ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet49g03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF363918.1| Oryza officinalis clone 9-5 25S ribosomal RNA gen... 80 5e-13
2gb|AF363917.1| Oryza australiensis clone 12-17 25S ribosomal RNA... 80 5e-13
3gb|AF363916.1| Oryza granulata clone 16-4 25S ribosomal RNA gene... 80 5e-13
4gb|AF363915.1| Oryza granulata clone 16-18 25S ribosomal RNA gen... 80 5e-13
5gb|AF363909.1| Oryza longistaminata clone 4-2 25S ribosomal RNA ... 80 5e-13
6gb|AF363900.1| Oryza ridleyi clone 8-13 25S ribosomal RNA gene, ... 80 5e-13
7gb|AF363899.1| Oryza malampuzhaensis clone 10-8 25S ribosomal RN... 80 5e-13
8gb|AF363898.1| Oryza malampuzhaensis clone 10-31 25S ribosomal R... 80 5e-13
9gb|AF363892.1| Oryza granulata clone 16-3 25S ribosomal RNA gene... 80 5e-13
10gb|AF363891.1| Oryza longistaminata clone 4-29 25S ribosomal RNA... 80 5e-13
11gb|AF363890.1| Oryza longistaminata clone 4-4 25S ribosomal RNA ... 80 5e-13
12gb|AF363889.1| Oryza officinalis clone 9Nep-5 25S ribosomal RNA ... 80 5e-13
13gb|AF363888.1| Oryza officinalis clone 9Nep-15 25S ribosomal RNA... 80 5e-13
14gb|AF363887.1| Oryza officinalis clone 9Nep-29 25S ribosomal RNA... 80 5e-13
15gb|AF363886.1| Oryza officinalis clone 9Nep-1 25S ribosomal RNA ... 80 5e-13
16gb|AF363885.1| Oryza officinalis clone 9Nep-9 25S ribosomal RNA ... 80 5e-13
17gb|AF363884.1| Oryza officinalis clone 9Nep-24 25S ribosomal RNA... 80 5e-13
18gb|AF363883.1| Oryza officinalis clone 9Nep-18 25S ribosomal RNA... 80 5e-13
19gb|AF363882.1| Oryza officinalis clone 9-14 25S ribosomal RNA ge... 80 5e-13
20gb|AF363881.1| Oryza officinalis clone 9-28 25S ribosomal RNA ge... 80 5e-13
21gb|AF363880.1| Oryza officinalis clone 9-12 25S ribosomal RNA ge... 80 5e-13
22gb|AF363879.1| Oryza granulata clone 16-7 25S ribosomal RNA gene... 80 5e-13
23gb|AF363878.1| Oryza granulata clone 16-22 25S ribosomal RNA gen... 80 5e-13
24gb|AF363876.1| Oryza glaberrima clone 1-29 25S ribosomal RNA gen... 80 5e-13
25gb|AF363875.1| Oryza punctata clone 5-27 25S ribosomal RNA gene,... 80 5e-13
26gb|AF363874.1| Oryza glaberrima clone 1-5 25S ribosomal RNA gene... 80 5e-13
27gb|AF363873.1| Oryza nivara clone 15-3 25S ribosomal RNA gene, p... 80 5e-13
28gb|AF363872.1| Oryza nivara clone 15-34 25S ribosomal RNA gene, ... 80 5e-13
29gb|AF363871.1| Oryza australiensis clone 12-29 25S ribosomal RNA... 80 5e-13
30gb|AF363870.1| Oryza australiensis clone 12-1 25S ribosomal RNA ... 80 5e-13
31gb|AF363869.1| Oryza malampuzhaensis clone 10-49 25S ribosomal R... 80 5e-13
32gb|AF363868.1| Oryza rufipogon clone 7-9 25S ribosomal RNA gene,... 80 5e-13
33gb|AF363867.1| Oryza grandiglumis clone 14-7 25S ribosomal RNA g... 80 5e-13
34gb|AF363866.1| Oryza glaberrima clone 1-20 25S ribosomal RNA gen... 80 5e-13
35gb|AF363865.1| Oryza punctata clone 5-21 25S ribosomal RNA gene,... 80 5e-13
36gb|AF363864.1| Oryza glaberrima clone 1-22 25S ribosomal RNA gen... 80 5e-13
