ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet51h08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_104782.3| Arabidopsis thaliana unknown protein AT1G61010 ... 42 0.14
2ref|NM_001036138.1| Arabidopsis thaliana unknown protein AT1G610... 42 0.14
3ref|NM_179504.1| Arabidopsis thaliana unknown protein AT1G61010 ... 42 0.14
4gb|AY140900.1| Arabidopsis thaliana putative cleavage and polyad... 42 0.14
5gb|AY074280.1| Arabidopsis thaliana putative cleavage and polyad... 42 0.14
6emb|BX816651.1|CNS0AASC Arabidopsis thaliana Full-length cDNA Co... 42 0.14
7gb|AC018908.8|AC018908 Arabidopsis thaliana chromosome 1 BAC T7P... 42 0.14
8emb|AJ250498.1|VFA250498 Vicia faba ENOD5 gene for early nodulin... 42 0.14
9emb|AJ250497.1|VFA250497 Vicia faba mRNA for early nodulin (ENOD... 42 0.14
10ref|NM_111992.2| Arabidopsis thaliana unknown protein AT3G11590 ... 40 0.55
11ref|NM_119889.2| Arabidopsis thaliana MYB73; DNA binding / trans... 40 0.55
12ref|NM_119890.2| Arabidopsis thaliana HMA1; copper-exporting ATP... 40 0.55
13ref|NM_114837.2| Arabidopsis thaliana unknown protein AT3G49770 ... 40 0.55
14gb|AY800625.1| Arabidopsis thaliana clone H0000001232 hypothetic... 40 0.55
15gb|AY519613.1| Arabidopsis thaliana MYB transcription factor (At... 40 0.55
16ref|XM_719328.1| Plasmodium yoelii yoelii str. 17XNL mature-para... 40 0.55
17gb|AY150478.1| Arabidopsis thaliana putative cleavage and polyad... 40 0.55
18emb|Z99707.1|ATAP21 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 0.55
19gb|AY091267.1| Arabidopsis thaliana putative myb-related protein... 40 0.55
20gb|AY063912.1| Arabidopsis thaliana putative myb-related protein... 40 0.55
21emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, ... 40 0.55
22emb|AL132965.1|ATT16K5 Arabidopsis thaliana DNA chromosome 3, BA... 40 0.55
23gb|AF412084.1|AF412084 Arabidopsis thaliana AT3g11590/F24K9_26 m... 40 0.55
24emb|BX823893.1|CNS0A6J9 Arabidopsis thaliana Full-length cDNA Co... 40 0.55
25emb|BX826190.1|CNS0A50I Arabidopsis thaliana Full-length cDNA Co... 40 0.55
26gb|AC158498.3| Medicago truncatula chromosome 2 BAC clone mth2-6... 40 0.55
27gb|AC008153.5|AC008153 Arabidopsis thaliana chromosome 3 BAC F24... 40 0.55
28gb|AY954850.1| Arabidopsis thaliana hypothetical protein (At3g49... 40 0.55
29dbj|AP001024.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 0.55
30gb|AF062906.1|AF062906 Arabidopsis thaliana putative transcripti... 40 0.55
31ref|XM_803800.1| Trypanosoma cruzi strain CL Brener SPFH domain ... 38 2.2
32emb|CR388058.6| Zebrafish DNA sequence from clone DKEY-184L17 in... 38 2.2
33gb|AC137152.2| Mus musculus BAC clone RP24-269A16 from chromosom... 38 2.2
34gb|AC133942.3| Mus musculus BAC clone RP23-472J11 from chromosom... 38 2.2
35gb|AC155346.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 38 2.2
36gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, com... 36 8.6
37gb|AY383619.1| Citrus x paradisi harpin binding protein 1 (HrBP1... 36 8.6
38gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 36 8.6
39gb|AF119632.1| Polistes cavapyta microsatellite Pbe269 sequence 36 8.6
40gb|AF119631.1| Polistes canadensis microsatellite Pbe269 sequence 36 8.6
