ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet50h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK121590.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 3e-20
2gb|U37687.1|OSU37687 Oryza sativa polyubiquitin (Rubq1) mRNA, co... 105 3e-20
3emb|X76064.1|OSPOLUBI O.sativa rub1 mRNA for polyubiquitin 98 7e-18
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 96 3e-17
5gb|AF184279.1|AF184279 Oryza sativa polyubiquitin (RUBQ1) gene, ... 96 3e-17
6dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic D... 96 3e-17
7dbj|AP006454.3| Oryza sativa (japonica cultivar-group) genomic D... 96 3e-17
8dbj|AP005610.3| Oryza sativa (japonica cultivar-group) genomic D... 96 3e-17
9gb|BT016557.1| Zea mays clone Contig390 mRNA sequence 94 1e-16
10gb|AF361365.1| Oncorhynchus mykiss polyubiquitin mRNA, complete cds 94 1e-16
11gb|S82312.1|S82312S1 Zea mays polyubiquitin homolog mRNA, partia... 94 1e-16
12gb|AY103543.1| Zea mays PCO110026 mRNA sequence 94 1e-16
13gb|L41658.1|SCFPOLY Saccharum hybrid (clone SCUBI561) polyubiqui... 94 1e-16
14gb|AF148448.1|AF148448 Sporobolus stapfianus polyubiquitin mRNA,... 92 4e-16
15ref|XM_506723.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 7e-15
16ref|XM_464194.1| Oryza sativa (japonica cultivar-group), mRNA 88 7e-15
17gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complet... 88 7e-15
18gb|AC146016.2| Pan troglodytes BAC clone RP43-131D21 from 7, com... 88 7e-15
19ref|NG_001207.1| Homo sapiens ubiquitin A-52 residue ribosomal p... 88 7e-15
20dbj|AK101547.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 7e-15
21dbj|AK067024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 7e-15
22dbj|AK063441.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 7e-15
23dbj|AK061956.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 7e-15
24gb|U29162.1|ZMU29162 Zea mays clone MubG9 ubiquitin gene, comple... 88 7e-15
25gb|M62405.1|HUMUBA52A Human ubiquitin/52 residue ribosomal prote... 88 7e-15
26dbj|AB089616.1| Pongo pygmaeus UbC gene for polyubiquitin C, com... 86 3e-14
27ref|XM_527693.1| PREDICTED: Pan troglodytes similar to ubiquitin... 84 1e-13
28dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 1e-13
29gb|AF184280.1|AF184280 Oryza sativa polyubiquitin (RUBQ2) gene, ... 84 1e-13
30dbj|AP004126.4| Oryza sativa (japonica cultivar-group) genomic D... 84 1e-13
31gb|U77939.1|PVU77939 Phaseolus vulgaris ubiquitin-like protein m... 84 1e-13
32ref|XM_848237.1| PREDICTED: Canis familiaris similar to ubiquiti... 82 4e-13
33emb|AJ271129.1|PAB271129 Picea abies mRNA for putative polyubiqu... 82 4e-13
34gb|DQ252482.1| Solanum tuberosum clone 031C02 polyubiquitin-like... 82 4e-13
35gb|M22428.1|DROUBIA D.melanogaster ubiquitin protein gene, compl... 82 4e-13
36dbj|D83208.1|GPIUBIY Cavia cobaya mRNA for ubiquitin, complete cds 82 4e-13
37ref|XM_522865.1| PREDICTED: Pan troglodytes similar to ubiquitin... 80 2e-12
38ref|XM_528575.1| PREDICTED: Pan troglodytes similar to ubiquitin... 80 2e-12
39emb|AL354709.15| Human DNA sequence from clone RP11-145E5 on chr... 80 2e-12
40emb|X69422.1|AFTETUBI A.fatua mRNA for tetraubiquitin 80 2e-12
41gb|AC000049.11| Homo sapiens Chromosome 9p21 Cosmid Clone c86, c... 80 2e-12
42ref|NG_002524.1| Homo sapiens ubiquitin A-52 residue ribosomal p... 80 2e-12
43emb|Z11667.1|STUQ95 S.tuberosum mRNA for ubiquitin (partial) 80 2e-12
44emb|AL121579.4|CNS01DRX Human chromosome 14 DNA sequence BAC R-3... 80 2e-12
45dbj|AB060808.1| Homo sapiens gene for p16/CDKN2A, complete cds 80 2e-12
46ref|NM_202787.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); ... 78 7e-12
47ref|NM_178969.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); ... 78 7e-12
48ref|NM_116771.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); ... 78 7e-12
49ref|NM_178968.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); ... 78 7e-12
50ref|NM_116523.2| Arabidopsis thaliana UBQ14; protein binding AT4... 78 7e-12
51ref|NM_178960.1| Arabidopsis thaliana UBQ14; protein binding AT4... 78 7e-12
52gb|DQ216252.1| Taeniopygia guttata clone 0058P0005E02 ubiquitin ... 78 7e-12
53gb|DQ216236.1| Taeniopygia guttata clone 0058P0054D08 ubiquitin ... 78 7e-12
54gb|BT016596.1| Zea mays clone Contig429 mRNA sequence 78 7e-12
55gb|BT017660.1| Zea mays clone EL01N0440E11.c mRNA sequence 78 7e-12
56gb|BT000701.1| Arabidopsis thaliana clone RAFL08-11-A12 (R11186)... 78 7e-12
57gb|AY056295.1| Arabidopsis thaliana At4g05320 mRNA sequence 78 7e-12
58ref|XM_782408.1| PREDICTED: Strongylocentrotus purpuratus simila... 78 7e-12
59gb|AY139999.1| Arabidopsis thaliana polyubiquitin UBQ10 (At4g053... 78 7e-12
60gb|AF506969.1| Equus caballus ubiquitin mRNA, complete cds 78 7e-12
61gb|AY057500.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, co... 78 7e-12
62gb|AY052698.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, co... 78 7e-12
63gb|AY042884.1| Arabidopsis thaliana Unknown protein mRNA, comple... 78 7e-12
64emb|BX828380.1|CNS0A30T Arabidopsis thaliana Full-length cDNA Co... 78 7e-12
65gb|AC158180.2| Selaginella moellendorffii chromosome JGIASXY-5A1... 78 7e-12
66gb|AY087759.1| Arabidopsis thaliana clone 38261 mRNA, complete s... 78 7e-12
67dbj|AK177176.1| Mus musculus cDNA, clone:Y0G0101N24, strand:plus... 78 7e-12
68dbj|AB089614.1| Pan troglodytes UbC gene for polyubiquitin C, co... 78 7e-12
69gb|L05361.1|ATHUBQ10R Arabidopsis thaliana polyubiquitin (ubq10)... 78 7e-12
70ref|XM_473982.1| Oryza sativa (japonica cultivar-group), predic... 76 3e-11
71gb|DQ216241.1| Taeniopygia guttata clone 0058P0057E02 ubiquitin ... 76 3e-11
72gb|DQ216240.1| Taeniopygia guttata clone 0061P0001C12 ubiquitin ... 76 3e-11
73gb|DQ216239.1| Taeniopygia guttata clone 0058P0040D01 ubiquitin ... 76 3e-11
74gb|DQ216235.1| Taeniopygia guttata clone 0058P0048G02 ubiquitin ... 76 3e-11
75gb|BT016652.1| Zea mays clone Contig485 mRNA sequence 76 3e-11
76ref|XM_415847.1| PREDICTED: Gallus gallus similar to polyubiquit... 76 3e-11
77ref|XM_363356.1| Magnaporthe grisea 70-15 hypothetical protein (... 76 3e-11
78emb|Z24723.1|PCUBIQGNA P.chrysosporium ubiquitin gene, complete CDS 76 3e-11
79emb|X87156.1|APOLYUBIQ Acanthamoeba sp. 4b3 polyubiquitin gene 76 3e-11
80emb|X75628.1|ACUBIFUS A.castellanii mRNA for ubiquitin fusion pr... 76 3e-11
81emb|X67957.1|AMUBIQMRP A.majus mRNA for ubiquitin (partial) 76 3e-11
82emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin 76 3e-11
83emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin 76 3e-11
84emb|AJ697758.1| Eucalyptus globulus subsp. globulus partial mRNA... 76 3e-11
85gb|AC018992.6| Homo sapiens chromosome 8, clone RP11-468O2, comp... 76 3e-11
86dbj|AB168934.1| Macaca fascicularis testis cDNA, clone: QtsA-158... 76 3e-11
87gb|S94464.1| polyubiquitin [maize, Genomic, 3841 nt] 76 3e-11
88dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 76 3e-11
89gb|AC068228.8| Homo sapiens chromosome 8, clone RP11-539E17, com... 76 3e-11
90ref|NM_001009202.1| Ovis aries polyubiquitin (LOC443016), mRNA 76 3e-11
91gb|AF038129.1|AF038129 Ovis aries polyubiquitin mRNA, complete cds 76 3e-11
92gb|AY954394.1| Oryza sativa (japonica cultivar-group) polyubiqui... 76 3e-11
93gb|AC104430.3| Homo sapiens chromosome 8 clone RP11-391E1 map 8q... 76 3e-11
94emb|X02650.1|GGUBIQ Chicken mRNA for ubiquitin 76 3e-11
95dbj|AK102389.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 3e-11
96gb|AY104761.1| Zea mays PCO089720 mRNA sequence 76 3e-11
97gb|AY098526.1| Ananas comosus tetrameric ubiquitin mRNA, complet... 76 3e-11
98dbj|D12776.1|RICPOLYUBI Oryza sativa (japonica cultivar-group) m... 76 3e-11
99gb|U29159.1|ZMU29159 Zea mays clone MubG1 ubiquitin gene, comple... 76 3e-11
100emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4,... 76 3e-11
101gb|AF056625.1|AF056625 Magnaporthe grisea strain Guy-11 poly-ubi... 76 3e-11
102emb|Z49056.1|CJUBIQ C.jacchus mRNA for ubiquitin 76 3e-11
103gb|M11100.1|CHKUBHSP Chicken ubiquitin mRNA, from heat shocked e... 76 3e-11
104gb|M14693.1|CHKUB1A Chicken ubiquitin I (UbI) gene, partial cds 76 3e-11
105gb|DQ216253.1| Taeniopygia guttata clone 0058P0031B03 ubiquitin ... 74 1e-10
106gb|DQ216249.1| Taeniopygia guttata clone 0058P0031D03 ubiquitin ... 74 1e-10
107gb|DQ216247.1| Taeniopygia guttata clone 0058P0020E12 ubiquitin ... 74 1e-10
108gb|DQ216246.1| Taeniopygia guttata clone 0058P0016A01 ubiquitin ... 74 1e-10
109emb|CR693983.2|CNS0FYFF Tetraodon nigroviridis full-length cDNA 74 1e-10
110gb|AY118702.1| Drosophila melanogaster AT20865 full insert cDNA 74 1e-10
111gb|AC010047.8| Drosophila melanogaster 3L BAC RP98-28E17 (Roswel... 74 1e-10
112ref|NM_206272.1| Drosophila melanogaster Ubiquitin-63E CG11624-R... 74 1e-10
113ref|NM_168043.2| Drosophila melanogaster Ubiquitin-63E CG11624-R... 74 1e-10
114ref|NM_079185.4| Drosophila melanogaster Ubiquitin-63E CG11624-R... 74 1e-10
115gb|AE003479.3| Drosophila melanogaster chromosome 3L, section 13... 74 1e-10
116ref|NM_178970.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); ... 72 4e-10
117ref|NM_178961.1| Arabidopsis thaliana UBQ14; protein binding AT4... 72 4e-10
118gb|AC004044.1| Arabidopsis thaliana BAC T5J8 from chromosome IV,... 72 4e-10
119ref|XM_878714.1| PREDICTED: Bos taurus similar to ribosomal prot... 72 4e-10
120gb|BT012698.1| Lycopersicon esculentum clone 113569R, mRNA sequence 72 4e-10
121emb|Y17003.1|SDO17003 Suberites domuncula mRNA for polyubiquitin 72 4e-10
122emb|Y12081.1|SDPOLUBQ1 Suberites domuncula mRNA for polyubiquiti... 72 4e-10
123emb|AL161503.2|ATCHRIV15 Arabidopsis thaliana DNA chromosome 4, ... 72 4e-10
124emb|AL161495.2|ATCHRIV7 Arabidopsis thaliana DNA chromosome 4, c... 72 4e-10
125dbj|D28123.1|SOYSUBI3 Glycine max SUBI-3 gene for ubiquitin, com... 72 4e-10
126gb|BC102248.1| Bos taurus cDNA clone MGC:127041 IMAGE:7941775, c... 72 4e-10
127gb|AY842446.1| Bubalus bubalis ubiquitin/ribosomal fusion protei... 72 4e-10
128ref|NM_214211.1| Sus scrofa ubiquitin/ribosomal fusion protein (... 72 4e-10
129gb|AC012477.1|AC012477 Genomic Sequence For Arabidopsis thaliana... 72 4e-10
130gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana... 72 4e-10
131dbj|AK058319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 4e-10
132dbj|AB090878.1| Aster tripolium mRNA for polyubiquitin, complete... 72 4e-10
133gb|U72496.1|SSU72496 Sus scrofa ubiquitin/ribosomal fusion prote... 72 4e-10
134gb|L05394.1|ATHUBQ14G Arabidopsis thaliana polyubiquitin (ubq14)... 72 4e-10
135gb|AC152972.1| Oryza sativa (japonica cultivar-group) chromosome... 72 4e-10
136ref|NM_116744.2| Arabidopsis thaliana UBQ11 (UBIQUITIN 11); prot... 70 2e-09
137gb|AY819759.1| Homo sapiens ubiquitin C splice variant (UBC) mRN... 70 2e-09
138gb|BT016508.1| Zea mays clone Contig341 mRNA sequence 70 2e-09
139gb|BT018032.1| Zea mays clone EL01N0530D02.c mRNA sequence 70 2e-09
140gb|BC066197.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:76... 70 2e-09
141gb|AC123736.8| Mus musculus chromosome 3, clone RP23-478I18, com... 70 2e-09
142gb|BC080583.1| Homo sapiens cDNA clone IMAGE:2822684, partial cds 70 2e-09
143gb|BC019850.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:29... 70 2e-09
144gb|BC039193.1| Homo sapiens ubiquitin C, mRNA (cDNA clone MGC:14... 70 2e-09
145ref|NM_011664.2| Mus musculus ubiquitin B (Ubb), mRNA 70 2e-09
146gb|DQ473431.1| Anser anser breed Landoise polyubiquitin mRNA, co... 70 2e-09
147gb|AF285162.1| Mus musculus cell-line C3H/RV polyubiquitin C (Ub... 70 2e-09
148gb|AF285161.1| Mus musculus cell-line C3H/He polyubiquitin C (Ub... 70 2e-09
149ref|XR_004580.1| PREDICTED: Mus musculus gene model 1821, (NCBI)... 70 2e-09
150ref|XR_004579.1| PREDICTED: Mus musculus gene model 1821, (NCBI)... 70 2e-09
151ref|XR_001605.1| PREDICTED: Mus musculus gene model 1821, (NCBI)... 70 2e-09
152ref|XM_973010.1| PREDICTED: Mus musculus ubiquitin C (Ubc), mRNA 70 2e-09
153ref|XM_974638.1| PREDICTED: Mus musculus similar to polyubiquiti... 70 2e-09
154ref|XM_992219.1| PREDICTED: Mus musculus similar to polyubiquiti... 70 2e-09
155ref|XR_005158.1| PREDICTED: Mus musculus ubiquitin pseudogene (L... 70 2e-09
156gb|BC000449.2| Homo sapiens ubiquitin C, mRNA (cDNA clone IMAGE:... 70 2e-09
157gb|BC008955.2| Homo sapiens ubiquitin C, mRNA (cDNA clone IMAGE:... 70 2e-09
158gb|BC021837.1| Mus musculus ubiquitin C, mRNA (cDNA clone MGC:30... 70 2e-09
159gb|BC006680.1| Mus musculus ubiquitin C, mRNA (cDNA clone MGC:78... 70 2e-09
160gb|AC137844.8| Mus musculus, clone RP23-415L22, complete sequence 70 2e-09
161emb|Y17004.1|SDO17004 Suberites domuncula mRNA for monoubiquitin 70 2e-09
162gb|BC100341.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:11... 70 2e-09
163emb|AL596181.10| Mouse DNA sequence from clone RP23-234K24 on ch... 70 2e-09
164gb|DQ420617.1| Anser anser ubiquitin C II mRNA, complete cds 70 2e-09
165gb|DQ420616.1| Anser anser ubiquitin C I mRNA, complete cds 70 2e-09
166emb|CR621420.1| full-length cDNA clone CS0DE004YK08 of Placenta ... 70 2e-09
167dbj|AK097415.1| Homo sapiens cDNA FLJ40096 fis, clone TESTI20040... 70 2e-09
168dbj|AK056939.1| Homo sapiens cDNA FLJ32377 fis, clone SKMUS10000... 70 2e-09
169dbj|AK132747.1| Mus musculus adult male testis cDNA, RIKEN full-... 70 2e-09
170ref|NM_021009.3| Homo sapiens ubiquitin C (UBC), mRNA 70 2e-09
171dbj|AK165313.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 70 2e-09
172dbj|AK160683.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 70 2e-09
173dbj|AK168448.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 70 2e-09
174gb|AY057530.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, com... 70 2e-09
175gb|AY054281.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, com... 70 2e-09
176gb|AY052661.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, com... 70 2e-09
177dbj|AK013873.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 70 2e-09
178dbj|AK010625.1| Mus musculus ES cells cDNA, RIKEN full-length en... 70 2e-09
179dbj|AK010413.1| Mus musculus ES cells cDNA, RIKEN full-length en... 70 2e-09
180dbj|AK003190.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 70 2e-09
181dbj|AK088453.1| Mus musculus 2 days neonate thymus thymic cells ... 70 2e-09
182dbj|AK013027.1| Mus musculus 10, 11 days embryo whole body cDNA,... 70 2e-09
183dbj|AK012443.1| Mus musculus 11 days embryo whole body cDNA, RIK... 70 2e-09
184dbj|AK007273.1| Mus musculus adult male testis cDNA, RIKEN full-... 70 2e-09
185gb|AC126309.8| Homo sapiens 12 BAC RP11-592O2 (Roswell Park Canc... 70 2e-09
186dbj|AB071067.1| Macaca fascicularis testis cDNA clone:QtsA-16192... 70 2e-09
187ref|XM_579662.1| PREDICTED: Rattus norvegicus similar to polyubi... 70 2e-09
188gb|AY086967.1| Arabidopsis thaliana clone 3001 mRNA, complete se... 70 2e-09
189gb|BC093445.1| Homo sapiens cDNA clone IMAGE:5284302, partial cds 70 2e-09
190dbj|AB089615.1| Gorilla gorilla UbC gene for polyubiquitin C, co... 70 2e-09
191dbj|AB089613.1| Homo sapiens UbC gene for polyubiquitin C, compl... 70 2e-09
192dbj|AK098827.1| Homo sapiens cDNA FLJ25961 fis, clone TST09043, ... 70 2e-09
193dbj|AK026846.1| Homo sapiens cDNA: FLJ23193 fis, clone REC00306,... 70 2e-09
194dbj|AK129749.1| Homo sapiens cDNA FLJ26238 fis, clone CBR05440, ... 70 2e-09
195gb|AY104762.1| Zea mays PCO089719 mRNA sequence 70 2e-09
196gb|AC120412.12| Mus musculus chromosome 5, clone RP24-447P14, co... 70 2e-09
197ref|NR_002875.1| Mus musculus gene model 1821, (NCBI) (Gm1821) o... 70 2e-09
198dbj|D63782.1|CRUPUQ Cricetulus sp. gene for polyubiquitin, compl... 70 2e-09
199dbj|AB003732.1| Cricetulus griseus gene for polyubiquitin, compl... 70 2e-09
200dbj|AB003731.1| Cricetulus griseus gene for polyubiquitin, compl... 70 2e-09
201dbj|AB003730.1| Homo sapiens gene for polyubiquitin, complete cds 70 2e-09
202ref|NM_019639.3| Mus musculus ubiquitin C (Ubc), mRNA 70 2e-09
203dbj|AB209782.1| Homo sapiens mRNA for ubiquitin C variant protein 70 2e-09
204emb|X51703.1|MMUBIQU Mouse mRNA for ubiquitin 70 2e-09
205gb|M26880.1|HUMUBI13 Human ubiquitin mRNA, complete cds 70 2e-09
206gb|AC163692.4| Mus musculus BAC clone RP24-68H1 from chromosome ... 70 2e-09
207gb|L05362.1|ATHUBQB Arabidopsis thaliana (clone ubq11) polyubiqu... 70 2e-09
208dbj|AB025001.1| Cicer arietinum mRNA for polyubiquitin, partial cds 70 2e-09
209dbj|D63791.1|HUMPOLYUBI Human UbC gene for polyubiquitin, exon1-... 70 2e-09
210dbj|AB009010.1| Homo sapiens mRNA for polyubiquitin UbC, complet... 70 2e-09
211gb|DQ216251.1| Taeniopygia guttata clone 0063P0020H09 ubiquitin ... 68 6e-09
212gb|DQ216250.1| Taeniopygia guttata clone 0058P0027F01 ubiquitin ... 68 6e-09
213gb|DQ216248.1| Taeniopygia guttata clone 0058P0029E05 ubiquitin ... 68 6e-09
214gb|DQ216237.1| Taeniopygia guttata clone 0058P0020B09 ubiquitin ... 68 6e-09
215gb|DQ216234.1| Taeniopygia guttata clone 0058P0013A07 ubiquitin ... 68 6e-09
216gb|DQ216233.1| Taeniopygia guttata clone 0063P0008C04 ubiquitin ... 68 6e-09
217gb|DQ216232.1| Taeniopygia guttata clone 0058P0060G06 ubiquitin ... 68 6e-09
218gb|BT018987.1| Zea mays clone Contig444.F mRNA sequence 68 6e-09
219gb|BT016494.1| Zea mays clone Contig327 mRNA sequence 68 6e-09
220gb|BT016274.1| Zea mays clone Contig107 mRNA sequence 68 6e-09
221gb|AY751539.1| Cloning vector pHUE, complete sequence 68 6e-09
222gb|AF517839.1| Triticum aestivum ubiquitin protein mRNA, partial... 68 6e-09
223gb|BC070919.1| Rattus norvegicus polyubiquitin, mRNA (cDNA clone... 68 6e-09
224gb|BC060312.1| Rattus norvegicus polyubiquitin, mRNA (cDNA clone... 68 6e-09
225ref|NM_001033930.1| Homo sapiens ubiquitin A-52 residue ribosoma... 68 6e-09
226ref|NM_003333.3| Homo sapiens ubiquitin A-52 residue ribosomal p... 68 6e-09
227gb|AY563026.1| Ovis aries ubiqitin RPL40 fusion protein mRNA, co... 68 6e-09
228ref|XM_001001919.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
229ref|XM_001001949.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
230ref|XM_001001988.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
231ref|XM_001002029.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
232ref|XM_001002019.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
233ref|XM_001002053.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
234ref|XM_001002045.1| PREDICTED: Mus musculus ubiquitin C, transcr... 68 6e-09
235gb|DQ479851.1| Homo sapiens ubiquitin A-52 residue ribosomal pro... 68 6e-09
236emb|CR731853.1|CNS0GRN6 Tetraodon nigroviridis full-length cDNA 68 6e-09
237emb|CR730909.2|CNS0GQWY Tetraodon nigroviridis full-length cDNA 68 6e-09
238emb|CR729835.2|CNS0GQ35 Tetraodon nigroviridis full-length cDNA 68 6e-09
239emb|CR728830.2|CNS0GPB8 Tetraodon nigroviridis full-length cDNA 68 6e-09
240emb|CR725973.2|CNS0GN3V Tetraodon nigroviridis full-length cDNA 68 6e-09
241emb|CR725532.2|CNS0GMRM Tetraodon nigroviridis full-length cDNA 68 6e-09
242gb|BC008661.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:... 68 6e-09
243gb|BC025894.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:... 68 6e-09
244gb|BC036303.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:... 68 6e-09
245ref|XM_858590.1| PREDICTED: Canis familiaris similar to ubiquiti... 68 6e-09
246ref|XM_536651.2| PREDICTED: Canis familiaris similar to ubiquiti... 68 6e-09
247ref|XM_858547.1| PREDICTED: Canis familiaris similar to ubiquiti... 68 6e-09
248emb|CR685693.2|CNS0FS15 Tetraodon nigroviridis full-length cDNA 68 6e-09