37gb|AF363863.1| Oryza punctata clone 5-13 25S ribosomal RNA gene,... 80 5e-13
38gb|AF363862.1| Oryza glaberrima clone 1-11 25S ribosomal RNA gen... 80 5e-13
39gb|AF363861.1| Oryza glaberrima clone 1-13 25S ribosomal RNA gen... 80 5e-13
40gb|AF363860.1| Oryza alta clone 11-31 25S ribosomal RNA gene, pa... 80 5e-13
41gb|AF363859.1| Oryza australiensis clone 12-23 25S ribosomal RNA... 80 5e-13
42gb|AF363858.1| Oryza nivara clone 15-18 25S ribosomal RNA gene, ... 80 5e-13
43gb|AF363857.1| Oryza nivara clone 15-4 25S ribosomal RNA gene, p... 80 5e-13
44gb|AF363856.1| Oryza rufipogon clone 7-19 25S ribosomal RNA gene... 80 5e-13
45gb|AF363855.1| Oryza malampuzhaensis clone 10-55 25S ribosomal R... 80 5e-13
46gb|AF363854.1| Oryza grandiglumis clone 14-14 25S ribosomal RNA ... 80 5e-13
47gb|AF363853.1| Oryza malampuzhaensis clone 10-21 25S ribosomal R... 80 5e-13
48gb|AF363850.1| Oryza rufipogon clone 7-20 25S ribosomal RNA gene... 80 5e-13
49gb|AF363849.1| Oryza rufipogon clone 7-30 25S ribosomal RNA gene... 80 5e-13
50gb|AF363848.1| Oryza rufipogon clone 7-22 25S ribosomal RNA gene... 80 5e-13
51gb|AF363847.1| Oryza rufipogon clone 7-7 25S ribosomal RNA gene,... 80 5e-13
52gb|AF363846.1| Oryza rufipogon clone 7-18 25S ribosomal RNA gene... 80 5e-13
53gb|AF363845.1| Oryza sativa subsp. indica clone IR36-16 25S ribo... 80 5e-13
54gb|AF363844.1| Oryza sativa subsp. indica clone IR36-2 25S ribos... 80 5e-13
55gb|AF363843.1| Oryza sativa subsp. indica clone IR36-10 25S ribo... 80 5e-13
56gb|AF363842.1| Oryza sativa subsp. indica clone IR36-13 25S ribo... 80 5e-13
57gb|AF363841.1| Oryza officinalis clone 9Nep-31 25S ribosomal RNA... 80 5e-13
58gb|AF363839.1| Oryza grandiglumis clone 14-17 25S ribosomal RNA ... 80 5e-13
59gb|AF363838.1| Oryza latifolia clone 6-61 25S ribosomal RNA gene... 80 5e-13
60gb|AF363837.1| Oryza latifolia clone 6-27 25S ribosomal RNA gene... 80 5e-13
61gb|AF363836.1| Oryza sativa subsp. indica clone IR36-9 25S ribos... 80 5e-13
62gb|AF363835.1| Oryza latifolia clone 6-6 25S ribosomal RNA gene,... 80 5e-13
63gb|AF375551.1| Oryza glaberrima clone 1-6 25S ribosomal RNA gene... 80 5e-13
64gb|AF375550.1| Oryza glaberrima clone 1-28 25S ribosomal RNA gen... 80 5e-13
65gb|AY752478.1| Microlaena polynoda 18S ribosomal RNA gene, parti... 80 5e-13
66gb|AY752477.1| Microlaena avenacea 18S ribosomal RNA gene, parti... 80 5e-13
67gb|AY237880.1| Dupontia fisheri c14 00-8-14 18S ribosomal RNA ge... 80 5e-13
68gb|AY237875.1| Dupontia fisheri c1 00-8-13 18S ribosomal RNA gen... 80 5e-13
69gb|AY237874.1| Dupontia fisheri c10 00-6-1 18S ribosomal RNA gen... 80 5e-13
70gb|AY237873.1| Dupontia fisheri c8 00-6-1 18S ribosomal RNA gene... 80 5e-13
71gb|AY237872.1| Dupontia fisheri c5 00-6-1 18S ribosomal RNA gene... 80 5e-13
72gb|AY237871.1| Dupontia fisheri c3 00-6-1 18S ribosomal RNA gene... 80 5e-13
73gb|AY237870.1| Dupontia fisheri c1 00-6-1 18S ribosomal RNA gene... 80 5e-13