41gb|AF119630.1| Polistes buyssoni microsatellite Pbe269 sequence 36 8.6
42gb|AF119629.1| Polistes annularis microsatellite Pbe269 sequence 36 8.6
43gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 36 8.6
44gb|AC108433.9| Mus musculus chromosome 18, clone RP23-194M19, co... 36 8.6
45gb|U12964.1| Caenorhabditis elegans cosmid F26F4, complete sequence 36 8.6
46ref|XM_880857.1| PREDICTED: Bos taurus similar to PL6 protein (P... 36 8.6
47ref|XM_610981.2| PREDICTED: Bos taurus similar to PL6 protein (P... 36 8.6
48gb|AY028371.1| Bacteroides fragilis ferritin A (ftnA) gene, comp... 36 8.6
49gb|AY600965.1| Mangifera indica xyloglucanendotransglycosylase m... 36 8.6
50gb|DQ465448.1| Arabidopsis thaliana ecotype Tamm_46 disease resi... 36 8.6
51gb|DQ465441.1| Arabidopsis thaliana ecotype Ler_0 disease resist... 36 8.6
52gb|DQ465440.1| Arabidopsis thaliana ecotype Kas_1 disease resist... 36 8.6
53gb|DQ465438.1| Arabidopsis thaliana ecotype Ang_0 disease resist... 36 8.6
54gb|AY487212.1| Arabidopsis thaliana isolate Sco_1 disease resist... 36 8.6
55gb|AY487211.1| Arabidopsis thaliana isolate Cul_1 disease resist... 36 8.6
56gb|AY487210.1| Arabidopsis thaliana isolate Ksk_1 disease resist... 36 8.6
57gb|AY487209.1| Arabidopsis thaliana isolate Crl_1 disease resist... 36 8.6
58gb|AY487208.1| Arabidopsis thaliana isolate Bra_1 disease resist... 36 8.6
59ref|XM_566735.1| Cryptococcus neoformans var. neoformans JEC21 m... 36 8.6
60gb|AF465511.1| Human coxsackievirus A13 strain Flores, complete ... 36 8.6
61gb|AF499637.1| Human coxsackievirus A13 strain Flores, complete ... 36 8.6
62emb|AL136312.11| Human DNA sequence from clone RP3-494K13 on chr... 36 8.6
63emb|AL096769.7|HS1080B10 Human DNA sequence from clone RP5-1080B... 36 8.6
64emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 36 8.6
65gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, com... 36 8.6
66gb|DQ099201.1| Arachis hypogaea clone Ah1TC1H04 microsatellite s... 36 8.6
67gb|DQ399466.1| Ictalurus punctatus clone SGGA03 PRP19/PSO4-like ... 36 8.6
68gb|AC146722.16| Medicago truncatula clone mth2-23c16, complete s... 36 8.6
69gb|AC093494.1| Homo sapiens chromosome 3 clone RP11-1004I19 map ... 36 8.6
70ref|NM_065624.3| Caenorhabditis elegans F26F4.6 (F26F4.6) mRNA, ... 36 8.6
71emb|BX834006.1|CNS09Z0F Arabidopsis thaliana Full-length cDNA Co... 36 8.6
72gb|AC110086.3| Homo sapiens BAC clone RP11-624F4 from 2, complet... 36 8.6
73gb|AC084466.1|AC084466 Caenorhabditis briggsae cosmid CB041P18, ... 36 8.6
74ref|XM_224784.3| PREDICTED: Rattus norvegicus tolloid-like (pred... 36 8.6
75gb|AC091492.2| Homo sapiens chromosome 3 clone RP11-335I9 map 3p... 36 8.6
76dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome 36 8.6
77emb|AL117202.1|CEY47D3A Caenorhabditis elegans YAC Y47D3A, compl... 36 8.6
78gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, co... 36 8.6
79emb|AL672249.6| Mouse DNA sequence from clone RP23-92P11 on chro... 36 8.6
80emb|AL831759.5| Mouse DNA sequence from clone RP23-150J13 on chr... 36 8.6 
>ref|NM_104782.3| Arabidopsis thaliana unknown protein AT1G61010 transcript variant
          AT1G61010.1 mRNA, complete cds
          Length = 2390