249gb|BC062397.1| Rattus norvegicus cDNA clone IMAGE:5623273, **** ... 68 6e-09
250gb|BC019044.1| Homo sapiens cDNA clone IMAGE:4635339, **** WARNI... 68 6e-09
251gb|AF517849.1| Griffithsia japonica isolate Gj532 polyubiquitin ... 68 6e-09
252gb|AF517848.1| Griffithsia japonica isolate Gj526 polyubiquitin ... 68 6e-09
253emb|X92661.1|RNUBC5 R.norvegicus mRNA for polyubiquitin 5' end 68 6e-09
254emb|AJ416499.1|POS416499 Pleurotus ostreatus partial mRNA for pu... 68 6e-09
255emb|AJ415521.1|AST415521 Anopheles stephensi mRNA for anopheles ... 68 6e-09
256emb|AJ223328.1|NTAJ3328 Nicotiana tabacum TUQG2 gene, complete CDS 68 6e-09
257emb|AJ012552.1|VFA012552 Vicia faba mRNA for polyubiquitin 68 6e-09
258emb|CR857299.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2422 (from cl... 68 6e-09
259gb|AC113619.5| Drosophila melanogaster X BAC RP98-22D21 (Roswell... 68 6e-09
260emb|CR624915.1| full-length cDNA clone CS0DE004YN17 of Placenta ... 68 6e-09
261emb|CR605557.1| full-length cDNA clone CS0DI053YA13 of Placenta ... 68 6e-09
262gb|AC023710.5| Drosophila melanogaster X BAC RP98-19D3 (Roswell ... 68 6e-09
263gb|BC114001.1| Bos taurus polyubiquitin, mRNA (cDNA clone MGC:13... 68 6e-09
264ref|NM_132078.1| Drosophila melanogaster CG11700-RA (CG11700), mRNA 68 6e-09
265gb|DQ118117.1| Lupinus albus polyubiquitin mRNA, partial cds 68 6e-09
266gb|DQ393578.1| Metarhizium anisopliae polyubiquitin mRNA, comple... 68 6e-09
267gb|AF429430.1|AF429430 Olea europaea polyubiquitin OUB2 mRNA, co... 68 6e-09
268gb|AY857485.1| Suberites domuncula S27a-ubiquitin mRNA, complete... 68 6e-09
269gb|AY034031.1| Alstroemeria hybrid cultivar 'Samora' ubiquitin m... 68 6e-09
270dbj|AK010964.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 68 6e-09
271gb|U57603.1|GGU57603 Gallus gallus polyubiquitin (UbI) mRNA, par... 68 6e-09
272dbj|AK012427.1| Mus musculus 11 days embryo whole body cDNA, RIK... 68 6e-09
273gb|BC094012.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:... 68 6e-09
274ref|NM_017314.1| Rattus norvegicus ubiquitin C (Ubc), mRNA 68 6e-09
275gb|AF348700.1|AF348700 Homo sapiens ubiquitin A-52 residue ribos... 68 6e-09
276dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 68 6e-09
277gb|AY228477.1| Anas platyrhynchos polyubiquitin gene, partial cds 68 6e-09
278gb|AY228476.1| Anas platyrhynchos polyubiquitin gene, partial cds 68 6e-09
279emb|BX827035.1|CNS0A37F Arabidopsis thaliana Full-length cDNA Co... 68 6e-09
280gb|AY737055.1| Oreochromis mossambicus clone Contig17 ubiquitin ... 68 6e-09
281ref|NM_174133.2| Bos taurus polyubiquitin (LOC281370), mRNA 68 6e-09
282ref|NM_001009286.1| Ovis aries ubiqitin RPL40 fusion protein (OV... 68 6e-09
283gb|AF306645.1|AF306645 Scyliorhinus torazame ubiquitin mRNA, par... 68 6e-09
284gb|AF268174.1|AF268174 Bovine viral diarrhea virus type 2 strain... 68 6e-09
285ref|XM_579409.1| PREDICTED: Rattus norvegicus hypothetical gene ... 68 6e-09
286dbj|D10432.1|RICK37 Oryza sativa mRNA for ubiquitin (K37 gene), ... 68 6e-09
287dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic D... 68 6e-09
288dbj|AK176953.1| Mus musculus cDNA, clone:Y0G0101B17, strand:minu... 68 6e-09
289dbj|AP005515.3| Oryza sativa (japonica cultivar-group) genomic D... 68 6e-09
290gb|BC078726.1| Rattus norvegicus polyubiquitin, mRNA (cDNA clone... 68 6e-09
291gb|AY297059.1| Triticum aestivum ubiquitin (WUB1) mRNA, complete... 68 6e-09
292emb|Z54175.1|BVDTGACB1 Bovine viral diarrhea virus TGAC-B1 RNA 68 6e-09
293emb|Z54176.1|BVDCPA2 Bovine viral diarrhea virus cpA2 RNA 68 6e-09
294dbj|AB089618.1| Pongo pygmaeus UbB gene for polyubiquitin B, com... 68 6e-09
295gb|BC089218.1| Rattus norvegicus ubiquitin C, mRNA (cDNA clone I... 68 6e-09
296emb|X60390.1|CGPOLYUGE C.griseus gene for polyubiquitin 68 6e-09
297gb|AE003437.3| Drosophila melanogaster chromosome X, section 21 ... 68 6e-09
298dbj|AB099044.1| Bos taurus mRNA for similar to polyubiquitin, pa... 68 6e-09
299dbj|AB098957.1| Bos taurus mRNA for similar to ubiquitin/ribosom... 68 6e-09
300ref|NM_138895.1| Rattus norvegicus polyubiquitin (Ubb), mRNA 68 6e-09
301dbj|D16554.1|RATPOLYU Rattus norvegicus mRNA for polyubiquitin, ... 68 6e-09
302dbj|D17296.1|RATPILP Rattus norvegicus mRNA for polyubiquitin, c... 68 6e-09
303gb|AF093504.1|AF093504 Saccharum hybrid cultivar H32-8560 tetra-... 68 6e-09
304gb|AC005253.1|AC005253 Homo sapiens chromosome 19, cosmid R26445... 68 6e-09
305gb|BC101830.1| Homo sapiens ubiquitin A-52 residue ribosomal pro... 68 6e-09
306gb|BC103477.1| Rattus norvegicus ubiquitin C, mRNA (cDNA clone M... 68 6e-09
307gb|BC101832.1| Homo sapiens ubiquitin A-52 residue ribosomal pro... 68 6e-09
308gb|DQ104334.1| Morus mongolica ubiquitin monomer protein mRNA, c... 68 6e-09
309gb|BT001165.1| Arabidopsis thaliana Unknown protein (At4g02890) ... 68 6e-09
310gb|M11691.1|SYNMUSUBGA Synthetic beta-galactosidase/mouse ubiqui... 68 6e-09
311gb|M88684.1|AGLPOLYUBI Aglaothamnion neglectum ubiquitin mRNA, c... 68 6e-09
312emb|Z18245.1|BTPOLYUB Bos taurus gene for polyubiquitin 68 6e-09
313emb|X56999.1|HSUBA52P Human UbA52 placental mRNA for ubiquitin-5... 68 6e-09
314emb|X56998.1|HSUBA52A Human UbA52 adrenal mRNA for ubiquitin-52 ... 68 6e-09
315emb|X56997.1|HSUBA52G Human UbA52 gene coding for ubiquitin-52 a... 68 6e-09
316gb|L05399.1|ATH10POLU Arabidopsis thaliana polyubiquitin gene se... 68 6e-09
317gb|M62429.1|BOVPOUBA Bovine polyubiquitin mRNA, 3' end, clone rpub2 68 6e-09
318gb|AY748809.1| Stauracon pallidus polyubiquitin (UBQ) gene, part... 68 6e-09
319dbj|AB036698.1| Felis catus mRNA for ubiquitin, partial cds 68 6e-09
320ref|NM_129175.1| Arabidopsis thaliana protein binding / structur... 66 2e-08
321gb|DQ216245.1| Taeniopygia guttata clone 0065P0025D10 ubiquitin ... 66 2e-08
322emb|CR700205.2|CNS0G389 Tetraodon nigroviridis full-length cDNA 66 2e-08
323emb|CR692919.2|CNS0FXLV Tetraodon nigroviridis full-length cDNA 66 2e-08
324emb|Z24738.1|BRUBIRBPA B.rapa ubiquitin and ribosomal protein mR... 66 2e-08
325emb|Z11672.1|STUQ25 S.tuberosum mRNA for ubiquitin (partial) 66 2e-08
326gb|AF360311.1| Arabidopsis thaliana putative ubiquitin extension... 66 2e-08
327ref|NM_167065.1| Drosophila melanogaster CG32744-PA (CG32744) mR... 66 2e-08
328gb|AC007135.8| Arabidopsis thaliana chromosome 2 clone F9C22 map... 66 2e-08
329gb|AF061807.1| Elaeagnus umbellata polyubiquitin mRNA, complete cds 66 2e-08
330dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-08
331dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-08
332dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-08
333dbj|AK099513.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-08
334gb|AY104764.1| Zea mays PCO108118 mRNA sequence 66 2e-08
335dbj|D50527.1|MUSTI225D Mus musculus mRNA for TI-225, complete cds 66 2e-08
336gb|L21898.1|BRRUBIRIPL Brassica rapa ubiquitin/ribosomal protein... 66 2e-08
337gb|J05508.1|ATHUXP2A A.thaliana ubiquitin extension protein (UBQ... 66 2e-08
338gb|M33122.1|DROUBSI D.melanogaster ubiquitin gene, 5' end 66 2e-08
339gb|M33121.1|DROUBSH D.melanogaster ubiquitin gene, 5' end 66 2e-08
340gb|M33019.1|DROUBSG D.melanogaster ubiquitin gene, 5' end 66 2e-08
341gb|M33018.1|DROUBSF D.melanogaster ubiquitin gene, 5' end 66 2e-08
342gb|M33017.1|DROUBSE D.melanogaster ubiquitin gene, 5' end 66 2e-08
343gb|M33016.1|DROUBSD D.melanogaster ubiquitin gene, 5' end 66 2e-08
344gb|M33015.1|DROUBSC D.melanogaster ubiquitin gene, 5' end 66 2e-08
345gb|M33014.1|DROUBSB D.melanogaster ubiquitin gene, 5' end 66 2e-08
346gb|M33013.1|DROUBSA D.melanogaster ubiquitin gene, 5' end 66 2e-08
347gb|M37610.1|DROPOLAG D.melanogaster polytene gene, partial cds 66 2e-08
348gb|M37609.1|DROPOLAF D.melanogaster polytene gene, partial cds 66 2e-08
349ref|NM_001036508.1| Arabidopsis thaliana UBQ11 (UBIQUITIN 11); p... 64 1e-07
350ref|XM_520690.1| PREDICTED: Pan troglodytes similar to ubiquitin... 64 1e-07
351ref|NM_018955.2| Homo sapiens ubiquitin B (UBB), mRNA 64 1e-07
352gb|BC038999.1| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:47... 64 1e-07
353gb|BT020104.1| Homo sapiens ubiquitin B mRNA, complete cds 64 1e-07
354gb|AC137606.2| Oryza sativa (japonica cultivar-group) chromosome... 64 1e-07
355gb|BC046123.2| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:57... 64 1e-07
356gb|BC031027.1| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:32... 64 1e-07
357gb|BC000379.2| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:83... 64 1e-07
358gb|BC026301.1| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:24... 64 1e-07
359gb|BC070367.1| Homo sapiens cDNA clone IMAGE:6618390, containing... 64 1e-07
360gb|AY522603.1| Oreochromis mossambicus ubiquitin precursor-like ... 64 1e-07
361gb|BC021067.1| Homo sapiens cDNA clone IMAGE:3510175, **** WARNI... 64 1e-07
362emb|X73156.1|LEPUR L.esculentum polyubiquitin repeats 64 1e-07
363emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, ... 64 1e-07
364dbj|AP006335.1| Lotus japonicus genomic DNA, chromosome 3, clone... 64 1e-07
365dbj|AK127995.1| Homo sapiens cDNA FLJ46113 fis, clone TESTI20362... 64 1e-07
366emb|CR620731.1| full-length cDNA clone CS0DF038YI22 of Fetal bra... 64 1e-07
367emb|CR607481.1| full-length cDNA clone CS0DN001YF11 of Adult bra... 64 1e-07
368emb|CR590697.1| full-length cDNA clone CS0DE002YC17 of Placenta ... 64 1e-07
369emb|CR589965.1| full-length cDNA clone CS0DF011YA08 of Fetal bra... 64 1e-07
370gb|AC093484.2| Homo sapiens chromosome , clone RP11-138I1, compl... 64 1e-07
371ref|NG_002285.1| Homo sapiens ubiquitin B pseudogene 4 (UBBP4) o... 64 1e-07
372dbj|AK004727.1| Mus musculus adult male lung cDNA, RIKEN full-le... 64 1e-07
373dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 64 1e-07
374dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 64 1e-07
375gb|AC138761.4| Homo sapiens chromosome 17, clone RP11-1109M24, c... 64 1e-07
376gb|AY099138.1| Cercomonas edax isolate pub10 polyubiquitin gene,... 64 1e-07
377gb|AY099137.1| Cercomonas edax isolate pub9 polyubiquitin gene, ... 64 1e-07
378gb|AY099136.1| Cercomonas edax isolate pub8 polyubiquitin gene, ... 64 1e-07
379gb|AY099135.1| Cercomonas edax isolate pub7 polyubiquitin gene, ... 64 1e-07
380gb|AY099134.1| Cercomonas edax isolate pub6 polyubiquitin gene, ... 64 1e-07
381gb|AY099133.1| Cercomonas edax isolate pub5 polyubiquitin gene, ... 64 1e-07
382gb|AY099130.1| Cercomonas edax isolate pub2 polyubiquitin gene, ... 64 1e-07
383dbj|AP004568.3| Oryza sativa (japonica cultivar-group) genomic D... 64 1e-07
384gb|AY891423.1| Synthetic construct Homo sapiens clone FLH017070.... 64 1e-07
385gb|AY888785.1| Synthetic construct Homo sapiens clone FLH017074.... 64 1e-07
386gb|AY888190.1| Synthetic construct Homo sapiens clone FLH021788.... 64 1e-07
387dbj|AB089617.1| Homo sapiens UbB gene for polyubiquitin B, compl... 64 1e-07
388dbj|AP004656.3| Oryza sativa (japonica cultivar-group) genomic D... 64 1e-07
389dbj|AK129498.1| Homo sapiens cDNA FLJ25987 fis, clone CBR05488, ... 64 1e-07
390gb|BC015127.1| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:24... 64 1e-07
391gb|BC009301.2| Homo sapiens ubiquitin B, mRNA (cDNA clone MGC:16... 64 1e-07
392gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4 64 1e-07
393dbj|AB098769.1| Bos taurus mRNA for similar to polyubiquitin, pa... 64 1e-07
394dbj|D16248.1|SOYUBI Glycine max Subi-1 gene for ubiquitin, compl... 64 1e-07
395gb|AC087575.11| Homo sapiens chromosome 17, clone RP11-305L6, co... 64 1e-07
396gb|U26831.1|STU26831 Solanum tuberosum polyubiquitin gene, promo... 64 1e-07
397emb|AL356460.3|HS84M10 Homo sapiens chromosome 17 from PAC 84M10... 64 1e-07
398emb|X07499.1|HSUBBP Homo sapiens UBBP4 pseudogene for ubiquitin UBB 64 1e-07
399emb|X04803.2|HSYUBG1 Homo sapiens ubiquitin gene 64 1e-07
400gb|M87812.1|BVDMSEQH Bovine viral diarrhea virus mRNA sequence 64 1e-07
401gb|M62431.1|BVDCP1 Bovine viral diarrhea virus CP1 putative helc... 64 1e-07
402gb|AC125495.4| Oryza sativa (japonica cultivar-group) chromosome... 62 4e-07
403ref|XM_514202.1| PREDICTED: Pan troglodytes similar to ubiquitin... 62 4e-07
404ref|XM_415105.1| PREDICTED: Gallus gallus ubiquitin (LOC396190),... 62 4e-07
405ref|XM_586525.2| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
406ref|XM_874972.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
407ref|XM_874894.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
408ref|XM_875774.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
409ref|XM_874811.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
410ref|XM_874725.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
411ref|XM_874640.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
412ref|XM_875701.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
413ref|XM_875631.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
414ref|XM_875556.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
415ref|XM_875261.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
416ref|XM_875198.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
417ref|XM_875130.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
418ref|XM_875488.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
419ref|XM_875413.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
420ref|XM_875335.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
421ref|XM_874550.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
422ref|XM_874473.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
423ref|XM_874390.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
424ref|XM_874317.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
425ref|XM_874230.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
426ref|XM_874142.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
427ref|XM_874048.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
428ref|XM_873963.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
429ref|XM_873860.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
430ref|XM_864638.1| PREDICTED: Bos taurus polyubiquitin, transcript... 62 4e-07
431ref|NM_200502.1| Danio rerio zgc:66168 (zgc:66168), mRNA 62 4e-07
432gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 62 4e-07
433ref|XM_755610.1| Ustilago maydis 521 hypothetical protein (UM045... 62 4e-07
434ref|XM_566660.1| Cryptococcus neoformans var. neoformans JEC21 u... 62 4e-07
435ref|XM_847471.1| PREDICTED: Canis familiaris similar to ubiquiti... 62 4e-07
436gb|BC014880.1| Homo sapiens ubiquitin C, mRNA (cDNA clone IMAGE:... 62 4e-07
437gb|BC049478.1| Danio rerio zgc:66168, mRNA (cDNA clone IMAGE:591... 62 4e-07
438gb|AC099535.2| Homo sapiens chromosome 3 clone RP11-2G22, comple... 62 4e-07
439emb|X17020.1|PISUMPUI Pea PU1 gene mRNA for polyubiquitin 62 4e-07
440emb|X64344.1|PCCUBI41 P.crispum mRNA Pcubi4-1 for polyubiquitin 62 4e-07
441emb|AL117514.1|HSM801035 Homo sapiens mRNA; cDNA DKFZp434K0435 (... 62 4e-07
442emb|BX324134.11| Zebrafish DNA sequence from clone DKEY-103K8 in... 62 4e-07
443emb|CR848813.6| Zebrafish DNA sequence from clone DKEY-260J20 in... 62 4e-07
444gb|BC055524.1| Danio rerio zgc:66168, mRNA (cDNA clone MGC:66168... 62 4e-07
445gb|AF429429.1|AF429429 Olea europaea polyubiquitin OUB1 mRNA, co... 62 4e-07
446gb|L81140.1| Pisum sativum (Alaska) ubiquitin (PUB2) gene, compl... 62 4e-07
447ref|NR_002856.1| Mus musculus ubiquitin pseudogene (LOC218963) o... 62 4e-07
448dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 62 4e-07
449gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 62 4e-07
450gb|U75407.1|RNU75407 Rattus norvegicus polyubiquitin mRNA, parti... 62 4e-07
451gb|AC137675.2| Homo sapiens chromosome 3 clone RP11-358O21, comp... 62 4e-07
452emb|X58195.1|GGPOUBII G.gallus DNA for polyubiquitin gene Ub II 62 4e-07
453dbj|AB111967.1| Bovine viral diarrhea virus T-20 gene for porypr... 62 4e-07
454dbj|AB111966.1| Bovine viral diarrhea virus 190cp gene for poryp... 62 4e-07
455dbj|AK108207.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 4e-07
456gb|AF104029.1|AF104029 Bovine viral diarrhea virus-2 subgenome D... 62 4e-07
457gb|AF104028.1|AF104028 Bovine viral diarrhea virus-2 subgenome D... 62 4e-07
458gb|AF104026.1|AF104026 Bovine viral diarrhea virus-2 subgenome D... 62 4e-07
459gb|AF104025.1|AF104025 Bovine viral diarrhea virus-2 subgenome C... 62 4e-07
460gb|AF104024.1|AF104024 Bovine viral diarrhea virus-2 subgenome C... 62 4e-07
461gb|AF104023.1|AF104023 Bovine viral diarrhea virus-2 subgenome C... 62 4e-07
462gb|AF104022.1|AF104022 Bovine viral diarrhea virus-2 subgenome C... 62 4e-07
463gb|AF104021.1|AF104021 Bovine viral diarrhea virus-2 subgenome C... 62 4e-07
464gb|AF104020.1|AF104020 Bovine viral diarrhea virus-2 subgenome B... 62 4e-07
465gb|AF104019.1|AF104019 Bovine viral diarrhea virus-2 subgenome A... 62 4e-07
466emb|X08013.1|CSUBIQ Chinese hamster mRNA for ubiquitin 62 4e-07
467dbj|AB099083.1| Bos taurus mRNA for similar to polyubiquitin, pa... 62 4e-07
468gb|AF052164.1|AF052164 Homo sapiens clone 24683 mRNA sequence 62 4e-07
469gb|U86599.1|PTU86599 Pestivirus type 1 cytopathic genomic RNA, c... 62 4e-07
470gb|L13783.1|BVDP125A Bovine viral diarrhea virus p125 protein ge... 62 4e-07
471gb|M87811.1|BVDMSEQG Bovine viral diarrhea virus mRNA sequence 62 4e-07
472gb|M17597.1|HUMUB Human poly-ubiquitin mRNA, complete cds 62 4e-07
473gb|M62428.1|BOVPOUB Bovine polyubiquitin mRNA, 3' end, clone rpub1 62 4e-07
474ref|XM_478155.1| Oryza sativa (japonica cultivar-group), mRNA 60 2e-06
475gb|AY732488.1| Homo sapiens ubiquitin C splice variant (UBC) mRN... 60 2e-06
476gb|BT016665.1| Zea mays clone Contig498 mRNA sequence 60 2e-06
477gb|BT016436.1| Zea mays clone Contig269 mRNA sequence 60 2e-06
478gb|BT016403.1| Zea mays clone Contig236 mRNA sequence 60 2e-06
479gb|AY433571.1| Aedes aegypti ASAP ID: 38413 cytosolic large ribo... 60 2e-06
480gb|BC074147.1| Xenopus laevis MGC81889 protein, mRNA (cDNA clone... 60 2e-06
481ref|XM_323905.1| Neurospora crassa OR74A hypothetical protein ( ... 60 2e-06
482ref|XM_950851.1| Neurospora crassa OR74A hypothetical protein ( ... 60 2e-06
483gb|AY478418.1| Clusia minor polyubiquitin (Ubq1) mRNA, partial cds 60 2e-06
484ref|XM_001001910.1| PREDICTED: Mus musculus ubiquitin C, transcr... 60 2e-06
485ref|XM_753127.1| Ustilago maydis 521 hypothetical protein (UM020... 60 2e-06
486ref|XM_755642.1| Ustilago maydis 521 hypothetical protein (UM045... 60 2e-06
487ref|XM_388944.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 60 2e-06
488gb|AY456195.1| Helicoverpa armigera ubiquitin mRNA, partial cds 60 2e-06
489emb|CR734606.2|CNS0GTLP Tetraodon nigroviridis full-length cDNA 60 2e-06
490emb|CR734308.2|CNS0GTDF Tetraodon nigroviridis full-length cDNA 60 2e-06
491emb|CR658596.2|CNS0F756 Tetraodon nigroviridis full-length cDNA 60 2e-06
492emb|CR657614.2|CNS0F6DW Tetraodon nigroviridis full-length cDNA 60 2e-06
493emb|CR734033.2|CNS0GT5S Tetraodon nigroviridis full-length cDNA 60 2e-06
494emb|CR733056.2|CNS0GSJ4 Tetraodon nigroviridis full-length cDNA 60 2e-06
495emb|CR732801.2|CNS0GSD6 Tetraodon nigroviridis full-length cDNA 60 2e-06
496emb|CR732664.2|CNS0GS9P Tetraodon nigroviridis full-length cDNA 60 2e-06
497emb|CR732511.2|CNS0GS5G Tetraodon nigroviridis full-length cDNA 60 2e-06
498emb|CR732470.2|CNS0GS4B Tetraodon nigroviridis full-length cDNA 60 2e-06
499emb|CR732546.1|CNS0GS6F Tetraodon nigroviridis full-length cDNA 60 2e-06
500emb|CR732158.2|CNS0GRVN Tetraodon nigroviridis full-length cDNA 60 2e-06