74gb|AY237869.1| Dupontia fisheri c5 6954-7 18S ribosomal RNA gene... 80 5e-13
75gb|AY237868.1| Dupontia fisheri c3 6954-7 18S ribosomal RNA gene... 80 5e-13
76gb|AY237867.1| Dupontia fisheri c2 6954-7 18S ribosomal RNA gene... 80 5e-13
77gb|AY237866.1| Dupontia fisheri c1 6954-7 18S ribosomal RNA gene... 80 5e-13
78gb|AY237865.1| Dupontia fisheri c4 00-11-2 18S ribosomal RNA gen... 80 5e-13
79gb|AY237864.1| Dupontia fisheri c3 00-11-2 18S ribosomal RNA gen... 80 5e-13
80gb|AY237863.1| Dupontia fisheri c2 00-11-2 18S ribosomal RNA gen... 80 5e-13
81gb|AY237862.1| Dupontia fisheri c1 00-11-2 18S ribosomal RNA gen... 80 5e-13
82gb|AY237861.1| Dupontia fisheri c3 00-7-2 18S ribosomal RNA gene... 80 5e-13
83gb|AY237860.1| Dupontia fisheri c2 00-7-2 18S ribosomal RNA gene... 80 5e-13
84gb|AY237859.1| Dupontia fisheri c1 00-7-2 18S ribosomal RNA gene... 80 5e-13
85gb|AY237858.1| Dupontia fisheri c4 RB00-166 18S ribosomal RNA ge... 80 5e-13
86gb|AY237857.1| Dupontia fisheri c3 RB00-166 18S ribosomal RNA ge... 80 5e-13
87gb|AY237856.1| Dupontia fisheri c2 RB00-166 18S ribosomal RNA ge... 80 5e-13
88gb|AY237855.1| Dupontia fisheri c1 RB00-166 18S ribosomal RNA ge... 80 5e-13
89gb|AY237854.1| Dupontia fisheri c2 6954-10 18S ribosomal RNA gen... 80 5e-13
90gb|AY237853.1| Dupontia fisheri c1 6954-10 18S ribosomal RNA gen... 80 5e-13
91gb|AY237852.1| Dupontia fisheri c3 03/12-1 18S ribosomal RNA gen... 80 5e-13
92gb|AY237851.1| Dupontia fisheri c2 03/12-1 18S ribosomal RNA gen... 80 5e-13
93gb|AY237850.1| Dupontia fisheri c1 03/12-1 18S ribosomal RNA gen... 80 5e-13
94gb|AY237849.1| Dupontia fisheri c3 01/11-1 18S ribosomal RNA gen... 80 5e-13
95gb|AY237848.1| Dupontia fisheri c2 01/11-1 18S ribosomal RNA gen... 80 5e-13
96gb|AY237847.1| Dupontia fisheri c1 01/11-1 18S ribosomal RNA gen... 80 5e-13
97gb|AY237846.1| Deschampsia flexuosa 00-14-1 18S ribosomal RNA ge... 80 5e-13
98gb|AY237843.1| Arctagrostis latifolia 6586 18S ribosomal RNA gen... 80 5e-13
99gb|AY237832.1| Arctophila fulva 00-9-17 18S ribosomal RNA gene, ... 80 5e-13
100gb|AY237831.1| Arctophila fulva 00-9-15 18S ribosomal RNA gene, ... 80 5e-13
101gb|AY705899.1| Elymus tenuis voucher AK282069 18S ribosomal RNA ... 80 5e-13
102gb|AY705898.1| Elymus sacandros voucher AK286643 18S ribosomal R... 80 5e-13
103gb|AY705897.1| Elymus apricus voucher AK286417 18S ribosomal RNA... 80 5e-13
104gb|AY705896.1| Elymus falcis voucher AK286908 18S ribosomal RNA ... 80 5e-13
105gb|AY705895.1| Elymus solandri voucher AK281159 18S ribosomal RN... 80 5e-13
106gb|AY705894.1| Elymus multiflorus voucher AK282082 18S ribosomal... 80 5e-13
107gb|AY686655.1| Poa ramosissima voucher AK282001 18S ribosomal RN... 80 5e-13
108gb|AY559123.1| Hookerochloa hookeriana voucher MEL 2123239 18S r... 80 5e-13
109gb|AY559122.1| Festucella eriopoda voucher MEL 305017 18S riboso... 80 5e-13
110gb|AY129731.1| Panicum whitei internal transcribed spacer 1, 5.8... 80 5e-13
