| Clone Name | baet51f09 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome | 42 | 0.58 | 2 | gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome | 40 | 2.3 | 3 | gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Canc... | 40 | 2.3 |
|---|
>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome Length = 5650368 Score = 42.1 bits (21), Expect = 0.58 Identities = 21/21 (100%) Strand = Plus / Plus Query: 35 caccgaagcaatccagatcga 55 ||||||||||||||||||||| Sbjct: 5374622 caccgaagcaatccagatcga 5374642
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 40.1 bits (20), Expect = 2.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 44 aatccagatcgagcaccccgagct 67 |||||||||||| ||||||||||| Sbjct: 3756468 aatccagatcgaacaccccgagct 3756445
>gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 216030 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 ctgctctgaccaccggagga 181 |||||||||||||||||||| Sbjct: 114095 ctgctctgaccaccggagga 114114 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 565,192 Number of Sequences: 3902068 Number of extensions: 565192 Number of successful extensions: 40209 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40152 Number of HSP's gapped (non-prelim): 57 length of query: 183 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 161 effective length of database: 17,147,199,772 effective search space: 2760699163292 effective search space used: 2760699163292 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)