>dbj|AK121590.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037P03, full
           insert sequence
          Length = 1983

 Score =  105 bits (53), Expect = 3e-20
 Identities = 56/57 (98%)
 Strand = Plus / Plus

                                                                    
Query: 63  tctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 65  tctcaagatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggt 121



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 756 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 805



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 1212 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggt 1261



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||| || |||||||| || || ||||||||||| ||||| |||||
Sbjct: 1439 gatgcagatattcgtgaagaccctgactggcaagaccattacccttgaggt 1489



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || || |||||||||||||| || |||||
Sbjct: 984  atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggt 1033



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 528 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 577



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 300 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 349



to top

>gb|U37687.1|OSU37687 Oryza sativa polyubiquitin (Rubq1) mRNA, complete cds
          Length = 1679

 Score =  105 bits (53), Expect = 3e-20
 Identities = 56/57 (98%)
 Strand = Plus / Plus

                                                                    
Query: 63  tctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 47  tctcaagatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggt 103



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 738 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 787



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 1193 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 1243



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 965  gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 1015



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || |||||||||||||||||||||||
Sbjct: 510 atgcagatcttcgtcaagaccttgactggcaagaccatcaccctcgaggt 559



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 282 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 331



to top

>emb|X76064.1|OSPOLUBI O.sativa rub1 mRNA for polyubiquitin
          Length = 1673

 Score = 97.6 bits (49), Expect = 7e-18
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 63  tctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 38  tctcaagatgcagatctttgtgaagaccctcacgggcaagaccatcaccctcgaggt 94



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 729 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 778



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 1184 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 1234



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 957  atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggt 1006



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 501 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 550



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 273 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 322



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                    
Query: 68       agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                |||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 28018930 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggt 28018981



 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Minus

                                                                    
Query: 68       agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                |||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 27575676 agatgcagatctttgtgaagacactcactggcaagaccatcaccctcgaggt 27575625



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 28019616 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 28019665



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                   
Query: 69       gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 28020299 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 28020349



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 28020072 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggt 28020121



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 26202053 atgcagatcttcgtgaagacgctgacggggaagaccatcactctcgaggt 26202102



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| || ||||| || || |||||||||||||| || |||||
Sbjct: 28019844 atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggt 28019893



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 28019388 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 28019437



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 28019160 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 28019209



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 4      catccgatccaatccaatccaatcca 29
              ||||| ||||||||||||||||||||
Sbjct: 480166 catcctatccaatccaatccaatcca 480141



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                         
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcac 110
                ||||||||||||||||||||  | || || |||||||||||
Sbjct: 27575446 atgcagatctttgtgaagaccttgacaggaaagaccatcac 27575406



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 5      atccgatccaatccaatccaatcca 29
              |||| ||||||||||||||||||||
Sbjct: 480160 atccaatccaatccaatccaatcca 480136



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 10      atccaatccaatccaatcca 29
               ||||||||||||||||||||
Sbjct: 4216061 atccaatccaatccaatcca 4216042



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 10      atccaatccaatccaatcca 29
               ||||||||||||||||||||
Sbjct: 4047480 atccaatccaatccaatcca 4047499



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 10      atccaatccaatccaatcca 29
               ||||||||||||||||||||
Sbjct: 1760990 atccaatccaatccaatcca 1761009



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 5      atccgatccaatccaatccaatcc 28
              |||| |||||||||||||||||||
Sbjct: 480155 atccaatccaatccaatccaatcc 480132



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 5       atccgatccaatccaatccaatc 27
               |||| ||||||||||||||||||
Sbjct: 4216061 atccaatccaatccaatccaatc 4216039



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 5       atccgatccaatccaatccaatc 27
               |||| ||||||||||||||||||
Sbjct: 4047480 atccaatccaatccaatccaatc 4047502



to top

>gb|AF184279.1|AF184279 Oryza sativa polyubiquitin (RUBQ1) gene, complete cds
          Length = 3184

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1700 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggt 1751



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 2386 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 2435



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 2841 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 2891



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 2614 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggt 2663



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || |||||  | || |||||||||||||||||||||||
Sbjct: 2158 atgcagatcttcgtcaagaccttgactggcaagaccatcaccctcgaggt 2207



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 1930 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 1979



to top

>dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0547F09
          Length = 140615

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 63749 agatgcagatctttgtgaagaccctcaccggcaagaccatcaccctcgaggt 63800



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 64435 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 64484



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                
Query: 69    gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||| |||||||| || || ||||||||||| ||||| |||||
Sbjct: 65118 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggt 65168