111gb|AY129725.1| Panicum subalbidum internal transcribed spacer 1,... 80 5e-13
112gb|AY129724.1| Panicum stapfianum internal transcribed spacer 1,... 80 5e-13
113gb|AY129723.1| Panicum schinzii internal transcribed spacer 1, 5... 80 5e-13
114gb|AY129722.1| Panicum repens internal transcribed spacer 1, 5.8... 80 5e-13
115gb|AY129721.1| Panicum queenslandicum internal transcribed space... 80 5e-13
116gb|AY129718.1| Panicum natalense internal transcribed spacer 1, ... 80 5e-13
117gb|AY129716.1| Panicum miliaceum from Turkey internal transcribe... 80 5e-13
118gb|AY129715.1| Panicum miliaceum from China internal transcribed... 80 5e-13
119gb|AY129714.1| Panicum miliaceum from Bulgaria internal transcri... 80 5e-13
120gb|AY129713.1| Panicum miliaceum from Australia internal transcr... 80 5e-13
121gb|AY129712.1| Panicum maximum internal transcribed spacer 1, 5.... 80 5e-13
122gb|AY129710.1| Panicum lanipes internal transcribed spacer 1, 5.... 80 5e-13
123gb|AY129708.1| Panicum grumosum internal transcribed spacer 1, 5... 80 5e-13
124gb|AY129707.1| Panicum dregeanum internal transcribed spacer 1, ... 80 5e-13
125gb|AY129704.1| Panicum decompositum internal transcribed spacer ... 80 5e-13
126gb|AY129701.1| Panicum coloratum var. coloratum internal transcr... 80 5e-13
127gb|AY129699.1| Panicum bulbosum internal transcribed spacer 1, 5... 80 5e-13
128gb|AY129691.1| Homopholis proluta internal transcribed spacer 1,... 80 5e-13
129dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
130dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
131dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
132dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
133dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
134dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic D... 80 5e-13
135dbj|AK108164.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-13
136dbj|AK063745.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 5e-13
137gb|M19228.1|RICRRM O.sativa 28S large subunit rRNA, 5' end 80 5e-13
138gb|M16845.1|RICRGSBHA Rice gene encoding three ribosomal RNA's: ... 80 5e-13
139gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene 80 5e-13
140gb|AY049797.1| Pyxidanthera barbulata internal transcribed space... 76 7e-12
141emb|AJ550613.1|SRE550613 Sutera revoluta ITS1, 5.8S rRNA gene an... 74 3e-11
142gb|AF479100.1| Shepherdia canadensis 26S ribosomal RNA gene, com... 74 3e-11
143gb|AF363922.1| Oryza latifolia clone 3-5 25S ribosomal RNA gene,... 72 1e-10
144gb|AF363921.1| Oryza latifolia clone 3-3 25S ribosomal RNA gene,... 72 1e-10
145gb|AF363897.1| Oryza latifolia clone 6-80 25S ribosomal RNA gene... 72 1e-10
146gb|AF363852.1| Oryza grandiglumis clone 14-16 25S ribosomal RNA ... 72 1e-10
147gb|AF363851.1| Oryza grandiglumis clone 14-11 25S ribosomal RNA ... 72 1e-10
148gb|AF363840.1| Oryza latifolia clone 6-79 25S ribosomal RNA gene... 72 1e-10
149gb|AY548197.1| Adenophora remotiflora 18S ribosomal RNA gene, pa... 72 1e-10
