protein (Myb39) gene, partial cds
          Length = 433

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 77  caaggaggaggacgtgcgcctgggcgcg 104
           |||||||||||||| |||||||| ||||
Sbjct: 316 caaggaggaggacgagcgcctggtcgcg 343

---

>gb|AC124345.4| Mus musculus BAC clone RP24-459N19 from chromosome 15, complete
             sequence
          Length = 184532

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 12    ctcacacccacacccatcttctcc 35
             ||||||| ||||||||||||||||
Sbjct: 34549 ctcacacacacacccatcttctcc 34526

---

>gb|AC117240.4| Mus musculus BAC clone RP24-140F3 from 12, complete sequence
          Length = 171990

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     cacacccacacccatcttct 33
              ||||||||||||||||||||
Sbjct: 165898 cacacccacacccatcttct 165917

---

>emb|AL359963.29| Human DNA sequence from clone RP11-18A3 on chromosome 9 Contains a NADH
             dehydrogenase subunit 2 pseudogene, the 5' end of the
             EPB41L4B gene for erythrocyte membrane protein band 4.1
             like 4B, the 3' end of the PTPN3 gene for protein tyrosine
             phosphatase (non-receptor type 3), and one CpG island,
             complete sequence
          Length = 134979

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ccacacccatcttctcctcc 38
             ||||||||||||||||||||
Sbjct: 55883 ccacacccatcttctcctcc 55864

---

>emb|BX072361.1|CNS09RZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 141 ggagggcaaggaggaggacg 122

---

>emb|BX070068.1|CNS09Q88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 387 ggagggcaaggaggaggacg 406

---

>emb|BX068379.1|CNS09OXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295

---

>emb|BX068378.1|CNS09OXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 497 ggagggcaaggaggaggacg 516

---

>emb|BX067609.1|CNS09OBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 429

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 291 ggagggcaaggaggaggacg 272

---

>emb|BX067608.1|CNS09OBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 489 ggagggcaaggaggaggacg 508

---

>emb|BX061944.1|CNS09JYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260

---

>emb|BX057462.1|CNS09GI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 299 ggagggcaaggaggaggacg 280

---

>emb|BX056299.1|CNS09FLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 302 ggagggcaaggaggaggacg 283

---

>emb|BX055254.1|CNS09ESQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 239 ggagggcaaggaggaggacg 220

---

>emb|BX055253.1|CNS09ESP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 484 ggagggcaaggaggaggacg 503

---

>emb|BX054694.1|CNS09ED6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 203 ggagggcaaggaggaggacg 184

---

>emb|BX049557.1|CNS09AEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 251 ggagggcaaggaggaggacg 232

---

>emb|BX049556.1|CNS09AEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 468 ggagggcaaggaggaggacg 487

---

>emb|BX049060.1|CNS09A0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527

---

>emb|BX046605.1|CNS0984H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 279 ggagggcaaggaggaggacg 260

---

>emb|BX046604.1|CNS0984G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 926 ggagggcaaggaggaggacg 945

---

>emb|BX041706.1|CNS094CE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 253 ggagggcaaggaggaggacg 234

---

>emb|BX041977.1|CNS094JX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 464 ggagggcaaggaggaggacg 483

---

>emb|BX041661.1|CNS094B5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 483 ggagggcaaggaggaggacg 502

---

>emb|BX041260.1|CNS09400 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 510 ggagggcaaggaggaggacg 529

---

>emb|BX039117.1|CNS092CH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 345 ggagggcaaggaggaggacg 326

---

>emb|BX039116.1|CNS092CG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 513 ggagggcaaggaggaggacg 532

---

>emb|BX038773.1|CNS0922X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 329 ggagggcaaggaggaggacg 310

---

>emb|BX038772.1|CNS0922W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 512 ggagggcaaggaggaggacg 531

---

>emb|BX038693.1|CNS0920P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 704

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 314 ggagggcaaggaggaggacg 295

---

>emb|BX038692.1|CNS0920O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 521 ggagggcaaggaggaggacg 540

---

>emb|BX038208.1|CNS091N8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 341 ggagggcaaggaggaggacg 322

---

>emb|BX038207.1|CNS091N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 467 ggagggcaaggaggaggacg 486

---

>emb|BX038039.1|CNS091IJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 323 ggagggcaaggaggaggacg 304

---

>emb|BX038038.1|CNS091II Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 508 ggagggcaaggaggaggacg 527

---

>emb|BX037613.1|CNS0916P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 667

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 340 ggagggcaaggaggaggacg 321

---

>emb|BX037612.1|CNS0916O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 514 ggagggcaaggaggaggacg 533

---

>emb|BX037577.1|CNS0915P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 318 ggagggcaaggaggaggacg 299

---

>emb|BX037488.1|CNS09138 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 270 ggagggcaaggaggaggacg 251

---

>emb|BX037487.1|CNS09137 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 477 ggagggcaaggaggaggacg 496

---

>emb|BX036984.1|CNS090P8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 366

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 277 ggagggcaaggaggaggacg 258

---

>emb|BX032549.1|CNS08XA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505

---

>emb|BX028080.1|CNS08TTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 388 ggagggcaaggaggaggacg 407

---

>emb|BX027509.1|CNS08TE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 393

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 292 ggagggcaaggaggaggacg 273

---

>emb|BX027508.1|CNS08TE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 498 ggagggcaaggaggaggacg 517

---

>emb|BX024766.1|CNS08R9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 460

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 233 ggagggcaaggaggaggacg 214

---

>emb|BX019545.1|CNS08N8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 248 ggagggcaaggaggaggacg 229

---

>emb|BX019544.1|CNS08N8S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 507 ggagggcaaggaggaggacg 526