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 64891 atgcagatcttcgtcaagaccctgaccggcaagaccatcacgcttgaggt 64940



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| || ||||| || || |||||||||||||| || |||||
Sbjct: 64663 atgcagatcttcgtcaagaccctgactggcaagaccatcacacttgaggt 64712



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 64207 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 64256



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| || |||||  | || ||||||||||||||||| |||||
Sbjct: 63979 atgcagatcttcgtcaagaccttgactggcaagaccatcacccttgaggt 64028



to top

>dbj|AP006454.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1472F02
          Length = 55065

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 17370 agatgcagatctttgtgaagacactcactggcaagaccatcaccctcgaggt 17319



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcac 110
             ||||||||||||||||||||  | || || |||||||||||
Sbjct: 17140 atgcagatctttgtgaagaccttgacaggaaagaccatcac 17100



to top

>dbj|AP005610.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0032M14
          Length = 146636

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 51/52 (98%)
 Strand = Plus / Minus

                                                                  
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 145234 agatgcagatctttgtgaagacactcactggcaagaccatcaccctcgaggt 145183



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcac 110
              ||||||||||||||||||||  | || || |||||||||||
Sbjct: 145004 atgcagatctttgtgaagaccttgacaggaaagaccatcac 144964



to top

>gb|BT016557.1| Zea mays clone Contig390 mRNA sequence
          Length = 981

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 35  tcaagatgcagatctttgtgaagaccctcaccggcaagactatcaccctcgaggt 89



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||  | || |||||||| |||||||| |||||
Sbjct: 496 atgcagatctttgtcaagaccttgactggcaagacaatcacccttgaggt 545



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||  | || |||||||| |||||||| |||||
Sbjct: 268 atgcagatctttgtcaagaccttgactggcaagacaatcacccttgaggt 317



to top

>gb|AF361365.1| Oncorhynchus mykiss polyubiquitin mRNA, complete cds
          Length = 1162

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 52  tcaagatgcagatctttgtgaagacacttaccggcaagaccatcaccctggaggt 106



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 741 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggt 790



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 513 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggt 562



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 285 atgcagatcttcgtgaagacccttaccggcaagaccatcaccctggaggt 334



to top

>gb|S82312.1|S82312S1 Zea mays polyubiquitin homolog mRNA, partial cds
          Length = 199

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 80  tcaagatgcagatctttgtgaagaccctcaccggcaagactatcaccctcgaggt 134



to top

>gb|AY103543.1| Zea mays PCO110026 mRNA sequence
          Length = 1623

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 120 tcaagatgcagatctttgtgaagaccctcaccggcaagactatcaccctcgaggt 174



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||  | || ||||||||||| ||||| |||||
Sbjct: 1037 atgcagatctttgtgaagaccttgactggcaagaccataaccctggaggt 1086



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 809 atgcagatcttcgtgaagacattgactggcaagaccatcacc 850



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || || |||||||||||||| || |||||
Sbjct: 581 atgcagatctttgtgaaaacccttactggcaagaccatcactcttgaggt 630



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||  | || |||||||| |||||||| |||||
Sbjct: 353 atgcagatctttgtcaagaccttgactggcaagacaatcacccttgaggt 402



to top

>gb|L41658.1|SCFPOLY Saccharum hybrid (clone SCUBI561) polyubiquitin mRNA, complete cds
          Length = 1187

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 66  tcaagatgcagatctttgtgaagaccctcaccggcaagactatcaccctcgaggt 120



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||| |||||||| |||||
Sbjct: 299 atgcagatctttgtgaagacccttactggcaagacgatcacccttgaggt 348



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || |||||||| |||||||| |||||
Sbjct: 527 atgcagatcttcgtgaagacccttactggcaagacgatcacccttgaggt 576



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccat 107
           ||||||||||||||||||||  | || |||||||||||
Sbjct: 755 atgcagatctttgtgaagaccttgactggcaagaccat 792



to top

>gb|AF148448.1|AF148448 Sporobolus stapfianus polyubiquitin mRNA, complete cds
          Length = 1423

 Score = 91.7 bits (46), Expect = 4e-16
 Identities = 55/58 (94%)
 Strand = Plus / Plus

                                                                     
Query: 62  ctctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||
Sbjct: 58  ctctcaagatgcagatcttcgtaaagaccctcaccggcaagaccatcaccctcgaggt 115



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 750 atgcagatctttgtgaagaccctcaccggcaagaccatcacccttgaggt 799



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| |||||||||||||||||||| || |||||
Sbjct: 522 atgcagatcttcgtgaagaccctcaccggcaagaccatcacgcttgaggt 571



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| |||||||||||||||||||| || |||||
Sbjct: 294 atgcagatcttcgtgaagaccctcaccggcaagaccatcacgcttgaggt 343



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||| ||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 978  atgcagatttttgtcaagaccctcactggcaagaccatcaccctggaggt 1027



to top

>ref|XM_506723.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ9003_G05.28
           mRNA
          Length = 1642

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 77  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 132



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 539 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 588



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 995  atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 1044



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 767 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 816



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 311 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 360



to top

>ref|XM_464194.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1640

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 74  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 129



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 536 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 585



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 992  atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 1041



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 764 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 813



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 308 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 357



to top

>gb|AC005165.1| Homo sapiens BAC clone CTA-242H14 from 7, complete sequence
          Length = 155164

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 26804 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccctcgaggt 26753



to top

>gb|AC146016.2| Pan troglodytes BAC clone RP43-131D21 from 7, complete sequence
          Length = 169393

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 79462 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccctcgaggt 79411



to top

>ref|NG_001207.1| Homo sapiens ubiquitin A-52 residue ribosomal protein fusion
           product 1 pseudogene 1 (UBA52P1) on chromosome 7
          Length = 675

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 110 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccctcgaggt 161



to top

>dbj|AK101547.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048M20, full
           insert sequence
          Length = 1642

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 77  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 132



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 539 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 588



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 995  atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 1044



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 767 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 816



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 311 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 360



to top

>dbj|AK067024.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091J24, full
           insert sequence
          Length = 1189

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 77  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 132



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 539 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 588



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 767 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 816



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 311 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 360



to top

>dbj|AK063441.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-E12, full
           insert sequence
          Length = 1642

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 74  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 129



to top

>dbj|AK061956.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F08, full
           insert sequence
          Length = 1640

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 53/56 (94%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 74  ctcaagatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 129



 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 536 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 585



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 992  atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 1041



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 764 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 813



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 308 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 357



to top

>gb|U29162.1|ZMU29162 Zea mays clone MubG9 ubiquitin gene, complete cds
          Length = 2913

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 1223 agatgcagatctttgtgaagaccctcaccggcaagactatcaccctcgaggt 1274



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||  | || ||||||||||| ||||| |||||
Sbjct: 2137 atgcagatctttgtgaagaccttgactggcaagaccataaccctggaggt 2186



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            ||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 1909 atgcagatcttcgtgaagacattgactggcaagaccatcacc 1950



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || || |||||||||||||| || |||||
Sbjct: 1681 atgcagatctttgtgaaaacccttactggcaagaccatcactcttgaggt 1730



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| |||||  | || |||||||| |||||||| |||||
Sbjct: 1453 atgcagatctttgtcaagaccttgactggcaagacaatcacccttgaggt 1502



to top

>gb|M62405.1|HUMUBA52A Human ubiquitin/52 residue ribosomal protein fusion gene, complete
           sequence
          Length = 948

 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 355 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccctcgaggt 406



to top

>dbj|AB089616.1| Pongo pygmaeus UbC gene for polyubiquitin C, complete cds
          Length = 2286

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||||||||| |||||||||||||||||||||||
Sbjct: 1824 gatgcagatcttcgtgaagacactcactggcaagaccatcaccctcgaggt 1874



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 2052 gatgcagatcttcgtgaagaccctgacaggcaagaccatcaccctcgaggt 2102



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||||||||| |||||||| |||||||| |||||
Sbjct: 1368 gatgcagatcttcgtgaagacactcactggcaagactatcacccttgaggt 1418



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 228 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggt 278



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1646



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 506



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           |||||||||||| |||||||| || || ||||||||||| ||||| ||||||||
Sbjct: 912 gatgcagatcttcgtgaagaccctgactggcaagaccattacccttgaggtaga 965



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 50



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1140 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1190



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || |||||||||||||| || |||||
Sbjct: 684 gatgcagatcttcgtgaagaccctgactggcaagaccatcactcttgaggt 734



to top

>ref|XM_527693.1| PREDICTED: Pan troglodytes similar to ubiquitin A-52 residue
           ribosomal protein fusion product 1 (LOC472318), mRNA
          Length = 486

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| |||||||||||||||||||||||
Sbjct: 1   atgcagatctttgtgaagaccctcacaggcaagaccatcaccctcgaggt 50



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                 
Query: 70      atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
               |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 3341559 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 3341510



 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                   
Query: 68      agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
               ||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 3342017 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 3341966



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                 
Query: 70      atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
               ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 3341331 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 3341282



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                 
Query: 70      atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
               |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 3341103 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 3341054



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                 
Query: 70      atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
               |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 3341787 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 3341738



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 8        cgatccaatccaatccaatcca 29
                ||||||||||||||||||||||
Sbjct: 22912083 cgatccaatccaatccaatcca 22912062



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 5       atccgatccaatccaatccaatcca 29
               |||| ||||||||||||||||||||
Sbjct: 4364973 atccaatccaatccaatccaatcca 4364997



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 10       atccaatccaatccaatcca 29
                ||||||||||||||||||||
Sbjct: 33641067 atccaatccaatccaatcca 33641086



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 10       atccaatccaatccaatcca 29
                ||||||||||||||||||||
Sbjct: 33460710 atccaatccaatccaatcca 33460729



to top

>gb|AF184280.1|AF184280 Oryza sativa polyubiquitin (RUBQ2) gene, complete cds
          Length = 4442

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 3242 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 3291



 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 2784 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 2835



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 3698 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 3747



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 3470 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 3519



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 3014 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 3063



to top

>dbj|AP004126.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ9003_G05
          Length = 141860

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 90419 atgcagatctttgtcaagacactgaccggcaagaccatcaccctcgaggt 90370



 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||||||||||||||| | ||||||||||| ||||||||||||||
Sbjct: 90877 agatgcagatctttgtgaagacattgaccggcaagactatcaccctcgaggt 90826



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 90191 atgcaaatcttcgtgaagactctgaccggcaagaccatcaccctcgaggt 90142



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||| ||||| ||||| ||||||||||||||||| |||||
Sbjct: 89963 atgcagatctttgtcaagaccctcacaggcaagaccatcaccctggaggt 89914



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||| ||||| || ||||||||||| |||||||| |||||
Sbjct: 90647 atgcagatctttgtcaagactctgaccggcaagactatcacccttgaggt 90598



to top

>gb|U77939.1|PVU77939 Phaseolus vulgaris ubiquitin-like protein mRNA, complete cds
          Length = 1399

 Score = 83.8 bits (42), Expect = 1e-13
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || ||||||||||||||||||||||||||
Sbjct: 584 atgcagatctttgtgaagactcttaccggcaagaccatcaccctcgaggt 633



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || ||||| |||||||||||||| |||||
Sbjct: 356 atgcagatctttgtgaagactcttaccggaaagaccatcacccttgaggt 405



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 70  atgcagatctttgtgaagacactcaccggcaagac 104
           |||||||||||||||||||| ||||| || |||||
Sbjct: 812 atgcagatctttgtgaagaccctcactggtaagac 846



to top

>ref|XM_848237.1| PREDICTED: Canis familiaris similar to ubiquitin C (LOC610695),
           mRNA
          Length = 501

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 71  tgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 59  tgcagatctttgtgaagaccctcaccggcaagaccatgaccctcgaggt 107



to top

>emb|AJ271129.1|PAB271129 Picea abies mRNA for putative polyubiquitin, (pPA0031 gene)
          Length = 1020

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 67  aagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 70  aagatgcagatctttgtcaagaccctcaccggcaagaccatcactctcgaggt 122



to top

>gb|DQ252482.1| Solanum tuberosum clone 031C02 polyubiquitin-like mRNA, complete
           cds
          Length = 487

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 63  tctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 82  tctcaagatgcagatctttgttaagacactcaccggaaagaccatcactcttgaggt 138



to top

>gb|M22428.1|DROUBIA D.melanogaster ubiquitin protein gene, complete cds
          Length = 2620

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            |||||||||||||||||||| || || ||||||||||||||||||||||||||
Sbjct: 1940 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggtaga 1992



 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1712 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1764



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2168 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2220



to top

>dbj|D83208.1|GPIUBIY Cavia cobaya mRNA for ubiquitin, complete cds
          Length = 1028

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| |||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 275 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggtaga 327



 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 730 gatgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggt 780



 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 503 atgcagatcttcgtgaagaccctcactggcaagaccatcaccctcgaggt 552



 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 47  atgcagatcttcgtaaagaccctcactggcaagaccatcaccctcgaggtaga 99



to top

>ref|XM_522865.1| PREDICTED: Pan troglodytes similar to ubiquitin A-52 residue
           ribosomal protein fusion product 1 (LOC467468), mRNA
          Length = 444

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 59  agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 110



to top

>ref|XM_528575.1| PREDICTED: Pan troglodytes similar to ubiquitin A-52 residue
           ribosomal protein fusion product 1 (LOC473205), mRNA
          Length = 1311

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 53  agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 104



to top

>emb|AL354709.15| Human DNA sequence from clone RP11-145E5 on chromosome 9 Contains the
            5' end of the CDKN2B gene for cyclin-dependent kinase
            inhibitor 2B (p15, inhibits CDK4), a ubiquitin A-52
            residue ribosomal protein fusion product 1 (UBA52)
            (RPL40) pseudogene, the 3' end of a variant of the MTAP
            gene for methylthioadenosine phosphorylase (MSAP), a
            novel gene and a CpG island, complete sequence
          Length = 157533

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 3739 agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 3790



to top

>emb|X69422.1|AFTETUBI A.fatua mRNA for tetraubiquitin
          Length = 1196

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||||||| ||||| |||||||||||||| || |||||
Sbjct: 27  ctcaagatgcagatctttgtgaagaccctcactggcaagaccatcacacttgaggt 82



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||||||||||||||||||||| |||||
Sbjct: 261 atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctggaggt 310



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| || ||||| ||||| |||||||||||||||
Sbjct: 717 atgcagatcttcgtcaagaccctcactggcaagaccatcacc 758



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| || |||||||||||||| |||||
Sbjct: 489 atgcagatcttcgtcaagaccctcactggtaagaccatcaccctggaggt 538



to top

>gb|AC000049.11| Homo sapiens Chromosome 9p21 Cosmid Clone c86, complete sequence
          Length = 44160

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 21956 agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 21905



to top

>ref|NG_002524.1| Homo sapiens ubiquitin A-52 residue ribosomal protein fusion
           product 1 pseudogene 3 (UBA52P3) on chromosome 14
          Length = 721

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 142 agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 193



to top

>emb|Z11667.1|STUQ95 S.tuberosum mRNA for ubiquitin (partial)
          Length = 123

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 46/48 (95%)
 Strand = Plus / Plus

                                                           
Query: 63  tctcaagatgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 73  tctcaagatgcagatctttgttaagacactcaccggaaagaccatcac 120



to top

>emb|AL121579.4|CNS01DRX Human chromosome 14 DNA sequence BAC R-349A22 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 161771

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 93168 agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 93219



to top

>dbj|AB060808.1| Homo sapiens gene for p16/CDKN2A, complete cds
          Length = 250000

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 49/52 (94%)
 Strand = Plus / Plus

                                                                  
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 229541 agatgcagatctttgtgaagaccctcacgggcaagaccatcacccttgaggt 229592



to top

>ref|NM_202787.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding
           AT4G05320 (UBQ10) transcript variant AT4G05320.5 mRNA,
           complete cds
          Length = 1203

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 81  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 135



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 542 atgcagatcttcgtgaagactctcaccggaaagactatcac 582



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 770 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 813



to top

>ref|NM_178969.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding
           AT4G05320 (UBQ10) transcript variant AT4G05320.3 mRNA,
           complete cds
          Length = 1431

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 81  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 135



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 542 atgcagatcttcgtgaagactctcaccggaaagaccatcac 582



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagactatcac 810



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 998  atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1041



to top

>ref|NM_116771.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding
           AT4G05320 (UBQ10) transcript variant AT4G05320.1 mRNA,
           complete cds
          Length = 1431

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 81  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 135



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagactatcac 810



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 998  atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1041



to top

>ref|NM_178968.1| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding
           AT4G05320 (UBQ10) transcript variant AT4G05320.2 mRNA,
           complete cds
          Length = 1834

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 81  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 135



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 770 atgcagatcttcgtgaagactctcaccggaaagaccatcac 810



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 998  atgcagatcttcgtgaagactctcaccggaaagactatcac 1038



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1226 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1269



to top

>ref|NM_116523.2| Arabidopsis thaliana UBQ14; protein binding AT4G02890 (UBQ14)
           transcript variant AT4G02890.1 mRNA, complete cds
          Length = 1202

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 63  tcaagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 117



to top

>ref|NM_178960.1| Arabidopsis thaliana UBQ14; protein binding AT4G02890 (UBQ14)
           transcript variant AT4G02890.2 mRNA, complete cds
          Length = 975

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 64  tcaagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 118



to top

>gb|DQ216252.1| Taeniopygia guttata clone 0058P0005E02 ubiquitin C variant 12-like
           mRNA, complete sequence
          Length = 1378

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 296 gatgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 346



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||| |||||||| || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtgaagaccctgactggcaagaccatcaccct 1024



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccct 568



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 752 gatgcagatcttcgtcaagaccctgaccggcaagaccatcactcttgaggt 802



to top

>gb|DQ216236.1| Taeniopygia guttata clone 0058P0054D08 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1150