150gb|AY460568.1| Henriettea succosa 18S ribosomal RNA gene, partia... 72 1e-10
151gb|AY460567.1| Henriettella rimosa 18S ribosomal RNA gene, parti... 72 1e-10
152gb|AY460565.1| Henriettea spruceana 18S ribosomal RNA gene, part... 72 1e-10
153gb|AY460564.1| Henriettea martiusii 18S ribosomal RNA gene, part... 72 1e-10
154gb|AY460469.1| Clidemia alternifolia 18S ribosomal RNA gene, par... 72 1e-10
155gb|DQ217771.1| Salix matsudana isolate HLJ 18S ribosomal RNA gen... 72 1e-10
156gb|AY483213.1| Besseya wyomingensis internal transcribed spacer ... 72 1e-10
157gb|AY483211.1| Besseya bullii internal transcribed spacer 1, par... 72 1e-10
158gb|AY483208.1| Besseya plantaginea internal transcribed spacer 1... 72 1e-10
159gb|AY483207.1| Besseya wyomingensis internal transcribed spacer ... 72 1e-10
160gb|AY483206.1| Besseya wyomingensis internal transcribed spacer ... 72 1e-10
161gb|AY483204.1| Besseya wyomingensis internal transcribed spacer ... 72 1e-10
162gb|AY483203.1| Besseya wyomingensis internal transcribed spacer ... 72 1e-10
163gb|AY483202.1| Synthyris lanuginosa internal transcribed spacer ... 72 1e-10
164gb|AY483201.1| Besseya rubra internal transcribed spacer 1, part... 72 1e-10
165gb|AY483200.1| Synthyris missurica subsp. stellata internal tran... 72 1e-10
166gb|AY483193.1| Synthyris schizantha internal transcribed spacer ... 72 1e-10
167gb|AY483185.1| Synthyris canbyi internal transcribed spacer 1, p... 72 1e-10
168gb|BT016655.1| Zea mays clone Contig488 mRNA sequence 72 1e-10
169gb|AY752488.1| Trisetum youngii 18S ribosomal RNA gene, partial ... 72 1e-10
170gb|AY752487.1| Trisetum tenellum 18S ribosomal RNA gene, partial... 72 1e-10
171gb|AY752486.1| Trisetum spicatum 18S ribosomal RNA gene, partial... 72 1e-10
172gb|AY752485.1| Trisetum drucei 18S ribosomal RNA gene, partial s... 72 1e-10
173gb|AY752482.1| Rytidosperma setifolium 18S ribosomal RNA gene, p... 72 1e-10
174gb|AY752480.1| Rytidosperma petrosum 18S ribosomal RNA gene, par... 72 1e-10
175gb|AY752476.1| Deschampsia chapmanii 18S ribosomal RNA gene, par... 72 1e-10
176gb|AY752475.1| Deschampsia tenella 18S ribosomal RNA gene, parti... 72 1e-10
177gb|AY724700.1| Synthyris laciniata isolate Streit10 internal tra... 72 1e-10
178gb|AY724696.1| Synthyris pinnatifida isolate Streit8 internal tr... 72 1e-10
179gb|AY237885.1| Dupontia fisheri c12 00-8-1 18S ribosomal RNA gen... 72 1e-10
180gb|AY237884.1| Dupontia fisheri c9 00-8-1 18S ribosomal RNA gene... 72 1e-10
181gb|AY237883.1| Dupontia fisheri c7 00-8-1 18S ribosomal RNA gene... 72 1e-10
182gb|AY237882.1| Dupontia fisheri c5 00-8-1 18S ribosomal RNA gene... 72 1e-10
183gb|AY237881.1| Dupontia fisheri c1 00-8-1 18S ribosomal RNA gene... 72 1e-10
184gb|AY237878.1| Dupontia fisheri c11 00-8-13 18S ribosomal RNA ge... 72 1e-10
185gb|AY237877.1| Dupontia fisheri c9 00-8-13 18S ribosomal RNA gen... 72 1e-10
186gb|AY237876.1| Dupontia fisheri c2 00-8-13 18S ribosomal RNA gen... 72 1e-10