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 71 catggcttcttcttctacttc 91
to top
>ref|NM_001036138.1| Arabidopsis thaliana unknown protein AT1G61010 transcript variant
          AT1G61010.3 mRNA, complete cds
          Length = 2412

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 59 catggcttcttcttctacttc 79
to top
>ref|NM_179504.1| Arabidopsis thaliana unknown protein AT1G61010 transcript variant
          AT1G61010.2 mRNA, complete cds
          Length = 2455

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 59 catggcttcttcttctacttc 79
to top
>gb|AY140900.1| Arabidopsis thaliana putative cleavage and polyadenylation
          specificity factor 73 kDa subunit (At1g61010) mRNA,
          complete cds
          Length = 2338

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 71 catggcttcttcttctacttc 91
to top
>gb|AY074280.1| Arabidopsis thaliana putative cleavage and polyadenylation
          specificity factor (At1g61010) mRNA, complete cds
          Length = 2346

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 59 catggcttcttcttctacttc 79
to top
>emb|BX816651.1|CNS0AASC Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH60ZD03 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 2278

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 39 catggcttcttcttctacttc 59
to top
>gb|AC018908.8|AC018908 Arabidopsis thaliana chromosome 1 BAC T7P1 genomic sequence, complete
             sequence
          Length = 102299

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    catggcttcttcttctacttc 35
             |||||||||||||||||||||
Sbjct: 72746 catggcttcttcttctacttc 72726
to top
>emb|AJ250498.1|VFA250498 Vicia faba ENOD5 gene for early nodulin, exons 1-2
          Length = 2457

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 15   catggcttcttcttctacttc 35
            |||||||||||||||||||||
Sbjct: 1385 catggcttcttcttctacttc 1405
to top
>emb|AJ250497.1|VFA250497 Vicia faba mRNA for early nodulin (ENOD5 gene)
          Length = 559

 Score = 42.1 bits (21), Expect = 0.14
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 15 catggcttcttcttctacttc 35
          |||||||||||||||||||||
Sbjct: 7  catggcttcttcttctacttc 27
to top
>ref|NM_111992.2| Arabidopsis thaliana unknown protein AT3G11590 mRNA, complete cds
          Length = 2218

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  atggcttcttcttctacttc 35
           ||||||||||||||||||||
Sbjct: 101 atggcttcttcttctacttc 82
to top
>ref|NM_119889.2| Arabidopsis thaliana MYB73; DNA binding / transcription factor
           AT4G37260 (MYB73) mRNA, complete cds
          Length = 1310

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 845 cttcttcttctacttccact 826
to top
>ref|NM_119890.2| Arabidopsis thaliana HMA1; copper-exporting ATPase AT4G37270 (HMA1)
            mRNA, complete cds
          Length = 4089

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 20   cttcttcttctacttccact 39
            ||||||||||||||||||||
Sbjct: 3245 cttcttcttctacttccact 3264
to top
>ref|NM_114837.2| Arabidopsis thaliana unknown protein AT3G49770 mRNA, complete cds
          Length = 904

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 169 cttcttcttctacttccact 150
to top
>gb|AY800625.1| Arabidopsis thaliana clone H0000001232 hypothetical protein
           (AT3G49770) mRNA, complete cds
          Length = 928

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 169 cttcttcttctacttccact 150
to top
>gb|AY519613.1| Arabidopsis thaliana MYB transcription factor (At4g37260) mRNA,
           complete cds
          Length = 963

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 733 cttcttcttctacttccact 714
to top
>ref|XM_719328.1| Plasmodium yoelii yoelii str. 17XNL mature-parasite-infected
           erythrocyte surface antigen (PY04167) partial mRNA
          Length = 3012

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 685 cttcttcttctacttccact 666



 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 613 cttcttcttctacttccact 594
to top
>gb|AY150478.1| Arabidopsis thaliana putative cleavage and polyadenylation
          specificity factor (At1g61010) mRNA, complete cds
          Length = 2113

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 16 atggcttcttcttctacttc 35
          ||||||||||||||||||||
Sbjct: 1  atggcttcttcttctacttc 20
to top
>emb|Z99707.1|ATAP21 Arabidopsis thaliana DNA chromosome 4, ESSA I AP2 contig fragment No. 1
          Length = 206420