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgaccggcaagaccatcactctcgaggt 574



 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 118



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 752 gatgcagatcttcgtcaagaccctgactggcaagaccatcaccct 796



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || || |||||||||||||| || |||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgactggcaagaccatcactcttgaggt 346



to top

>gb|BT016596.1| Zea mays clone Contig429 mRNA sequence
          Length = 980

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 116



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 295 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 344



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                          
Query: 73  cagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || || || ||||| ||||| |||||
Sbjct: 526 cagatctttgtgaagaccctgactggaaaaaccataaccctggaggt 572



to top

>gb|BT017660.1| Zea mays clone EL01N0440E11.c mRNA sequence
          Length = 997

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 70  tcaagatgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 124



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 304 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 353



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgagg 118
           ||||||||||| |||||||| || |||||||| || |||||||||||||
Sbjct: 532 atgcagatcttcgtgaagaccctgaccggcaaaactatcaccctcgagg 580



to top

>gb|BT000701.1| Arabidopsis thaliana clone RAFL08-11-A12 (R11186) putative
           polyubiquitin (UBQ10) (At4g05320) mRNA, complete cds
          Length = 1616

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 116



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcac 791



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 979  atgcagatcttcgtgaagactctcaccggaaagactatcac 1019



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1250



to top

>gb|AY056295.1| Arabidopsis thaliana At4g05320 mRNA sequence
          Length = 1637

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 116



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcac 791



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 979  atgcagatcttcgtgaagactctcaccggaaagactatcac 1019



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1250



to top

>ref|XM_782408.1| PREDICTED: Strongylocentrotus purpuratus similar to polyubiquitin
           (LOC582459), mRNA
          Length = 1701

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||| ||||| |||||||||||||||||||| ||||||||
Sbjct: 83  tcaacatgcagatctttgtcaagaccctcaccggcaagaccatcacactcgaggt 137



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || || || ||||| |||||||||||||| ||||||||
Sbjct: 772 atgcagatcttcgtcaaaaccctcacaggcaagaccatcacactcgaggt 821



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || || || ||||| |||||||||||||| ||||||||
Sbjct: 544 atgcagatcttcgtcaaaaccctcacaggcaagaccatcacactcgaggt 593



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || || || ||||| |||||||||||||| ||||||||
Sbjct: 316 atgcagatcttcgtcaaaaccctcacaggcaagaccatcacactcgaggt 365



to top

>gb|AY139999.1| Arabidopsis thaliana polyubiquitin UBQ10 (At4g05320) mRNA, complete
           cds
          Length = 1815

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 116



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagaccatcac 791



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 979  atgcagatcttcgtgaagactctcaccggaaagactatcac 1019



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1207 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1250



to top

>gb|AF506969.1| Equus caballus ubiquitin mRNA, complete cds
          Length = 1157

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 114 tcaaaatgcagatctttgtgaagaccctgaccggcaagaccatcaccctggaggt 168



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| || |||||||| || |||||||||||||||||||| |||||
Sbjct: 802 gatgcagattttcgtgaagaccctgaccggcaagaccatcaccctggaggt 852



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| || |||||||| || |||||||||||||||||||| |||||
Sbjct: 347 atgcagattttcgtgaagaccctgaccggcaagaccatcaccctggaggt 396



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| || |||||||| || |||||||||||||| ||||| |||||
Sbjct: 574 gatgcagattttcgtgaagaccctgaccggcaagaccattaccctggaggt 624



to top

>gb|AY057500.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, complete cds
          Length = 1319

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 116



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 523 atgcagatcttcgtgaagactctcaccggaaagaccatcac 563



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagactatcac 791



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 979  atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1022



to top

>gb|AY052698.1| Arabidopsis thaliana AT4g05320/C17L7_240 mRNA, complete cds
          Length = 1356

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 116



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 751 atgcagatcttcgtgaagactctcaccggaaagactatcac 791



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 979  atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1022



to top

>gb|AY042884.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 927

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 63  tcaagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 117



to top

>emb|BX828380.1|CNS0A30T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH81ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1525

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 48  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 102



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 974  atgcagatcttcgtgaagactctcaccggaaagactatcac 1014



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1205 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1248



to top

>gb|AC158180.2| Selaginella moellendorffii chromosome JGIASXY-5A14, complete sequence
          Length = 36906

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| |||||||||||||| ||||| ||||||||
Sbjct: 4175 gatgcagatctttgtgaagactctcaccggcaagacgatcacgctcgaggt 4225



to top

>gb|AY087759.1| Arabidopsis thaliana clone 38261 mRNA, complete sequence
          Length = 1190

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 64  tcaagatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 118



to top

>dbj|AK177176.1| Mus musculus cDNA, clone:Y0G0101N24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000054250, based on BLAT search
          Length = 454

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 297 gatgcagatctttgtgaagacactgacaggcaagaccatcaccctggaggt 347



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||||||||||||||| || || |||||||||||||||
Sbjct: 70  atgcagatctttgtgaagaccctgacaggcaagaccatcacc 111



to top

>dbj|AB089614.1| Pan troglodytes UbC gene for polyubiquitin C, complete cds
          Length = 2286

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| |||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 1824 gatgcaaatctttgtgaagacactcactggcaagaccatcacccttgaggt 1874



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 1140 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 1190



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 684 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 734



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||||||||| ||||| ||||||||||| |||||
Sbjct: 228 gatgcagatcttcgtgaagacactcactggcaaaaccatcacccttgaggt 278



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1646



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1368 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1418



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 912 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 962



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 506



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 50



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 2052 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 2102



to top

>gb|L05361.1|ATHUBQ10R Arabidopsis thaliana polyubiquitin (ubq10) mRNA, complete cds
          Length = 1577

 Score = 77.8 bits (39), Expect = 7e-12
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 38  tcaagatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 92



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 727 atgcagatcttcgtgaagactctcaccggaaagaccatcac 767



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 955 atgcagatcttcgtgaagactctcaccggaaagactatcac 995



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1183 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1226



to top

>ref|XM_473982.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1146

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 685 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 734



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 913 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 962



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 457 atgcagatctttgtgaagacccttactggcaagacgatcacc 498



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 82  gtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 241 gtgaagaccctcaccggcaagaccattaccctggaggt 278



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 1   atgcagatattcgttaagaccctcactggcaagaccatcacc 42



to top

>gb|DQ216241.1| Taeniopygia guttata clone 0058P0057E02 ubiquitin C variant 2-like
           mRNA, complete sequence
          Length = 1373

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 118



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || |||||||||||||| ||||||||
Sbjct: 752 gatgcagatctttgtgaagaccctgactggcaagaccatcactctcgaggt 802



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || |||| ||||||||| ||||||||
Sbjct: 980  gatgcagatctttgtgaagaccctgactggcaggaccatcactctcgaggt 1030



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccct 568



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| || ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagattttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



to top

>gb|DQ216240.1| Taeniopygia guttata clone 0061P0001C12 ubiquitin C variant 2-like
           mRNA, complete sequence
          Length = 1530

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 118



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || |||||||||||||| ||||||||
Sbjct: 981  gatgcagatctttgtgaagaccctgactggcaagaccatcactctcgaggt 1031



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccct 568



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 47/52 (90%), Gaps = 1/52 (1%)
 Strand = Plus / Plus

                                                               
Query: 69  gatgcagat-ctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| |||||||||||| || || |||||||||||||| ||||||||
Sbjct: 752 gatgcagatnctttgtgaagaccctgactggcaagaccatcactctcgaggt 803



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| || ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagattttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



to top

>gb|DQ216239.1| Taeniopygia guttata clone 0058P0040D01 ubiquitin C variant 2-like
           mRNA, complete sequence
          Length = 1376

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 118



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || |||||||||||||| ||||||||
Sbjct: 752 gatgcagatctttgtgaagaccctgactggcaagaccatcactctcgaggt 802



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || |||| ||||||||| ||||||||
Sbjct: 980  gatgcagatctttgtgaagaccctgactggcaggaccatcactctcgaggt 1030



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccct 568



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| || ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagattttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



to top

>gb|DQ216235.1| Taeniopygia guttata clone 0058P0048G02 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1305

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgaccggcaagaccatcacccttgaggt 118



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 754 atgcagatctttgtgaagaccctgactggcaagaccatcaccct 797



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgactggcaagaccatcactctcgaggt 346



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgacgggcaagaccatcaccct 568



to top

>gb|BT016652.1| Zea mays clone Contig485 mRNA sequence
          Length = 1253

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 312 atgcagatctttgtgaagacactcactggcaagacaatcacccttgaggt 361



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || |||||||| ||||||||||||||
Sbjct: 84  atgcagatcttcgtgaagaccctgactggcaagactatcaccctcgaggt 133



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||| |||||||||||| | || |||||||||||||||
Sbjct: 540 atgcagatttttgtgaagacattgactggcaagaccatcacc 581



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || || || ||||| ||||| |||||
Sbjct: 768 atgcagatctttgtgaagaccctgactggaaaaaccataaccctggaggt 817



to top

>ref|XM_415847.1| PREDICTED: Gallus gallus similar to polyubiquitin (LOC417602), mRNA
          Length = 1413

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 419 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggt 468



 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 191 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggt 240



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 875 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggt 924



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| ||  | || |||||||||||||||||||||||
Sbjct: 646 gatgcagatcttcgtgaaaaccttgactggcaagaccatcaccctcgaggt 696



to top

>ref|XM_363356.1| Magnaporthe grisea 70-15 hypothetical protein (MG01282.4) partial
           mRNA
          Length = 918

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctcactggcaagaccatcaccctcgaggt 50



to top

>emb|Z24723.1|PCUBIQGNA P.chrysosporium ubiquitin gene, complete CDS
          Length = 2054

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 373 atgcagatcttcgtgaagactctcacgggcaagaccatcaccctcgaggt 422



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||| |||||||| ||||| |||||||||||||| || |||||||||||
Sbjct: 1439 atgcaaatctttgttaagacgctcaccggcaagacgattaccctcgaggt 1488



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || || |||||||||||||| ||||||||
Sbjct: 653 atgcagatctttgtcaagaccctgacgggcaagaccatcacgctcgaggt 702



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| ||||||||  | ||||||||||| ||||| ||||||||
Sbjct: 1159 atgcagatcttcgtgaagacgttgaccggcaagacgatcacgctcgaggt 1208



to top

>emb|X87156.1|APOLYUBIQ Acanthamoeba sp. 4b3 polyubiquitin gene
          Length = 2388

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 2102 atgcagatcttcgtgaagaccctcaccggtaagaccatcaccctcgaggt 2151



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 2330 atgcagatcttcgtcaagacgctgaccggcaagaccatcaccctcgaggt 2379



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||| ||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 1874 atgcaaatcttcgtgaagaccctgaccggcaagaccatcaccctcgaggt 1923



to top

>emb|X75628.1|ACUBIFUS A.castellanii mRNA for ubiquitin fusion protein
          Length = 525

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 61  atgcagatcttcgtgaagaccctcaccggtaagaccatcaccctcgaggt 110



to top

>emb|X67957.1|AMUBIQMRP A.majus mRNA for ubiquitin (partial)
          Length = 1094

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 204 atgcagatctttgtgaagactctgaccggcaagaccatcacccttgaggt 253



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||| ||||||||||||||  | |||||||||||||| |||||||||||
Sbjct: 432 atgcaaatctttgtgaagaccttgaccggcaagaccattaccctcgaggt 481



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 95  ccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||| |||||
Sbjct: 1   ccggcaagaccatcacccttgaggt 25



to top

>emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin
          Length = 436

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 3   atgcagatatttgtgaagaccctcaccggcaagaccatcaccctggaggt 52



to top

>emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin
          Length = 436

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 3   atgcagatatttgtgaagaccctcaccggcaagaccatcaccctggaggt 52



to top

>emb|AJ697758.1| Eucalyptus globulus subsp. globulus partial mRNA for putative
           polyubiquitin
          Length = 228

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| |||||||||||||||||||||||||||||
Sbjct: 67  atgcagatcttcgtcaagaccctcaccggcaagaccatcaccctcgaggt 116



to top

>gb|AC018992.6| Homo sapiens chromosome 8, clone RP11-468O2, complete sequence
          Length = 151712

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                           
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
             |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 70219 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccct 70174



to top

>dbj|AB168934.1| Macaca fascicularis testis cDNA, clone: QtsA-15896, similar to
           human ubiquitin A-52 residue ribosomal protein
           fusionproduct 1 (UBA52), mRNA, RefSeq: NM_003333.2
          Length = 551

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| |||||||||||||||||
Sbjct: 52  atgcagatctttgtgaagaccctcacgggcaaaaccatcaccctcgaggt 101



to top

>gb|S94464.1| polyubiquitin [maize, Genomic, 3841 nt]
          Length = 3841

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 2906 atgcagatctttgtgaagacactcactggcaagacaatcacccttgaggt 2955



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 2678 atgcagatcttcgtgaagaccctgaccggcaagactatcaccctcgaggt 2727



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 2450 atgcagatcttcgtgaagaccctgaccggcaagactatcaccctcgaggt 2499



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 2222 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 2271



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||| || || || |||||||| ||||||||||||||
Sbjct: 1992 agatgcagatctttgtgaaaaccctgactggcaagactatcaccctcgaggt 2043



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||| |||||||||||| | || |||||||||||||||
Sbjct: 3134 atgcagatttttgtgaagacattgactggcaagaccatcacc 3175



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 31998355 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 31998404



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
                ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 31998583 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 31998632



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                          
Query: 70       atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
                |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 31998127 atgcagatctttgtgaagacccttactggcaagacgatcacc 31998168



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 82       gtgaagacactcaccggcaagaccatcaccctcgaggt 119
                |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 31997911 gtgaagaccctcaccggcaagaccattaccctggaggt 31997948



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 68       agatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
                |||||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 31997669 agatgcagatattcgttaagaccctcactggcaagaccatcacc 31997712



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 11       tccaatccaatccaatcca 29
                |||||||||||||||||||
Sbjct: 33425774 tccaatccaatccaatcca 33425756



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 10       atccaatccaatccaatcc 28
                |||||||||||||||||||
Sbjct: 31752997 atccaatccaatccaatcc 31752979



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 11       tccaatccaatccaatcca 29
                |||||||||||||||||||
Sbjct: 10482088 tccaatccaatccaatcca 10482106



to top

>gb|AC068228.8| Homo sapiens chromosome 8, clone RP11-539E17, complete sequence
          Length = 200622

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                            
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
              |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 164444 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccct 164489



to top

>ref|NM_001009202.1| Ovis aries polyubiquitin (LOC443016), mRNA
          Length = 1102

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 780 atgcagatctttgtgaagaccctgaccggcaagaccatcaccctggaggt 829



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 552 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 601



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 324 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 373



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||| ||||| ||||| || || |||||||||||||||||||| |||||
Sbjct: 91  tcaaaatgcaaatcttcgtgaaaaccctgaccggcaagaccatcaccctggaggt 145



to top

>gb|AF038129.1|AF038129 Ovis aries polyubiquitin mRNA, complete cds
          Length = 1102

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || |||||||||||||||||||| |||||
Sbjct: 780 atgcagatctttgtgaagaccctgaccggcaagaccatcaccctggaggt 829



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 552 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 601



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 324 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 373



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||| ||||| ||||| || || |||||||||||||||||||| |||||
Sbjct: 91  tcaaaatgcaaatcttcgtgaaaaccctgaccggcaagaccatcaccctggaggt 145



to top

>gb|AY954394.1| Oryza sativa (japonica cultivar-group) polyubiquitin (rubi3) gene,
            promoter region and complete cds
          Length = 3733

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 3201 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 3250



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 3429 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 3478



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 2973 atgcagatctttgtgaagacccttactggcaagacgatcacc 3014



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 82   gtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 2757 gtgaagaccctcaccggcaagaccattaccctggaggt 2794



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 2515 agatgcagatattcgttaagaccctcactggcaagaccatcacc 2558



to top

>gb|AC104430.3| Homo sapiens chromosome 8 clone RP11-391E1 map 8q24.2, complete sequence
          Length = 170376

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                            
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
              |||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 102586 agatgcagatctttgtgaagaccctcacaggcaagaccatcaccct 102631



to top

>emb|X02650.1|GGUBIQ Chicken mRNA for ubiquitin
          Length = 598

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 241 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggt 290



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| ||  | || ||||||||||||||||| |||||
Sbjct: 12  gatgcagatcttcgtgaaaacgttgactggcaagaccatcacccttgaggt 62



to top

>dbj|AK102389.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033092E11, full
            insert sequence
          Length = 2497

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 1894 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 1943



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 2122 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 2171



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 1666 atgcagatctttgtgaagacccttactggcaagacgatcacc 1707



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 82   gtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 1451 gtgaagaccctcaccggcaagaccattaccctggaggt 1488



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 1209 agatgcagatattcgttaagaccctcactggcaagaccatcacc 1252



to top

>gb|AY104761.1| Zea mays PCO089720 mRNA sequence
          Length = 803

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 50/54 (92%)
 Strand = Plus / Plus

                                                                 
Query: 66  caagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||||| || || || ||||||||||||||||||||
Sbjct: 116 caagatgcagatctttgtgaagacgctgacagggaagaccatcaccctcgaggt 169



to top

>gb|AY098526.1| Ananas comosus tetrameric ubiquitin mRNA, complete cds
          Length = 1199

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 723 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctcgaggt 772



 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 62  ctctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||| ||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 31  ctctcaagatgcaaatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 88



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 495 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 544



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 267 atgcagatcttcgtcaagaccctgaccggcaagaccatcaccctcgaggt 316



to top

>dbj|D12776.1|RICPOLYUBI Oryza sativa (japonica cultivar-group) mRNA for poly-ubiquitin,
           partial cds
          Length = 744