187gb|AY237845.1| Deschampsia alpina 00-11-20 18S ribosomal RNA gen... 72 1e-10
188gb|AY237844.1| Deschampsia sukatschewii subsp. borealis 00-7-10 ... 72 1e-10
189gb|AY237842.1| Poa arctica 5842 18S ribosomal RNA gene, partial ... 72 1e-10
190gb|AY237841.1| Poa hartzii subsp. hartzii 5945 18S ribosomal RNA... 72 1e-10
191gb|AY237840.1| Poa hartzii subsp. ammophila 5869 18S ribosomal R... 72 1e-10
192gb|AY237838.1| Poa flexuosa 96-1-20 18S ribosomal RNA gene, part... 72 1e-10
193gb|AY237837.1| Poa alpina var. alpina 96-1-4 18S ribosomal RNA g... 72 1e-10
194gb|AY237836.1| Poa alpina var. vivipara 96-1-9 18S ribosomal RNA... 72 1e-10
195gb|AY237835.1| Poa abbreviata 5816 18S ribosomal RNA gene, parti... 72 1e-10
196gb|AY237834.1| Poa pratensis subsp. alpigena 00-8-27 18S ribosom... 72 1e-10
197gb|AY237833.1| Poa pratensis subsp. alpigena 00-8-26 18S ribosom... 72 1e-10
198gb|AY576867.1| Ageratina adenophora 18S ribosomal RNA gene, part... 72 1e-10
199gb|AY576864.1| Chromolaena odorata isolate 84 from Australia 18S... 72 1e-10
200gb|AY576863.1| Campuloclinium macrocephalum 18S ribosomal RNA ge... 72 1e-10
201gb|AY576862.1| Chromolaena odorata isolate 48 from South Africa ... 72 1e-10
202gb|AY576861.1| Chromolaena odorata isolate 81 from Australia 18S... 72 1e-10
203gb|AY576860.1| Chromolaena odorata isolate 96 from South Africa ... 72 1e-10
204gb|AY576859.1| Chromolaena odorata isolate 95 from South Africa ... 72 1e-10
205gb|AY576858.1| Chromolaena odorata isolate 88 from South Africa ... 72 1e-10
206gb|AY576857.1| Chromolaena odorata isolate 92 from South Africa ... 72 1e-10
207gb|AY576856.1| Chromolaena odorata isolate 52 from Guatemala 18S... 72 1e-10
208gb|AY576855.1| Chromolaena collina 18S ribosomal RNA gene, parti... 72 1e-10
209gb|AY576853.1| Chromolaena squalida 18S ribosomal RNA gene, part... 72 1e-10
210gb|AY576852.1| Chromolaena odorata isolate 71 from Jamaica 18S r... 72 1e-10
211gb|AY576851.1| Chromolaena odorata isolate 69 from Jamaica 18S r... 72 1e-10
212gb|AY576850.1| Chromolaena odorata isolate 55 from Trinidad and ... 72 1e-10
213gb|AY576849.1| Chromolaena odorata isolate 51 from Brazil 18S ri... 72 1e-10
214gb|AY576848.1| Chromolaena odorata isolate 50 from South Africa ... 72 1e-10
215gb|AY576847.1| Chromolaena odorata isolate 102 from Puerto Rico ... 72 1e-10
216gb|AY576846.1| Chromolaena odorata isolate 100 from Puerto Rico ... 72 1e-10
217gb|AY576845.1| Chromolaena odorata isolate 97 from South Africa ... 72 1e-10
218gb|AY576844.1| Chromolaena borinquensis 18S ribosomal RNA gene, ... 72 1e-10
219gb|AY576843.1| Chromolaena odorata isolate 63 from Jamaica 18S r... 72 1e-10
220gb|AY576842.1| Chromolaena odorata isolate 62 from Jamaica 18S r... 72 1e-10
221gb|AY576841.1| Chromolaena odorata isolate 59 from Jamaica 18S r... 72 1e-10
222gb|AY576840.1| Chromolaena odorata isolate 58 from Jamaica 18S r... 72 1e-10