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    cttcttcttctacttccact 39
             ||||||||||||||||||||
Sbjct: 26350 cttcttcttctacttccact 26369
to top
>gb|AY091267.1| Arabidopsis thaliana putative myb-related protein (At4g37260) mRNA,
           complete cds
          Length = 994

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 733 cttcttcttctacttccact 714
to top
>gb|AY063912.1| Arabidopsis thaliana putative myb-related protein (At4g37260) mRNA,
           complete cds
          Length = 1344

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 845 cttcttcttctacttccact 826
to top
>emb|AL161591.2|ATCHRIV87 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 87
          Length = 196339

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    cttcttcttctacttccact 39
             ||||||||||||||||||||
Sbjct: 35104 cttcttcttctacttccact 35085
to top
>emb|AL132965.1|ATT16K5 Arabidopsis thaliana DNA chromosome 3, BAC clone T16K5
          Length = 97711

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    cttcttcttctacttccact 39
             ||||||||||||||||||||
Sbjct: 51460 cttcttcttctacttccact 51479
to top
>gb|AF412084.1|AF412084 Arabidopsis thaliana AT3g11590/F24K9_26 mRNA, complete cds
          Length = 2175

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 16  atggcttcttcttctacttc 35
           ||||||||||||||||||||
Sbjct: 101 atggcttcttcttctacttc 82
to top
>emb|BX823893.1|CNS0A6J9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS8ZD07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1539

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 276 cttcttcttctacttccact 295
to top
>emb|BX826190.1|CNS0A50I Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTSIL8ZG10 of Silique of strain col-0 of
          Arabidopsis thaliana (thale cress)
          Length = 735

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 16 atggcttcttcttctacttc 35
          ||||||||||||||||||||
Sbjct: 43 atggcttcttcttctacttc 24
to top
>gb|AC158498.3| Medicago truncatula chromosome 2 BAC clone mth2-65n13, complete
             sequence
          Length = 124573

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    cttcttcttctacttccact 39
             ||||||||||||||||||||
Sbjct: 50198 cttcttcttctacttccact 50179
to top
>gb|AC008153.5|AC008153 Arabidopsis thaliana chromosome 3 BAC F24K9 genomic sequence, complete
              sequence
          Length = 117296

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     atggcttcttcttctacttc 35
              ||||||||||||||||||||
Sbjct: 103012 atggcttcttcttctacttc 102993
to top
>gb|AY954850.1| Arabidopsis thaliana hypothetical protein (At3g49770) mRNA,
          complete cds
          Length = 573

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 20 cttcttcttctacttccact 39
          ||||||||||||||||||||
Sbjct: 82 cttcttcttctacttccact 63
to top
>dbj|AP001024.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-832N8, complete
              sequence
          Length = 183444

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     cttcttcttctacttccact 39
              ||||||||||||||||||||
Sbjct: 172047 cttcttcttctacttccact 172066
to top
>gb|AF062906.1|AF062906 Arabidopsis thaliana putative transcription factor (MYB73) mRNA,
           partial cds
          Length = 1014

 Score = 40.1 bits (20), Expect = 0.55
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 20  cttcttcttctacttccact 39
           ||||||||||||||||||||
Sbjct: 577 cttcttcttctacttccact 558
to top
>ref|XM_803800.1| Trypanosoma cruzi strain CL Brener SPFH domain / Band 7 family
            protein (Tc00.1047053508397.30) partial mRNA
          Length = 1218

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 17   tggcttcttcttctacttccact 39
            |||||||||||||| ||||||||
Sbjct: 1184 tggcttcttcttcttcttccact 1206
to top
>emb|CR388058.6| Zebrafish DNA sequence from clone DKEY-184L17 in linkage group 8,
             complete sequence
          Length = 141160

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ttcttcttctacttccact 39
             |||||||||||||||||||
Sbjct: 68776 ttcttcttctacttccact 68758
to top
>gb|AC137152.2| Mus musculus BAC clone RP24-269A16 from chromosome 7, complete sequence
          Length = 179719

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     tcttcttctacttccactc 40
              |||||||||||||||||||
Sbjct: 126753 tcttcttctacttccactc 126771
to top
>gb|AC133942.3| Mus musculus BAC clone RP23-472J11 from chromosome 7, complete sequence
          Length = 186014