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 109 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 158



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 337 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 386



to top

>gb|U29159.1|ZMU29159 Zea mays clone MubG1 ubiquitin gene, complete cds
          Length = 4190

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||||||||| |||||||| |||||||| |||||
Sbjct: 3255 atgcagatctttgtgaagacactcactggcaagacaatcacccttgaggt 3304



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 3027 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 3076



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 2799 atgcagatcttcgtgaagaccctgaccggcaagactatcaccctcgaggt 2848



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||| || || || |||||||| ||||||||||||||
Sbjct: 2341 agatgcagatctttgtgaaaaccctgactggcaagactatcaccctcgaggt 2392



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| ||  | ||||||||||| ||||||||||||||
Sbjct: 2571 atgcagatctttgtgaaaaccttgaccggcaagactatcaccctcgaggt 2620



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||| |||||||||||| | || |||||||||||||||
Sbjct: 3483 atgcagatttttgtgaagacattgactggcaagaccatcacc 3524



to top

>emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0089N06,
             complete sequence
          Length = 141752

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| |||||||| ||||||||||||||||||||||| |||||
Sbjct: 19062 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccctggaggt 19111



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 19290 atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 19339



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
             |||||||||||||||||||| || || |||||||| ||||||
Sbjct: 18834 atgcagatctttgtgaagacccttactggcaagacgatcacc 18875



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 82    gtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 18618 gtgaagaccctcaccggcaagaccattaccctggaggt 18655



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
             |||||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 18376 agatgcagatattcgttaagaccctcactggcaagaccatcacc 18419



to top

>gb|AF056625.1|AF056625 Magnaporthe grisea strain Guy-11 poly-ubiquitin (PUB4) mRNA,
           complete cds
          Length = 1326

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| |||||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctcactggcaagaccatcaccctcgaggt 50



to top

>emb|Z49056.1|CJUBIQ C.jacchus mRNA for ubiquitin
          Length = 189

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 1   atgcagatctttgtgaagaccctcacaggcaagaccatcacccttgaggt 50



to top

>gb|M11100.1|CHKUBHSP Chicken ubiquitin mRNA, from heat shocked embryo cells
          Length = 622

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 241 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggt 290



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| ||  | || ||||||||||||||||| |||||
Sbjct: 12  gatgcagatcttcgtgaaaacgttgactggcaagaccatcacccttgaggt 62



to top

>gb|M14693.1|CHKUB1A Chicken ubiquitin I (UbI) gene, partial cds
          Length = 2207

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || |||||||||||||||||||||||
Sbjct: 1789 atgcagatctttgtgaagaccctgactggcaagaccatcaccctcgaggt 1838



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||  | || ||||||||||||||||| |||||
Sbjct: 1333 atgcagatctttgtgaagaccttgactggcaagaccatcacccttgaggt 1382



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 1105 atgcagatcttcgtgaagaccctgactggcaagaccatcacccttgaggt 1154



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| ||||| ||  | || ||||||||||||||||| |||||
Sbjct: 1560 gatgcagatcttcgtgaaaacgttgactggcaagaccatcacccttgaggt 1610



to top

>gb|DQ216253.1| Taeniopygia guttata clone 0058P0031B03 ubiquitin C variant 14-like
           mRNA, complete sequence
          Length = 1327

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgaccggcaagaccatcaccct 568



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 296 gatgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 340



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 752 gatgcagatcttcgtcaagaccctgactggcaagaccatcaccct 796



to top

>gb|DQ216249.1| Taeniopygia guttata clone 0058P0031D03 ubiquitin C variant 9-like
           mRNA, complete sequence
          Length = 1327

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgaccggcaagaccatcaccct 568



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 296 gatgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 340



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||| || || ||||| || || |||||||||||||||||
Sbjct: 752 gatgcagattttcgtcaagaccctgactggcaagaccatcaccct 796



to top

>gb|DQ216247.1| Taeniopygia guttata clone 0058P0020E12 ubiquitin C variant 7-like
           mRNA, complete sequence
          Length = 1383

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgaccggcaagaccatcaccct 568



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || ||||||||||||||||| || |||||
Sbjct: 752 gatgcagatctttgtgaagaccctgaccggcaagaccatcactcttgaggt 802



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 296 gatgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 340



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtcaagaccctgactggcaagaccatcaccct 1024



to top

>gb|DQ216246.1| Taeniopygia guttata clone 0058P0016A01 ubiquitin C variant 7-like
           mRNA, complete sequence
          Length = 1377

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgaccggcaagaccatcaccct 568



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || ||||||||||||||||| || |||||
Sbjct: 752 gatgcagatctttgtgaagaccctgaccggcaagaccatcactcttgaggt 802



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 296 gatgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 340



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtcaagaccctgactggcaagaccatcaccct 1024



to top

>emb|CR693983.2|CNS0FYFF Tetraodon nigroviridis full-length cDNA
          Length = 682

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           |||||||||||||| ||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 2   atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggtaga 54



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||| || |||||
Sbjct: 230 atgcagatcttcgtcaagaccctcactggcaaaaccatcactcttgaggt 279



to top

>gb|AY118702.1| Drosophila melanogaster AT20865 full insert cDNA
          Length = 3448

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 147 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 199



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 3111 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 3163



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2883 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2935



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2655 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2707



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2427 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2479



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2199 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2251



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1971 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2023



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1743 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1795



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1515 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1567



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1287 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1339



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 603 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 655



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 375 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 427



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||| ||||||||
Sbjct: 1059 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctagaggtaga 1111



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||| ||||||||
Sbjct: 831 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctagaggtaga 883



to top

>gb|AC010047.8| Drosophila melanogaster 3L BAC RP98-28E17 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 164201

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 140153 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 140101



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 139925 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 139873



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 139697 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 139645



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 139469 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 139417



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 139241 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 139189



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 139013 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 138961



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 138785 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 138733



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 138557 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 138505



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 138329 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 138277



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 138101 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 138049



to top

>ref|NM_206272.1| Drosophila melanogaster Ubiquitin-63E CG11624-RC, transcript
           variant C (Ubi-p63E), mRNA
          Length = 2710

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 210 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 262



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2262 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2314



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2034 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2086



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1806 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1858



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1578 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1630



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1350 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1402



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1122 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1174



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 894 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 946



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 666 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 718



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 438 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 490



to top

>ref|NM_168043.2| Drosophila melanogaster Ubiquitin-63E CG11624-RA, transcript
           variant A (Ubi-p63E), mRNA
          Length = 2475

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 147 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 199



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2199 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2251



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1971 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2023



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1743 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1795



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1515 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1567



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1287 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1339



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1059 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1111



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 831 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 883



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 603 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 655



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 375 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 427



to top

>ref|NM_079185.4| Drosophila melanogaster Ubiquitin-63E CG11624-RB, transcript
           variant B (Ubi-p63E), mRNA
          Length = 2759

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 259 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 311



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2311 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2363



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 2083 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 2135



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1855 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1907



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1627 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1679



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1399 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1451



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
            ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 1171 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 1223



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 943 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 995



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 715 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 767



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 487 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 539



to top

>gb|AE003479.3| Drosophila melanogaster chromosome 3L, section 13 of 83 of the complete
              sequence
          Length = 309958

 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||||||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 215779 atgcagatctttgtgaagactttgaccggaaagaccatcaccctcgaggtaga 215727



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 215551 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 215499



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 215323 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 215271



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 215095 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 215043



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 214867 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 214815



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 214639 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 214587



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 214411 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 214359



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 214183 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 214131



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 213955 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 213903



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
              ||||||||||| ||||||||  | ||||| |||||||||||||||||||||||
Sbjct: 213727 atgcagatcttcgtgaagactttgaccggaaagaccatcaccctcgaggtaga 213675



to top

>ref|NM_178970.2| Arabidopsis thaliana UBQ10 (POLYUBIQUITIN 10); protein binding
           AT4G05320 (UBQ10) transcript variant AT4G05320.4 mRNA,
           complete cds
          Length = 1624

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 49  agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 100



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 735 atgcagatcttcgtgaagactctcaccggaaagaccatcac 775



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 963  atgcagatcttcgtgaagactctcaccggaaagactatcac 1003



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1191 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1234



to top

>ref|NM_178961.1| Arabidopsis thaliana UBQ14; protein binding AT4G02890 (UBQ14)
           transcript variant AT4G02890.3 mRNA, complete cds
          Length = 1499

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 363 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 414



to top

>gb|AC004044.1| Arabidopsis thaliana BAC T5J8 from chromosome IV, top arm, complete
             sequence
          Length = 98527

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 76756 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 76705



to top

>ref|XM_878714.1| PREDICTED: Bos taurus similar to ribosomal protein S27a, transcript
           variant 2 (LOC615199), mRNA
          Length = 1172

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 17  agatgcagatctttgtgaagaccctgacgggcaagaccatcacccttgaggt 68



to top

>gb|BT012698.1| Lycopersicon esculentum clone 113569R, mRNA sequence
          Length = 1626

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 60  ctctctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||||| || |||||||| ||||| |||||||| |||||
Sbjct: 51  ctctttcaagatgcagatctttgtgaaaactctcaccggaaagactatcaccctagaggt 110



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||| |||||||||||||| || ||||| || ||||||||||| |||||
Sbjct: 973  atgcaaatctttgtgaagacccttaccgggaaaaccatcaccctggaggt 1022



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||||||||||||  | ||||| |||||||||||
Sbjct: 1201 atgcagatctttgtgaagaccttgaccgggaagaccatcac 1241



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           |||||||| ||||| ||||| |||||||| |||||||||||
Sbjct: 745 atgcagatttttgttaagaccctcaccggaaagaccatcac 785



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| ||||| || ||||| || ||||| |||||
Sbjct: 289 atgcagatcttcgtgaagactctcacgggtaagacgattacccttgaggt 338



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 517 atgcagatcttcgttaagactcttaccggaaagaccatcac 557



to top

>emb|Y17003.1|SDO17003 Suberites domuncula mRNA for polyubiquitin
          Length = 1145

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 789 atgcaaatctttgtgaagacactcaccggaaagaccatcaccct 832



 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 561 atgcaaatctttgtgaagacactcaccggaaagaccatcaccct 604



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 333 atgcaaatctttgtgaagacactcaccggaaagaccatcac 373



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 105 atgcaaatcttcgtaaagacactcaccggcaagaccatcac 145



to top

>emb|Y12081.1|SDPOLUBQ1 Suberites domuncula mRNA for polyubiquitin precursor
          Length = 1392

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 1017 atgcaaatctttgtgaagacactcaccggaaagaccatcaccct 1060



 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 789 atgcaaatctttgtgaagacactcaccggaaagaccatcaccct 832



 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 561 atgcaaatctttgtgaagacactcaccggaaagaccatcaccct 604



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 333 atgcaaatctttgtgaagacactcaccggaaagaccatcac 373



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcac 110
           ||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 105 atgcaaatcttcgtaaagacactcaccggcaagaccatcac 145



to top

>emb|AL161503.2|ATCHRIV15 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 15
          Length = 199987

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 57010 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 57061



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                      
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcac 110
             ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 57696 atgcagatcttcgtgaagactctcaccggaaagaccatcac 57736



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcac 110
             ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 57924 atgcagatcttcgtgaagactctcaccggaaagactatcac 57964



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
             ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 58152 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 58195



to top

>emb|AL161495.2|ATCHRIV7 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 7
          Length = 199615

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                  
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 125426 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 125375



to top

>dbj|D28123.1|SOYSUBI3 Glycine max SUBI-3 gene for ubiquitin, complete cds
          Length = 2170

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||| || ||||| ||||||||||||||||||||||| |||||
Sbjct: 918 agatgcagatcttcgtcaagaccctcaccggcaagaccatcacccttgaggt 969



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| || ||||||||||||||||||||||| ||||| |||||
Sbjct: 1148 atgcagatcttcgttaagacactcaccggcaagaccataaccctagaggt 1197



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 1376 atgcagatcttcgttaagaccctcaccggcaagactattaccct 1419



to top

>gb|BC102248.1| Bos taurus cDNA clone MGC:127041 IMAGE:7941775, complete cds
          Length = 626

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 36  agatgcagatctttgtgaagaccctgacgggcaagaccatcacccttgaggt 87



to top

>gb|AY842446.1| Bubalus bubalis ubiquitin/ribosomal fusion protein mRNA, complete
           cds
          Length = 543

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 31  agatgcagatctttgtgaagaccctgacgggcaagaccatcacccttgaggt 82



to top

>ref|NM_214211.1| Sus scrofa ubiquitin/ribosomal fusion protein (UBA52), mRNA
          Length = 524

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 34  agatgcagatctttgtgaagaccctgacgggcaagaccatcacccttgaggt 85



to top

>gb|AC012477.1|AC012477 Genomic Sequence For Arabidopsis thaliana Clone C6L9, Chromosome IV,
             complete sequence
          Length = 145453

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 58285 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 58234



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                      
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcac 110
             ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 57599 atgcagatcttcgtgaagactctcaccggaaagaccatcac 57559



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                      
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcac 110
             ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 57371 atgcagatcttcgtgaagactctcaccggaaagactatcac 57331



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
             ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 57143 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 57100



to top

>gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana clone C17L7, Chromosome IV,
            complete sequence
          Length = 183147

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 68   agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 2537 agatgcagatctttgttaagactctcaccggaaagacaatcaccctcgaggt 2486



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                  
Query: 68     agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 132132 agatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 132183



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 1851 atgcagatcttcgtgaagactctcaccggaaagaccatcac 1811



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            ||||||||||| |||||||| |||||||| ||||| |||||
Sbjct: 1623 atgcagatcttcgtgaagactctcaccggaaagactatcac 1583



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            ||||||||||| || |||||  | ||||| ||||||||||||||
Sbjct: 1395 atgcagatcttcgtcaagactttgaccggaaagaccatcaccct 1352



to top

>dbj|AK058319.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A10, full
           insert sequence
          Length = 1421

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 752 atgcagatcttcgtgaagaccctcaccggcaagaccatcaccct 795



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 980  atgcagatcttcgtgaagaccctcactggcaagaccatcactctggaggt 1029



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||||| || || ||||| ||||| |||||||||||||||
Sbjct: 63  tcaagatgcagatattcgttaagaccctcactggcaagaccatcacc 109



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 82  gtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| ||||||||||||||||| ||||| |||||
Sbjct: 308 gtgaagaccctcaccggcaagaccattaccctggaggt 345



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||||||||| ||||| || || |||||||| ||||||
Sbjct: 524 atgcagatctttgtaaagacccttactggcaagacgatcacc 565



to top

>dbj|AB090878.1| Aster tripolium mRNA for polyubiquitin, complete cds
          Length = 819

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 61  tctctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           ||||||||||||||||||||||| |||||  | ||||| |||||||||||||||||
Sbjct: 18  tctctcaagatgcagatctttgttaagactttgaccggaaagaccatcaccctcga 73



to top

>gb|U72496.1|SSU72496 Sus scrofa ubiquitin/ribosomal fusion protein mRNA, complete cds
          Length = 524

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 34  agatgcagatctttgtgaagaccctgacgggcaagaccatcacccttgaggt 85



to top

>gb|L05394.1|ATHUBQ14G Arabidopsis thaliana polyubiquitin (ubq14) gene sequence
          Length = 1605

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 68  agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 470 agatgcagatctttgttaagactctcaccggaaagactatcaccctcgaggt 521



to top

>gb|AC152972.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNOa0048I04, complete sequence
          Length = 35440

 Score = 71.9 bits (36), Expect = 4e-10
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                                 
Query: 68    agatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||
Sbjct: 16443 agatgcagatctttgtgaagactctcactggcaagaccataacccttgaggt 16494



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 70    atgcagatctttgtgaagacactcaccggcaagaccat 107
             ||||||||||| |||||||| || || |||||||||||
Sbjct: 16901 atgcagatcttcgtgaagacccttactggcaagaccat 16938



to top

>ref|NM_116744.2| Arabidopsis thaliana UBQ11 (UBIQUITIN 11); protein binding
           AT4G05050 (UBQ11) transcript variant AT4G05050.1 mRNA,
           complete cds
          Length = 1025

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 64  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 118



to top

>gb|AY819759.1| Homo sapiens ubiquitin C splice variant (UBC) mRNA, complete cds,
           alternatively spliced
          Length = 718

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 246 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 296



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 474 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 524



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 19  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 68



to top

>gb|BT016508.1| Zea mays clone Contig341 mRNA sequence
          Length = 658

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 586 tcaagatgcagatcttcgtgaagaccctgacgggaaagaccatcaccctcgaggt 532



to top

>gb|BT018032.1| Zea mays clone EL01N0530D02.c mRNA sequence
          Length = 1238

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||| ||||||||| ||||
Sbjct: 67  tcaagatgcagatctttgtgaaaaccctgaccggcaagactatcaccctccaggt 121



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 300 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 349



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||| || ||||||||||||||
Sbjct: 528 atgcagatcttcgtgaagaccctgaccggcaaaactatcaccctcgaggt 577



 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 70  atgcagatctttgtgaagac 89
           ||||||||||||||||||||
Sbjct: 756 atgcagatctttgtgaagac 775



to top

>gb|BC066197.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:76690
           IMAGE:6435236), complete cds
          Length = 1214

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 124 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 178



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 357 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 406



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 813 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 854



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 585 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 634



to top

>gb|AC123736.8| Mus musculus chromosome 3, clone RP23-478I18, complete sequence
          Length = 189063

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                     
Query: 65     tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 173473 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 173527



to top

>gb|BC080583.1| Homo sapiens cDNA clone IMAGE:2822684, partial cds
          Length = 2187

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 725 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 775



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 269 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 319



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1865 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1915



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 497 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 547



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 42  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 91



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 953  gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 1000



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1181 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1231



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1637 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1684