223gb|AY576839.1| Chromolaena odorata isolate 56 from Jamaica 18S r... 72 1e-10
224gb|AY576838.1| Chromolaena odorata isolate 3 from Venezuela 18S ... 72 1e-10
225gb|AY576837.1| Chromolaena odorata isolate 57 from Jamaica 18S r... 72 1e-10
226gb|AY576836.1| Chromolaena odorata isolate 54 from Jamaica 18S r... 72 1e-10
227gb|AY576835.1| Chromolaena odorata isolate 42 from South Africa ... 72 1e-10
228gb|AY576833.1| Chromolaena odorata isolate 38 from Indonesia 18S... 72 1e-10
229gb|AY576832.1| Chromolaena odorata isolate 45 from South Africa ... 72 1e-10
230gb|AY576831.1| Chromolaena odorata isolate 32 from South Africa ... 72 1e-10
231gb|AY576830.1| Chromolaena odorata isolate 11 from Thailand 18S ... 72 1e-10
232gb|AY576829.1| Chromolaena odorata isolate 36 from South Africa ... 72 1e-10
233gb|AY576828.1| Chromolaena odorata isolate 1 from Venezuela 18S ... 72 1e-10
234gb|AY576824.1| Chromolaena odorata isolate 18 from South Africa ... 72 1e-10
235gb|AY576823.1| Chromolaena odorata isolate 23 from South Africa ... 72 1e-10
236gb|AY576822.1| Chromolaena odorata isolate 27 from South Africa ... 72 1e-10
237gb|AY576821.1| Chromolaena odorata isolate 17 18S ribosomal RNA ... 72 1e-10
238gb|AY576819.1| Chromolaena odorata isolate 15 from Mauritius 18S... 72 1e-10
239gb|AY576818.1| Chromolaena odorata isolate 8 from Jamaica 18S ri... 72 1e-10
240gb|AY576817.1| Chromolaena odorata isolate 28 from South Africa ... 72 1e-10
241gb|AY576815.1| Chromolaena odorata isolate 26 from South Africa ... 72 1e-10
242gb|AY576814.1| Chromolaena odorata isolate 9 from Jamaica 18S ri... 72 1e-10
243gb|AY576813.1| Chromolaena odorata isolate 6 from Costa Rica 18S... 72 1e-10
244gb|AY576812.1| Chromolaena odorata isolate 4 from Venezuela 18S ... 72 1e-10
245gb|AY576811.1| Chromolaena odorata isolate 7 from Guatemala 18S ... 72 1e-10
246gb|AY576810.1| Chromolaena odorata isolate 5 from Brazil 18S rib... 72 1e-10
247gb|AY705908.1| Lachnagrostis uda voucher AK282068 18S ribosomal ... 72 1e-10
248gb|AY705907.1| Lachnagrostis ammobia voucher AK247127 18S riboso... 72 1e-10
249gb|AY705906.1| Lachnagrostis littoralis subsp. salaria voucher A... 72 1e-10
250gb|AY705905.1| Lachnagrostis littoralis subsp. littoralis vouche... 72 1e-10
251gb|AY705904.1| Lachnagrostis billardierei voucher AK282153 18S r... 72 1e-10
252gb|AY705903.1| Lachnagrostis leptostachys voucher AK281999 18S r... 72 1e-10
253gb|AY705902.1| Hierochloe fusca voucher AK286448 18S ribosomal R... 72 1e-10
254gb|AY705901.1| Hierochloe equiseta voucher CH562182 18S ribosoma... 72 1e-10
255gb|AY705900.1| Hierochloe novae-zelandiae voucher AK287053 18S r... 72 1e-10
256gb|AY705893.1| Dichelachne lautumia voucher AK286907 18S ribosom... 72 1e-10
257gb|AY705892.1| Dichelachne micrantha voucher AK286503 18S riboso... 72 1e-10
258gb|AY705891.1| Dichelachne inaequiglumis voucher AK250805 18S ri... 72 1e-10
259gb|AY705890.1| Deyeuxia quadriseta voucher AK250793 18S ribosoma... 72 1e-10