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    tcttcttctacttccactc 40
             |||||||||||||||||||
Sbjct: 98184 tcttcttctacttccactc 98166
to top
>gb|AC155346.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1
             clone KBrH081N08, complete sequence
          Length = 56991

 Score = 38.2 bits (19), Expect = 2.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    cttcttcttctacttccac 38
             |||||||||||||||||||
Sbjct: 32417 cttcttcttctacttccac 32399
to top
>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence
          Length = 187760

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 20    cttcttcttctacttcca 37
             ||||||||||||||||||
Sbjct: 18284 cttcttcttctacttcca 18267
to top
>gb|AY383619.1| Citrus x paradisi harpin binding protein 1 (HrBP1) mRNA, complete
           cds
          Length = 1103

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  ggcttcttcttctacttc 35
           ||||||||||||||||||
Sbjct: 258 ggcttcttcttctacttc 241
to top
>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     ggcttcttcttctacttc 35
              ||||||||||||||||||
Sbjct: 356446 ggcttcttcttctacttc 356429
to top
>gb|AF119632.1| Polistes cavapyta microsatellite Pbe269 sequence
          Length = 105

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 20 cttcttcttctacttcca 37
          ||||||||||||||||||
Sbjct: 22 cttcttcttctacttcca 5
to top
>gb|AF119631.1| Polistes canadensis microsatellite Pbe269 sequence
          Length = 99

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 20 cttcttcttctacttcca 37
          ||||||||||||||||||
Sbjct: 22 cttcttcttctacttcca 5
to top
>gb|AF119630.1| Polistes buyssoni microsatellite Pbe269 sequence
          Length = 105

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 20 cttcttcttctacttcca 37
          ||||||||||||||||||
Sbjct: 22 cttcttcttctacttcca 5
to top
>gb|AF119629.1| Polistes annularis microsatellite Pbe269 sequence
          Length = 114

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 20 cttcttcttctacttcca 37
          ||||||||||||||||||
Sbjct: 22 cttcttcttctacttcca 5
to top
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 20      cttcttcttctacttcca 37
               ||||||||||||||||||
Sbjct: 1052168 cttcttcttctacttcca 1052151
to top
>gb|AC108433.9| Mus musculus chromosome 18, clone RP23-194M19, complete sequence
          Length = 188997

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 7     cttacaagcatggcttcttctt 28
             ||||||||||||||| ||||||
Sbjct: 94930 cttacaagcatggctgcttctt 94951
to top
>gb|U12964.1| Caenorhabditis elegans cosmid F26F4, complete sequence
          Length = 32365

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 24   ttcttctacttccactcg 41
            ||||||||||||||||||
Sbjct: 7564 ttcttctacttccactcg 7581
to top
>ref|XM_880857.1| PREDICTED: Bos taurus similar to PL6 protein (Placental protein 6)
           (PP6), transcript variant 2 (LOC532459), mRNA
          Length = 1954

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                     
Query: 26  cttctacttccactcgggtcgtctcc 51
           |||||||||||| |||||||| ||||
Sbjct: 317 cttctacttccagtcgggtcgactcc 292
to top
>ref|XM_610981.2| PREDICTED: Bos taurus similar to PL6 protein (Placental protein 6)
           (PP6), transcript variant 1 (LOC532459), mRNA
          Length = 2092

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                     
Query: 26  cttctacttccactcgggtcgtctcc 51
           |||||||||||| |||||||| ||||
Sbjct: 317 cttctacttccagtcgggtcgactcc 292
to top
>gb|AY028371.1| Bacteroides fragilis ferritin A (ftnA) gene, complete cds
          Length = 740

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 17  tggcttcttcttctactt 34
           ||||||||||||||||||
Sbjct: 533 tggcttcttcttctactt 516
to top
>gb|AY600965.1| Mangifera indica xyloglucanendotransglycosylase mRNA, partial cds
          Length = 426

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 15 catggcttcttcttctac 32
          ||||||||||||||||||
Sbjct: 30 catggcttcttcttctac 47
to top
>gb|DQ465448.1| Arabidopsis thaliana ecotype Tamm_46 disease resistance protein RPP13
            variant (RPP13) gene, complete cds
          Length = 3887