---

>emb|BX021590.1|CNS08OTM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 280 ggagggcaaggaggaggacg 261

---

>emb|BX021589.1|CNS08OTL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 350 ggagggcaaggaggaggacg 369

---

>emb|BX021431.1|CNS08OP7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 304 ggagggcaaggaggaggacg 285

---

>emb|BX020809.1|CNS08O7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 243 ggagggcaaggaggaggacg 262

---

>emb|BX012334.1|CNS08HOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 385

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 319 ggagggcaaggaggaggacg 300

---

>emb|BX008016.1|CNS08ECK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 287 ggagggcaaggaggaggacg 268

---

>emb|BX008015.1|CNS08ECJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 486 ggagggcaaggaggaggacg 505

---

>gb|AE005794.1| Caulobacter crescentus CB15 section 120 of 359 of the complete genome
          Length = 11475

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 127  ccatcggcacggcggcgcagggcg 150
            |||||||||||||||||| |||||
Sbjct: 2704 ccatcggcacggcggcgctgggcg 2727

---

>gb|AE012270.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 178
            of 460 of the complete genome
          Length = 10135

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 60   gcggcggcgatggagggcaa 79
            ||||||||||||||||||||
Sbjct: 9243 gcggcggcgatggagggcaa 9262

---

>gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-3
           (PIP1-3) mRNA, complete cds
          Length = 1159

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 165 aaggactacaaggagccgcccccggcccccttcttcgaggccggggag 212
           ||||||||||||||||| || || || ||||| || ||| ||||||||
Sbjct: 141 aaggactacaaggagccaccaccagcacccttgtttgagcccggggag 188

---

>gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-2
           (PIP1-2) mRNA, complete cds
          Length = 1154

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 246 gccgagttcctggccaccttcctc 269
           ||||||||| ||||||||||||||
Sbjct: 228 gccgagttcatggccaccttcctc 251

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
              complete sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 181    cgcccccggcccccttcttc 200
              ||||||||||||||||||||
Sbjct: 455050 cgcccccggcccccttcttc 455031

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 131      cggcacggcggcgcagggcggcgg 154
                ||||||||||||| ||||||||||
Sbjct: 28616742 cggcacggcggcggagggcggcgg 28616765

---

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 222 tggtccttctaccgggccggcatcgccgagttcctggccaccttcctc 269
           |||||||||||| | |||| ||| ||||||||| | |||||| |||||
Sbjct: 149 tggtccttctacagagccgtcattgccgagttcgtcgccaccctcctc 196

---

>gb|AC021667.21|AC021667 Mus musculus, clone RP23-304J12, complete sequence
          Length = 203106

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 12     ctcacacccacacccatcttctcc 35
              ||||||| ||||||||||||||||
Sbjct: 103003 ctcacacacacacccatcttctcc 103026

---

>dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0034C09
          Length = 170226

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 131    cggcacggcggcgcagggcggcgg 154
              ||||||||||||| ||||||||||
Sbjct: 143181 cggcacggcggcggagggcggcgg 143204

---

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 246 gccgagttcctggccaccttcctc 269
           ||||||||| ||||||||||||||
Sbjct: 220 gccgagttcatggccaccttcctc 243

---

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 131     cggcacggcggcgcagggcggcgg 154
               |||| |||||||||||||||||||
Sbjct: 2626407 cggcgcggcggcgcagggcggcgg 2626430

---

>ref|XM_321749.2| Anopheles gambiae str. PEST ENSANGP00000016913
           (ENSANGG00000014424), mRNA
          Length = 817

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 71  ggagggcaaggaggaggacg 90
           ||||||||||||||||||||
Sbjct: 504 ggagggcaaggaggaggacg 523

---

>gb|AY108280.1| Zea mays PCO132931 mRNA sequence
          Length = 1372

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 77  caaggaggaggacgtgcgcctgggcgcg 104
           |||||||||||||| |||||||| ||||
Sbjct: 192 caaggaggaggacgagcgcctggtcgcg 219

---

>gb|AY106483.1| Zea mays PCO145034 mRNA sequence
          Length = 1197

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 59  agcggcggcgatggagggcaagga 82
           ||||| ||||||||||||||||||
Sbjct: 84  agcggtggcgatggagggcaagga 107

---

>emb|AM156906.1| Zea mays mRNA for transcription factor MYB31 (myb31 gene)
          Length = 1264

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 77  caaggaggaggacgtgcgcctgggcgcg 104
           |||||||||||||| |||||||| ||||
Sbjct: 194 caaggaggaggacgagcgcctggtcgcg 221

---

>emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064H22,
              complete sequence
          Length = 147214

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 135    acggcggcgcagggcggcgg 154
              ||||||||||||||||||||
Sbjct: 137665 acggcggcgcagggcggcgg 137646

---

>emb|CR391944.10| Zebrafish DNA sequence from clone CH211-95K19 in linkage group 3,
            complete sequence
          Length = 172806

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 1    aatctctatctctcacacccacac 24
            |||||||||||||||||| |||||
Sbjct: 2066 aatctctatctctcacacacacac 2089

---

>gb|AC113930.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1384D03,
             complete sequence
          Length = 116214

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   cgcccccggcccccttcttc 200
             ||||||||||||||||||||
Sbjct: 53512 cgcccccggcccccttcttc 53493


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,422,402
Number of Sequences: 3902068
Number of extensions: 2422402
Number of successful extensions: 60800
Number of sequences better than 10.0: 162
Number of HSP's better than 10.0 without gapping: 163
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 60032
Number of HSP's gapped (non-prelim): 731
length of query: 269
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 247
effective length of database: 17,147,199,772
effective search space: 4235358343684
effective search space used: 4235358343684
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---