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1409 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1456



to top

>gb|BC019850.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:29922
           IMAGE:5123849), complete cds
          Length = 1146

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 63  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 117



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 752 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 801



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 296 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 345



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 524 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 573



to top

>gb|BC039193.1| Homo sapiens ubiquitin C, mRNA (cDNA clone MGC:14624
           IMAGE:4076286), complete cds
          Length = 2222

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 752 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 802



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 296 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 346



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1892 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1942



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 574



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 69  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 118



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 1027



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1208 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1258



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1664 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1711



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1436 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1483



to top

>ref|NM_011664.2| Mus musculus ubiquitin B (Ubb), mRNA
          Length = 1167

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 784 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 825



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 556 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 605



to top

>gb|DQ473431.1| Anser anser breed Landoise polyubiquitin mRNA, complete cds
          Length = 1148

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 86  tcaacatgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 140



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 775 atgcagatcttcgtgaagactctgactggcaagaccatcacccttgaggt 824



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 547 atgcagatcttcgtgaagactctgactggcaagaccatcacccttgaggt 596



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 319 atgcagatcttcgtgaagactctgactggcaagaccatcacccttgaggt 368



to top

>gb|AF285162.1| Mus musculus cell-line C3H/RV polyubiquitin C (Ubc) gene, complete
            cds
          Length = 4212

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2154 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2204



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3751 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3800



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3295 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3344



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3067 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3116



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2611 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2660



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1927 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1976



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1699 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1748



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 2382 gatgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 2432



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 3979 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 4020



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 3523 atgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 3572



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 2839 atgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 2888



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 1470 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 1520



to top

>gb|AF285161.1| Mus musculus cell-line C3H/He polyubiquitin C (Ubc) gene, complete
            cds
          Length = 3756

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3294 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3344



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3067 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3116



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2839 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2888



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2611 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2660



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2155 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2204



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1927 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1976



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1699 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1748



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 3523 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 3564



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 2383 atgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 2432



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 1470 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 1520



to top

>ref|XR_004580.1| PREDICTED: Mus musculus gene model 1821, (NCBI) (Gm1821), misc RNA
          Length = 746

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 99  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 153



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 332 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 381



to top

>ref|XR_004579.1| PREDICTED: Mus musculus gene model 1821, (NCBI) (Gm1821), misc RNA
          Length = 977

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 101 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 155



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 334 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 383



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 72  gcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 564 gcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 611



to top

>ref|XR_001605.1| PREDICTED: Mus musculus gene model 1821, (NCBI) (Gm1821), misc RNA
          Length = 379

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 99  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 153



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 332 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 375



to top

>ref|XM_973010.1| PREDICTED: Mus musculus ubiquitin C (Ubc), mRNA
          Length = 2310

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1234 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1284



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 778 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 828



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1919 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1968



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1463 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1512



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1007 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1056



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 551 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 600



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 2147 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 2190



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 1690 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 1740



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||||||||| ||  | || || ||||||||||||||
Sbjct: 321 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccct 365



to top

>ref|XM_974638.1| PREDICTED: Mus musculus similar to polyubiquitin (LOC669363), mRNA
          Length = 494

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



to top

>ref|XM_992219.1| PREDICTED: Mus musculus similar to polyubiquitin (LOC667759), mRNA
          Length = 493

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



to top

>ref|XR_005158.1| PREDICTED: Mus musculus ubiquitin pseudogene (LOC218963), misc RNA
          Length = 493

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



to top

>gb|BC000449.2| Homo sapiens ubiquitin C, mRNA (cDNA clone IMAGE:2821375), partial
           cds
          Length = 2201

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 737 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 787



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 281 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 331



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1877 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1927



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 509 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 559



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 54  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 103



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 965  gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 1012



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1193 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1243



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1649 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1696



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1421 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1468



to top

>gb|BC008955.2| Homo sapiens ubiquitin C, mRNA (cDNA clone IMAGE:3030313), partial
           cds
          Length = 1728

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 725 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 775



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 269 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 319



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 497 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 547



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 42  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 91



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1409 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1459



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1181 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1228



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 953  gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1000



to top

>gb|BC021837.1| Mus musculus ubiquitin C, mRNA (cDNA clone MGC:30231 IMAGE:5123918),
            complete cds
          Length = 2120

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 960  gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1010



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 504 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 554



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1645 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1694



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1189 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1238



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 733 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 782



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 277 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 326



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 1873 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 1916



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 1416 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 1466



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 48  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 98



to top

>gb|BC006680.1| Mus musculus ubiquitin C, mRNA (cDNA clone MGC:7811 IMAGE:3500023),
            complete cds
          Length = 1891

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 961  gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1011



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 505 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 555



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1190 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1239



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 734 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 783



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 278 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 327



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 1646 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 1689



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 1417 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 1467



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 49  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 99



to top

>gb|AC137844.8| Mus musculus, clone RP23-415L22, complete sequence
          Length = 188189

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                     
Query: 65     tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 144012 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 143958



to top

>emb|Y17004.1|SDO17004 Suberites domuncula mRNA for monoubiquitin
          Length = 625

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| ||||| || |||||||||||||| |||||
Sbjct: 29  gatgcagatctttgtgaagactctcacagggaagaccatcacccttgaggt 79



to top

>gb|BC100341.1| Mus musculus ubiquitin B, mRNA (cDNA clone MGC:117670
           IMAGE:30787432), complete cds
          Length = 1145

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 49  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 103



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 282 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 331



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 738 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 779



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 510 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 559



to top

>emb|AL596181.10| Mouse DNA sequence from clone RP23-234K24 on chromosome 11 Contains nine
              novel genes, the Trpv2 for member 2 transient receptor
              potential cation channel subfamily V, the Ubb gene for
              ubiquitin B, the 3' end of the gene for the ortholog of
              human and rat phosphatidylinositol glycan class L PIGL and
              five CpG islands, complete sequence
          Length = 195339

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                     
Query: 65     tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 122010 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 121956



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 121777 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 121728



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 121549 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 121500



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
              ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 121321 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 121280



to top

>gb|DQ420617.1| Anser anser ubiquitin C II mRNA, complete cds
          Length = 1199

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 85  tcaacatgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 139



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 774 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 823



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 546 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 595



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 318 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 367



to top

>gb|DQ420616.1| Anser anser ubiquitin C I mRNA, complete cds
          Length = 1191

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 85  tcaacatgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 139



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 774 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 823



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 546 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 595



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 318 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 367



to top

>emb|CR621420.1| full-length cDNA clone CS0DE004YK08 of Placenta of Homo sapiens
           (human)
          Length = 2162

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 738 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 788



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 282 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 332



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 510 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 560



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 55  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 104



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1878 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1928



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1194 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1244



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1650 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1697



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1422 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1469



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 966  gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1013



to top

>dbj|AK097415.1| Homo sapiens cDNA FLJ40096 fis, clone TESTI2004080, highly similar
           to Homo sapiens mRNA for polyubiquitin UbC
          Length = 1864

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 652 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 702



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 424 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 474



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1564 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1614



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 85  aagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| ||||||||||||||||| |||||
Sbjct: 212 aagacactcactggcaagaccatcacccttgaggt 246



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 121 atgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 170



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1336 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1383



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1108 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1155



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 880 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 927



to top

>dbj|AK056939.1| Homo sapiens cDNA FLJ32377 fis, clone SKMUS1000014, highly similar
           to Polyubiquitin 9
          Length = 1300

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 661 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 711



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 433 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 483



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 68  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 117



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 889 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 936



to top

>dbj|AK132747.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4922505B09 product:ubiquitin B, full
           insert sequence
          Length = 1166

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 784 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 825



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 556 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 605



to top

>ref|NM_021009.3| Homo sapiens ubiquitin C (UBC), mRNA
          Length = 2418

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 962  gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 1012



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 506 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 556



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 734 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 784



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 279 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 328



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 2102 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 2152



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1418 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1468



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1874 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1921



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1646 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1693



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1190 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1237



to top

>dbj|AK165313.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
           library, clone:F430012C16 product:ubiquitin B, full
           insert sequence
          Length = 1159

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 327 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 376



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 783 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 824



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 555 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 604



to top

>dbj|AK160683.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3010009A18 product:Similar to
           polyubiquitin (Fragment) homolog [Bos taurus], full
           insert sequence
          Length = 821

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 92  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 146



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| || || |||||||||||||||||
Sbjct: 325 atgcagatcttcgtgaagaccctgacgggcaagaccatcaccct 368



to top

>dbj|AK168448.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920021C12 product:ubiquitin C, full
           insert sequence
          Length = 980

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 518 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 568



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 291 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 340



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 747 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 790



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 62  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 112



to top

>gb|AY057530.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, complete cds
          Length = 929

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 116



to top

>gb|AY054281.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, complete cds
          Length = 884

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 116



to top

>gb|AY052661.1| Arabidopsis thaliana AT4g05050/T32N4_13 mRNA, complete cds
          Length = 958

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 64  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 118



to top

>dbj|AK013873.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3000008M07 product:ubiquitin B, full
           insert sequence
          Length = 1162

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 93  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 147



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 326 atgcagatcttcgtgaagacccttaccggcaagaccatcaccct 369



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 782 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 823



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 554 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 603



to top

>dbj|AK010625.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410036G24 product:ubiquitin B, full insert
           sequence
          Length = 1160

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 784 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 825



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 556 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 605



to top

>dbj|AK010413.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410005G06 product:polyubiquitin 4, full insert
           sequence
          Length = 1165

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 96  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 150



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 329 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 378



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 785 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 826



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 557 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 606



to top

>dbj|AK003190.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001L13 product:ubiquitin B,
           full insert sequence
          Length = 932

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 556 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 597



to top

>dbj|AK088453.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430018A04
           product:ubiquitin polyprotein (heat shock related)
           (fragment) homolog [Gallus gallus], full insert sequence
          Length = 704

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 96  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 150



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 329 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 378



to top

>dbj|AK013027.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810407D23 product:ubiquitin B,
           full insert sequence
          Length = 1167

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 95  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 149



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 784 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 825



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 556 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 605



to top

>dbj|AK012443.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700055N04 product:ubiquitin B,
           full insert sequence
          Length = 1166

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 96  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 150



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 329 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 378



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 785 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 826



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 557 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 606



to top

>dbj|AK007273.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700124N12 product:ubiquitin B, full
           insert sequence
          Length = 1195

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 126 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 180



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 359 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 408



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 815 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 856



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 587 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 636



to top

>gb|AC126309.8| Homo sapiens 12 BAC RP11-592O2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 121984

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                 
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 105881 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 105831



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                                 
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 105425 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 105375



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                 
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 105653 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 105603



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 106108 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 106059



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 104969 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 104919



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                                 
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 104285 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 104235



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
              |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 105197 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 105150



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
              |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 104741 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 104694



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                              
Query: 69     gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
              |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 104513 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 104466



to top

>dbj|AB071067.1| Macaca fascicularis testis cDNA clone:QtsA-16192, similar to human
           ubiquitin B precursor ( UBB ), mRNA, NM_018955.1
          Length = 883

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 32  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcacccttgaggt 86



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 265 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 308



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| ||||| || || |||||||||||||||||||| |||||
Sbjct: 493 atgcagatcttcgtgaaaaccctgaccggcaagaccatcaccctggaggt 542



to top

>ref|XM_579662.1| PREDICTED: Rattus norvegicus similar to polyubiquitin (LOC497709),
           partial mRNA
          Length = 160

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 59  tcaaaatgcagatctttgtgaagaccctgactggcaagaccatcaccctggaggt 113



to top

>gb|AY086967.1| Arabidopsis thaliana clone 3001 mRNA, complete sequence
          Length = 929

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 62  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 116



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| || ||||| ||||| || ||||| ||||| || ||||||||
Sbjct: 295 atgcagatcttcgttaagactctcacsggaaagackatcactcttgaggtaga 347



to top

>gb|BC093445.1| Homo sapiens cDNA clone IMAGE:5284302, partial cds
          Length = 2207

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 751 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 801



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 295 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 345



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 523 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 573



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 68  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 117



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1891 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1941



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1207 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1257



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1663 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1710



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1435 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1482



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 979  gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1026



to top

>dbj|AB089615.1| Gorilla gorilla UbC gene for polyubiquitin C, complete cds
          Length = 1830

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccctcgaggt 1646



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1368 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1418



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 912 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 962



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 684 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 734



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 506



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 228 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 278



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 50



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 1140 gatgcagatcttcgtgaagaccctgactggtaagaccatcacccttgaggt 1190



to top

>dbj|AB089613.1| Homo sapiens UbC gene for polyubiquitin C, complete cds
          Length = 2058

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 684 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 734



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 228 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 278



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 456 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 506



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1   atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 50



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1824 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1874



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1140 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1190



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1596 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1643



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1368 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1415



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 912 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 959



to top

>dbj|AK098827.1| Homo sapiens cDNA FLJ25961 fis, clone TST09043, highly similar to
           Polyubiquitin UbC
          Length = 2191

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 751 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 801



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 295 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 345



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1891 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1941



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 523 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 573



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 68  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 117



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 979  gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 1026



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1435 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1485



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1207 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1257



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1663 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1710



to top

>dbj|AK026846.1| Homo sapiens cDNA: FLJ23193 fis, clone REC00306, highly similar to
           AF052164 Homo sapiens clone 24683 mRNA sequence
          Length = 1082

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 307 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 357



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 763 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 813



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 80  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 129



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 535 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 582



to top

>dbj|AK129749.1| Homo sapiens cDNA FLJ26238 fis, clone CBR05440, highly similar to
           Rattus norvegicus ubiquitin C (Ubc)
          Length = 2191

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 751 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 801



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 295 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 345



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 523 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 573



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 68  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 117



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1891 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1941



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1207 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1257



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1663 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1710



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1435 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1482



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 979  gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1026



to top

>gb|AY104762.1| Zea mays PCO089719 mRNA sequence
          Length = 721

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 101 tcaagatgcagatcttcgtgaagaccctgacgggaaagaccatcaccctcgaggt 155



to top

>gb|AC120412.12| Mus musculus chromosome 5, clone RP24-447P14, complete sequence
          Length = 149454

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 4378 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 4328



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3922 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3872



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 4605 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 4556



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 4149 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 4100



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3693 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3644



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3237 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3188



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 3009 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 2966



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 3466 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 3416



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 4834 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 4784



to top

>ref|NR_002875.1| Mus musculus gene model 1821, (NCBI) (Gm1821) on chromosome 14
          Length = 704

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 96  tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 150



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 329 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 378



to top

>dbj|D63782.1|CRUPUQ Cricetulus sp. gene for polyubiquitin, complete cds
          Length = 8730

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 7881 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 7931



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 6969 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 7019



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 6741 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 6791



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 6513 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 6563



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 6058 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 6107



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 7425 gatgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 7475



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||| ||||| || || ||||||||||||||||| |||||
Sbjct: 7197 gatgcagatctttgtaaagaccctgacaggcaagaccatcaccctggaggt 7247



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||| ||||| || || ||||||||||| ||||| |||||
Sbjct: 7653 gatgcagatctttgtaaagaccctgacaggcaagaccataaccctggaggt 7703



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || || || ||||||||||| |||||
Sbjct: 6285 gatgcagatctttgtgaagaccctgacagggaaaaccatcaccctggaggt 6335



to top

>dbj|AB003732.1| Cricetulus griseus gene for polyubiquitin, complete cds
          Length = 3273

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 3017 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 3067



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2561 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2611



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2333 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2383



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2105 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2155



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1877 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1927



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1421 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1471



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1193 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1243



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 965  gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1015



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 737 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 787



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 509 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 559



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 281 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 331



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 2789 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 2839



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 1649 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 1699



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 54  atgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 103



to top

>dbj|AB003731.1| Cricetulus griseus gene for polyubiquitin, complete cds
          Length = 2817

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2561 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2611



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2333 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2383



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2105 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2155



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1649 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1699



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1421 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1471



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1193 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1243



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 965  gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1015



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 737 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 787



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 509 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 559



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 1877 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 1927



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 281 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 331



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 54  atgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 103



to top

>dbj|AB003730.1| Homo sapiens gene for polyubiquitin, complete cds
          Length = 2291

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 1108 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 1158



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 652 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 702



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 2020 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 2070



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 880 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 930



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 425 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 474



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1564 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1614



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1336 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1383



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcac 110
            |||||||||||| |||||||| || || || |||||||||||
Sbjct: 1792 gatgcagatcttcgtgaagaccctgactggtaagaccatcac 1833



to top

>ref|NM_019639.3| Mus musculus ubiquitin C (Ubc), mRNA
          Length = 2779

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 721 gatgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 771



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2318 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2367



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1862 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1911



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1634 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1683



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1178 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1227



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 494 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 543



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 266 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 315



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 949 gatgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 999



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 2546 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 2587



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 2090 atgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 2139



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||||||||| || || || ||||||||||||||||| |||||
Sbjct: 1406 atgcagatctttgtgaaaaccctgacaggcaagaccatcaccctggaggt 1455



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 37  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 87



to top

>dbj|AB209782.1| Homo sapiens mRNA for ubiquitin C variant protein
          Length = 3996

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||||||||| || ||||||||||| ||||||||
Sbjct: 3012 gatgcagatcttcgtgaagacactcactggtaagaccatcactctcgaggt 3062



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 732 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 782



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 276 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 326



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1188 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1238



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 504 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 554



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 49  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 98



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 3696 gatgcaaatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 3746



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 2784 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 2834



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 2556 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 2606



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 2100 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 2150



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1872 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1922



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || |||||||||||||| |||||
Sbjct: 1644 gatgcagatcttcgtgaagaccctgactggtaagaccatcacccttgaggt 1694



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1416 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1466



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 960  gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1010



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 3468 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 3515



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 3240 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 3287



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 2328 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 2375



to top

>emb|X51703.1|MMUBIQU Mouse mRNA for ubiquitin
          Length = 1172

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 100 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 154