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 3036 gcatggcttcttcttcta 3019
to top
>gb|DQ465441.1| Arabidopsis thaliana ecotype Ler_0 disease resistance protein RPP13
            variant (RPP13) gene, complete cds
          Length = 3891

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 3044 gcatggcttcttcttcta 3027
to top
>gb|DQ465440.1| Arabidopsis thaliana ecotype Kas_1 disease resistance protein RPP13
            variant (RPP13) gene, complete cds
          Length = 3839

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2993 gcatggcttcttcttcta 2976
to top
>gb|DQ465438.1| Arabidopsis thaliana ecotype Ang_0 disease resistance protein RPP13
            variant (RPP13) gene, complete cds
          Length = 3884

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 3033 gcatggcttcttcttcta 3016
to top
>gb|AY487212.1| Arabidopsis thaliana isolate Sco_1 disease resistance protein RPP13
            variant gene, complete cds
          Length = 2584

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2443 gcatggcttcttcttcta 2426
to top
>gb|AY487211.1| Arabidopsis thaliana isolate Cul_1 disease resistance protein RPP13
            variant gene, complete cds
          Length = 2581

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2440 gcatggcttcttcttcta 2423
to top
>gb|AY487210.1| Arabidopsis thaliana isolate Ksk_1 disease resistance protein RPP13
            variant gene, complete cds
          Length = 2581

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2440 gcatggcttcttcttcta 2423
to top
>gb|AY487209.1| Arabidopsis thaliana isolate Crl_1 disease resistance protein RPP13
            variant gene, complete cds
          Length = 2581

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2440 gcatggcttcttcttcta 2423
to top
>gb|AY487208.1| Arabidopsis thaliana isolate Bra_1 disease resistance protein RPP13
            variant gene, complete cds
          Length = 2581

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   gcatggcttcttcttcta 31
            ||||||||||||||||||
Sbjct: 2440 gcatggcttcttcttcta 2423
to top
>ref|XM_566735.1| Cryptococcus neoformans var. neoformans JEC21 mitochondrion protein
            (CNA03910) partial mRNA
          Length = 1766

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 20   cttcttcttctacttcca 37
            ||||||||||||||||||
Sbjct: 1611 cttcttcttctacttcca 1594
to top
>gb|AF465511.1| Human coxsackievirus A13 strain Flores, complete genome
          Length = 7458

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 15   catggcttcttcttctac 32
            ||||||||||||||||||
Sbjct: 3844 catggcttcttcttctac 3827
to top
>gb|AF499637.1| Human coxsackievirus A13 strain Flores, complete genome
          Length = 7458

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 15   catggcttcttcttctac 32
            ||||||||||||||||||
Sbjct: 3844 catggcttcttcttctac 3827
to top
>emb|AL136312.11| Human DNA sequence from clone RP3-494K13 on chromosome 6 Contains GSSs
             and STSs, complete sequence
          Length = 56028

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    tggcttcttcttctactt 34
             ||||||||||||||||||
Sbjct: 28926 tggcttcttcttctactt 28909
to top
>emb|AL096769.7|HS1080B10 Human DNA sequence from clone RP5-1080B10 on chromosome 20 Contains
             STSs and GSSs, complete sequence
          Length = 81798

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    agcatggcttcttcttct 30
             ||||||||||||||||||
Sbjct: 74824 agcatggcttcttcttct 74841
to top
>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 17      tggcttcttcttctactt 34
               ||||||||||||||||||
Sbjct: 3347604 tggcttcttcttctactt 3347621
to top
>gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, complete sequence
          Length = 198253

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 20     cttcttcttctacttcca 37
              ||||||||||||||||||
Sbjct: 183521 cttcttcttctacttcca 183504
to top
>gb|DQ099201.1| Arachis hypogaea clone Ah1TC1H04 microsatellite sequence
          Length = 691

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 15  catggcttcttcttctacttcc 36
           |||||||||||||||| |||||
Sbjct: 573 catggcttcttcttcttcttcc 594
to top
>gb|DQ399466.1| Ictalurus punctatus clone SGGA03 PRP19/PSO4-like protein-like mRNA,
           partial cds
          Length = 606

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 17  tggcttcttcttctacttccac 38
           |||||||||||||| |||||||
Sbjct: 516 tggcttcttcttcttcttccac 495
to top
>gb|AC146722.16| Medicago truncatula clone mth2-23c16, complete sequence
          Length = 121968

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 21    ttcttcttctacttccac 38
             ||||||||||||||||||
Sbjct: 65151 ttcttcttctacttccac 65168
to top
>gb|AC093494.1| Homo sapiens chromosome 3 clone RP11-1004I19 map 3p, complete sequence
          Length = 159189

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     tcttcttctacttccact 39
              ||||||||||||||||||
Sbjct: 157931 tcttcttctacttccact 157948
to top
>ref|NM_065624.3| Caenorhabditis elegans F26F4.6 (F26F4.6) mRNA, complete cds
          Length = 1183

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 24  ttcttctacttccactcg 41
           ||||||||||||||||||
Sbjct: 100 ttcttctacttccactcg 83
to top
>emb|BX834006.1|CNS09Z0F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL8ZF02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 852

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 20  cttcttcttctacttccactcg 41
           ||||||||||| ||||||||||
Sbjct: 509 cttcttcttcttcttccactcg 488
to top
>gb|AC110086.3| Homo sapiens BAC clone RP11-624F4 from 2, complete sequence
          Length = 106905

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 8    ttacaagcatggcttctt 25
            ||||||||||||||||||
Sbjct: 6834 ttacaagcatggcttctt 6817
to top
>gb|AC084466.1|AC084466 Caenorhabditis briggsae cosmid CB041P18, complete sequence
          Length = 74747

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 18   ggcttcttcttctacttc 35
            ||||||||||||||||||
Sbjct: 8920 ggcttcttcttctacttc 8903
to top
>ref|XM_224784.3| PREDICTED: Rattus norvegicus tolloid-like (predicted)
            (Tll_predicted), mRNA
          Length = 3957

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 18   ggcttcttcttctacttc 35
            ||||||||||||||||||
Sbjct: 3741 ggcttcttcttctacttc 3724
to top
>gb|AC091492.2| Homo sapiens chromosome 3 clone RP11-335I9 map 3p, complete sequence
          Length = 180963

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    tcttcttctacttccact 39
             ||||||||||||||||||
Sbjct: 77143 tcttcttctacttccact 77160
to top
>dbj|AP006841.1| Bacteroides fragilis YCH46 DNA, complete genome
          Length = 5277274

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 17      tggcttcttcttctactt 34
               ||||||||||||||||||
Sbjct: 3446198 tggcttcttcttctactt 3446215
to top
>emb|AL117202.1|CEY47D3A Caenorhabditis elegans YAC Y47D3A, complete sequence
          Length = 199814

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 20     cttcttcttctacttcca 37
              ||||||||||||||||||
Sbjct: 102677 cttcttcttctacttcca 102694
to top
>gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, complete sequence
          Length = 192545

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 20     cttcttcttctacttcca 37
              ||||||||||||||||||
Sbjct: 149049 cttcttcttctacttcca 149032
to top
>emb|AL672249.6| Mouse DNA sequence from clone RP23-92P11 on chromosome X, complete
              sequence
          Length = 191671

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 11     caagcatggcttcttctt 28
              ||||||||||||||||||
Sbjct: 158445 caagcatggcttcttctt 158428
to top
>emb|AL831759.5| Mouse DNA sequence from clone RP23-150J13 on chromosome X, complete
             sequence
          Length = 29788

 Score = 36.2 bits (18), Expect = 8.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aagcatggcttcttcttc 29
             ||||||||||||||||||
Sbjct: 22820 aagcatggcttcttcttc 22803


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,263,083
Number of Sequences: 3902068
Number of extensions: 1263083
Number of successful extensions: 62914
Number of sequences better than 10.0: 80
Number of HSP's better than 10.0 without gapping: 80
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62736
Number of HSP's gapped (non-prelim): 178
length of query: 60
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 39
effective length of database: 17,151,101,840
effective search space: 668892971760
effective search space used: 668892971760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top