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 333 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 382



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 789 atgcagatcttcgtgaagaccctgaccggcaagaccatcacc 830



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 561 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 610



to top

>gb|M26880.1|HUMUBI13 Human ubiquitin mRNA, complete cds
          Length = 2309

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 1731 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 1781



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 363 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 413



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1503 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1553



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 136 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 185



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
           |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 591 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 638



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || |||||||| |||||||||||
Sbjct: 1959 gatgcagatcttcgtgaagaccctgactggtaagaccattaccctcgaggt 2009



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 819 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 869



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1275 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1322



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1047 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1094



to top

>gb|AC163692.4| Mus musculus BAC clone RP24-68H1 from chromosome 14, complete sequence
          Length = 224333

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                     
Query: 65     tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              |||| ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 146104 tcaaaatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 146050



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 145871 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 145822



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 70     atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
              ||||||||||| |||||||| || || ||||||||||||||||| |||||
Sbjct: 145643 atgcagatcttcgtgaagaccctgactggcaagaccatcaccctggaggt 145594



to top

>gb|L05362.1|ATHUBQB Arabidopsis thaliana (clone ubq11) polyubiquitin gene sequence
          Length = 871

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 50  tcaagatgcagatcttcgttaagactctcaccggaaagactatcaccctcgaggt 104



to top

>dbj|AB025001.1| Cicer arietinum mRNA for polyubiquitin, partial cds
          Length = 359

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 64  ctcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggtaga 122
           ||||||||||| ||||| ||||| || |||||||||||||| ||||| |||||||||||
Sbjct: 30  ctcaagatgcaaatcttcgtgaaaaccctcaccggcaagacaatcactctcgaggtaga 88



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| |||||||||||||| || |||||
Sbjct: 264 atgcagatcttcgtcaagaccctcacaggcaagaccatcactcttgaggt 313



to top

>dbj|D63791.1|HUMPOLYUBI Human UbC gene for polyubiquitin, exon1-2, partial cds
          Length = 6605

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 5456 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 5506



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 5000 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 5050



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 5228 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 5278



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 4773 atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 4822



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 5684 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 5731



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 6368 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 6415



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 6140 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 6187



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgagg 118
            |||||||||||| |||||||| || || || ||||| ||||| |||||||
Sbjct: 5912 gatgcagatcttcgtgaagaccctgactggtaagacgatcactctcgagg 5961



to top

>dbj|AB009010.1| Homo sapiens mRNA for polyubiquitin UbC, complete cds
          Length = 2192

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 752 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 802



 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||| ||||| |||||||||||||| ||||||||||||||||| |||||
Sbjct: 296 gatgcaaatcttcgtgaagacactcactggcaagaccatcacccttgaggt 346



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 1892 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 1942



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcgaggt 574



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 69  atgcagatcttcgtgaagactctgactggtaagaccatcaccctcgaggt 118



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtgaagaccctgactggtaagaccatcaccctcga 1027



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||| |||||||| || || || ||||||||||| ||||||||
Sbjct: 1208 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcgaggt 1258



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1664 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1711



 Score = 48.1 bits (24), Expect = 0.006
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                            
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcga 116
            |||||||||||| |||||||| || || || ||||||||||| |||||
Sbjct: 1436 gatgcagatcttcgtgaagaccctgactggtaagaccatcactctcga 1483



to top

>gb|DQ216251.1| Taeniopygia guttata clone 0063P0020H09 ubiquitin C variant 10-like
           mRNA, complete sequence
          Length = 716

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 142 atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 191



to top

>gb|DQ216250.1| Taeniopygia guttata clone 0058P0027F01 ubiquitin C variant 9-like
           mRNA, complete sequence
          Length = 1074

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatca 109
           |||||||||||| |||||||| || ||||||||||||||||
Sbjct: 296 gatgcagatcttcgtgaagaccctgaccggcaagaccatca 336



 Score = 50.1 bits (25), Expect = 0.001
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgactggcaagaccatcaccct 568



to top

>gb|DQ216248.1| Taeniopygia guttata clone 0058P0029E05 ubiquitin C variant 8-like
           mRNA, complete sequence
          Length = 1378

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 69   gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||| |||||||| || || |||||||||||||||||
Sbjct: 980  gatgcagatcttcgtgaagaccctgactggcaagaccatcaccct 1024



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| || ||||| || ||||||||||||||||||||
Sbjct: 524 gatgcagatcttcgtcaagaccctgaccggcaagaccatcaccct 568



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 752 gatgcagatcttcgtcaagaccctgaccggcaagaccatcactcttgaggt 802



 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 69  gatgcagatctttgtgaagac 89
           |||||||||||||||||||||
Sbjct: 296 gatgcagatctttgtgaagac 316



to top

>gb|DQ216237.1| Taeniopygia guttata clone 0058P0020B09 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1346

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgactggcaagaccatcaccct 568



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||| ||||||||||| || || |||||||||||||||||
Sbjct: 752 gatgcagatttttgtgaagaccctgactggcaagaccatcaccct 796



to top

>gb|DQ216234.1| Taeniopygia guttata clone 0058P0013A07 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1347

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgactggcaagaccatcaccct 568



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||| ||||||||||| || || |||||||||||||||||
Sbjct: 752 gatgcagatttttgtgaagaccctgactggcaagaccatcaccct 796



to top

>gb|DQ216233.1| Taeniopygia guttata clone 0063P0008C04 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1305

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgactggcaagaccatcaccct 568



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||||||| |||||||| || || |||||||||||||||
Sbjct: 752 gatgcagatcttcgtgaagaccctgactggcaagaccatcacc 794



to top

>gb|DQ216232.1| Taeniopygia guttata clone 0058P0060G06 ubiquitin C variant 1-like
           mRNA, complete sequence
          Length = 1306

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 69  atgcagatctttgtgaagaccctgactggcaagaccatcacccttgaggt 118



 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||||||||||||| || || |||||||||||||||||
Sbjct: 524 gatgcagatctttgtgaagaccctgactggcaagaccatcaccct 568



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| ||||| || || ||||||||||||||||| ||||||||
Sbjct: 296 gatgcagatcttcgtgaaaaccctgaccggcaagaccatcactctcgaggt 346



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||| |||||||| || || |||||||||||||||||
Sbjct: 753 gatgcagatcttcgtgaagaccctgactggcaagaccatcaccct 797



to top

>gb|BT018987.1| Zea mays clone Contig444.F mRNA sequence
          Length = 668

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 66  caagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||| |||||||| || || || ||||||||||||||||||||
Sbjct: 610 caagatgcagatcttcgtgaagacgctgacagggaagaccatcaccctcgaggt 557



to top

>gb|BT016494.1| Zea mays clone Contig327 mRNA sequence
          Length = 974

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 296 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 345



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 51/56 (91%), Gaps = 1/56 (1%)
 Strand = Plus / Plus

                                                                   
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcac-cctcgaggt 119
           |||||||||||||||||||||| || || ||||||||||| ||||| |||||||||
Sbjct: 62  tcaagatgcagatctttgtgaaaaccctgaccggcaagactatcactcctcgaggt 117



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||| || ||||||||||||||
Sbjct: 524 atgcagatcttcgtgaagaccctgaccggcaaaactatcaccctcgaggt 573



to top

>gb|BT016274.1| Zea mays clone Contig107 mRNA sequence
          Length = 1486

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| || || ||||||||||| ||||||||||||||
Sbjct: 564 atgcagatctttgtgaaaaccctgaccggcaagactatcaccctcgaggt 613



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           ||||||||||| ||||||||| | || |||||||||||||||
Sbjct: 792 atgcagatcttcgtgaagacattgactggcaagaccatcacc 833



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || || || ||||| ||||| |||||
Sbjct: 1020 atgcagatctttgtgaagaccctgactggaaaaaccataaccctggaggt 1069



to top

>gb|AY751539.1| Cloning vector pHUE, complete sequence
          Length = 5942

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 168 atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 217



to top

>gb|AF517839.1| Triticum aestivum ubiquitin protein mRNA, partial cds
          Length = 204

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||| ||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 1   atgcagatttttgtaaagaccctcaccggcaagaccatcaccctggaggt 50



to top

>gb|BC070919.1| Rattus norvegicus polyubiquitin, mRNA (cDNA clone MGC:91487
           IMAGE:7104905), complete cds
          Length = 1170

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 757 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 806



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 529 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 578



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 301 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 350



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||| ||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 68  tcaaaatgcaaatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 122



to top

>gb|BC060312.1| Rattus norvegicus polyubiquitin, mRNA (cDNA clone MGC:72686
           IMAGE:6919609), complete cds
          Length = 1199

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 787 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 836



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 559 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 608



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 331 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 380



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 65  tcaagatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| ||||| ||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 98  tcaaaatgcaaatcttcgtgaagaccctgaccggcaagaccatcaccctagaggt 152



to top

>ref|NM_001033930.1| Homo sapiens ubiquitin A-52 residue ribosomal protein fusion
           product 1 (UBA52), transcript variant 1, mRNA
          Length = 2823

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 115 atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 164



to top

>ref|NM_003333.3| Homo sapiens ubiquitin A-52 residue ribosomal protein fusion
           product 1 (UBA52), transcript variant 2, mRNA
          Length = 2801

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 93  atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 142



to top

>gb|AY563026.1| Ovis aries ubiqitin RPL40 fusion protein mRNA, complete cds
          Length = 484

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 1   atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 50



to top

>ref|XM_001001919.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 3 (Ubc),
           mRNA
          Length = 794

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 550 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 599



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 321 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 371



to top

>ref|XM_001001949.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 8 (Ubc),
           mRNA
          Length = 1354

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 882 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 931



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 1110 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 1151



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 653 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 703



to top

>ref|XM_001001988.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 4 (Ubc),
           mRNA
          Length = 1250

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 778 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 827



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 550 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 599



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 1006 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 1047



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 321 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 371



to top

>ref|XM_001002029.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 18 (Ubc),
            mRNA
          Length = 2266

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1794 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1843



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1566 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1615



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1338 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1387



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1110 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1159



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 882 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 931



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 2022 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 2063



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 653 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 703



to top

>ref|XM_001002019.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 25 (Ubc),
            mRNA
          Length = 1676

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1204 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1253



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 976  atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1025



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 748 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 797



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 520 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 569



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 292 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 341



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 1432 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 1473



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 63  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 113



to top

>ref|XM_001002053.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 22 (Ubc),
            mRNA
          Length = 1931

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1459 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1508



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1231 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1280



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1003 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1052



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 775 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 824



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 547 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 596



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 319 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 368



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 1687 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 1728



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 90  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 140



to top

>ref|XM_001002045.1| PREDICTED: Mus musculus ubiquitin C, transcript variant 29 (Ubc),
            mRNA
          Length = 2494

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2022 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2071



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1794 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1843



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1566 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1615



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1338 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1387



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1110 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1159



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 882 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 931



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                      
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
            |||||||||||||||||||| || || |||||||||||||||
Sbjct: 2250 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 2291



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 653 gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 703



to top

>gb|DQ479851.1| Homo sapiens ubiquitin A-52 residue ribosomal protein fusion product
            1 (UBA52) gene, complete cds
          Length = 9411

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 3253 atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 3302



to top

>emb|CR731853.1|CNS0GRN6 Tetraodon nigroviridis full-length cDNA
          Length = 877

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| |||||||||||||||||||||||
Sbjct: 527 atgcagatcttcgtcaagaccctcactggcaagaccatcaccctcgaggt 576



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 299 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 348



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 71  atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 120



to top

>emb|CR730909.2|CNS0GQWY Tetraodon nigroviridis full-length cDNA
          Length = 686

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 463 atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 512



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || || ||||| |||||||||||||||||
Sbjct: 2   atgcagatctttgtcaagacccttactggcaaaaccatcaccctcgaggt 51



 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgag 117
           |||||||||||||| ||||| || || ||||| |||||||||||||||
Sbjct: 233 atgcagatctttgtaaagacccttactggcaaaaccatcaccctcgag 280



to top

>emb|CR729835.2|CNS0GQ35 Tetraodon nigroviridis full-length cDNA
          Length = 503

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 297 atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 346



 Score = 38.2 bits (19), Expect = 5.6
 Identities = 44/51 (86%), Gaps = 1/51 (1%)
 Strand = Plus / Plus

                                                              
Query: 70  atgcagatctttgtgaagacactcaccggcaaga-ccatcaccctcgaggt 119
           ||||||||||| || ||||| || || ||||| | ||||||||||||||||
Sbjct: 68  atgcagatcttcgtcaagacccttactggcaaaagccatcaccctcgaggt 118



to top

>emb|CR728830.2|CNS0GPB8 Tetraodon nigroviridis full-length cDNA
          Length = 755

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 532 atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 581



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 304 atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 353



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 76  atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 125



to top

>emb|CR725973.2|CNS0GN3V Tetraodon nigroviridis full-length cDNA
          Length = 799

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 230 atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 279



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| || || ||||| |||||||||||||||||
Sbjct: 458 atgcagatctttgtcaagacccttactggcaaaaccatcaccctcgaggt 507



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 2   atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 51



to top

>emb|CR725532.2|CNS0GMRM Tetraodon nigroviridis full-length cDNA
          Length = 753

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 530 atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 579



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||| | ||||| ||||| ||||| |||||||||||||||||
Sbjct: 302 atgcagatctttttcaagaccctcactggcaaaaccatcaccctcgaggt 351



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| || ||||| ||||| ||||| |||||||||||||||||
Sbjct: 72  atgcagatcttcgtcaagaccctcactggcaaaaccatcaccctcgaggt 121



to top

>gb|BC008661.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:3598724), complete
           cds
          Length = 777

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 301 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 350



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 529 atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 572



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 72  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 122



to top

>gb|BC025894.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:5055216), complete
           cds
          Length = 1213

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 738 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 787



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 282 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 331



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
            |||||||||||||||||||| || || |||||||||||||||||
Sbjct: 966  atgcagatctttgtgaagaccctgacaggcaagaccatcaccct 1009



 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||||||| || || ||||| ||||||||||| |||||
Sbjct: 509 gatgcagatctttgtgaagaccctgacaggcaaaaccatcaccctggaggt 559



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 53  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 103



to top

>gb|BC036303.1| Mus musculus ubiquitin C, mRNA (cDNA clone IMAGE:2645223), complete
           cds
          Length = 1193

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 490 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 539



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 262 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 311



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcacc 111
           |||||||||||||||||||| || || |||||||||||||||
Sbjct: 946 atgcagatctttgtgaagaccctgacaggcaagaccatcacc 987



 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || |||||||| |||||||| |||||
Sbjct: 718 atgcagatctttgtgaagaccctgacaggcaagactatcaccctggaggt 767



 Score = 46.1 bits (23), Expect = 0.023
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 69  gatgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 33  gatgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 83



to top

>ref|XM_858590.1| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 3 (LOC479513), mRNA
          Length = 743

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 328 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 377



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 100 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 149



to top

>ref|XM_536651.2| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 1 (LOC479513), mRNA
          Length = 881

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 466 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 515



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 238 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 287



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||| ||||| || || |||||||||||||||||||| |||||
Sbjct: 10  atgccgatcttcgtgaaaaccctaaccggcaagaccatcaccctggaggt 59



to top

>ref|XM_858547.1| PREDICTED: Canis familiaris similar to ubiquitin B precursor,
           transcript variant 2 (LOC479513), mRNA
          Length = 707

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 314 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaggt 363



 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccct 113
           ||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 230 atgcagatcttcgtgaagaccctgaccggcaagaccatcaccct 273



 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||| |||||| ||||| || || |||||||||||||||||||| |||||
Sbjct: 2   atgccgatcttcgtgaaaaccctaaccggcaagaccatcaccctggaggt 51



to top

>emb|CR685693.2|CNS0FS15 Tetraodon nigroviridis full-length cDNA
          Length = 866

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||| ||||| ||||| ||||| |||||||||||||||||
Sbjct: 66  atgcagatctttgtcaagaccctcactggcaaaaccatcaccctcgaggt 115



to top

>gb|BC062397.1| Rattus norvegicus cDNA clone IMAGE:5623273, **** WARNING: chimeric
            clone ****
          Length = 3040

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2558 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2607



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2330 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2379



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 2102 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 2151



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1874 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1923



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1646 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1695



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1418 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1467



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 1190 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1239



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                              
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
            |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 962  atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 1011



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 734 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 783



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 506 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 555



 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| || || ||||||||||||||||| |||||
Sbjct: 278 atgcagatctttgtgaagaccctgacaggcaagaccatcaccctggaggt 327



 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                     
Query: 70   atgcagatctttgtgaagacactcaccggcaagaccatcac 110
            |||||||||||||||||||| || || ||||||||||||||
Sbjct: 2786 atgcagatctttgtgaagaccctgacaggcaagaccatcac 2826



 Score = 44.1 bits (22), Expect = 0.092
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           ||||||||||||||||| ||  | || || |||||||||||||| |||||
Sbjct: 50  atgcagatctttgtgaaaaccttaactggtaagaccatcaccctggaggt 99



to top

>gb|BC019044.1| Homo sapiens cDNA clone IMAGE:4635339, **** WARNING: chimeric clone
           ****
          Length = 2503

 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 70  atgcagatctttgtgaagacactcaccggcaagaccatcaccctcgaggt 119
           |||||||||||||||||||| ||||| ||||| ||||||||||| |||||
Sbjct: 723 atgcagatctttgtgaagaccctcactggcaaaaccatcacccttgaggt 674


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 823,273
Number of Sequences: 3902068
Number of extensions: 823273
Number of successful extensions: 66743
Number of sequences better than 10.0: 1904
Number of HSP's better than 10.0 without gapping: 1925
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 59242
Number of HSP's gapped (non-prelim): 7062
length of query: 122
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 101
effective length of database: 17,151,101,840
effective search space: 1732261285840
effective search space used: 1732261285840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top