260gb|AY705889.1| Deyeuxia avenoides voucher AK255953 18S ribosomal... 72 1e-10
261gb|AY705888.1| Deyeuxia aucklandica voucher AK282067 18S ribosom... 72 1e-10
262gb|AY705887.1| Deyeuxia lacustris voucher AK281049 18S ribosomal... 72 1e-10
263gb|AY705886.1| Deyeuxia avenoides voucher AK282062 18S ribosomal... 72 1e-10
264gb|AY705885.1| Agrostis imbecilla voucher AK286442 18S ribosomal... 72 1e-10
265gb|AY705884.1| Agrostis muscosa voucher AK282074 18S ribosomal R... 72 1e-10
266gb|AY705883.1| Agrostis magellanica voucher AK281989 18S ribosom... 72 1e-10
267gb|AY705882.1| Agrostis petriei voucher AK286748 18S ribosomal R... 72 1e-10
268gb|AY705881.1| Agrostis personata voucher AK281042 18S ribosomal... 72 1e-10
269gb|AY705880.1| Agrostis muelleriana voucher AK282063 18S ribosom... 72 1e-10
270gb|AY705879.1| Agrostis pallescens voucher AK286499 18S ribosoma... 72 1e-10
271gb|DQ211588.1| Cuscuta japonica voucher CY-C-JAPONIC 006 18S rib... 72 1e-10
272gb|AY699643.1| Carex muelleri isolate 00606G 18S ribosomal RNA g... 72 1e-10
273gb|AY699642.1| Carex virgata isolate 00605F 18S ribosomal RNA ge... 72 1e-10
274gb|AY699640.1| Carex secta isolate 00606C 18S ribosomal RNA gene... 72 1e-10
275gb|AY699639.1| Carex sectoides isolate 00809G 18S ribosomal RNA ... 72 1e-10
276gb|AY699638.1| Carex kaloides isolate 00912G 18S ribosomal RNA g... 72 1e-10
277gb|AY699637.1| Carex appressa isolate 00912C 18S ribosomal RNA g... 72 1e-10
278gb|AY699626.1| Carex diandra isolate 00606D 18S ribosomal RNA ge... 72 1e-10
279gb|AY699625.1| Carex inversa isolate 00602E 18S ribosomal RNA ge... 72 1e-10
280gb|AY699624.1| Carex tenuiculmis isolate 00603D 18S ribosomal RN... 72 1e-10
281gb|AY699623.1| Carex virgata isolate 00604H 18S ribosomal RNA ge... 72 1e-10
282gb|AY699611.1| Carex secta isolate 00604F 18S ribosomal RNA gene... 72 1e-10
283gb|AY641644.1| Fagonia scoparia internal transcribed spacer 1, 5... 72 1e-10
284gb|AY641623.1| Fagonia cretica internal transcribed spacer 1, 5.... 72 1e-10
285gb|AY641616.1| Melocarpum robecchii internal transcribed spacer ... 72 1e-10
286gb|AY641615.1| Melocarpum hildebrandtii internal transcribed spa... 72 1e-10
287gb|AY686671.1| Poa subvestita voucher AK285252 18S ribosomal RNA... 72 1e-10
288gb|AY686670.1| Poa dipsacea voucher AK285251 18S ribosomal RNA g... 72 1e-10
289gb|AY686669.1| Poa cita voucher AK282070 18S ribosomal RNA gene,... 72 1e-10
290gb|AY686668.1| Poa spania voucher AK282077 18S ribosomal RNA gen... 72 1e-10
291gb|AY686667.1| Poa acicularifolia subsp. acicularifolia voucher ... 72 1e-10
292gb|AY686666.1| Poa anceps subsp. polyphylla voucher AK282943 18S... 72 1e-10
293gb|AY686665.1| Poa chathamica voucher CHR562183 18S ribosomal RN... 72 1e-10
294gb|AY686664.1| Poa colensoi voucher AK256110 18S ribosomal RNA g... 72 1e-10
295gb|AY686663.1| Poa colensoi voucher CHR549885 18S ribosomal RNA ... 72 1e-10
296gb|AY686662.1| Poa litorosa voucher AK281151 18S ribosomal RNA g... 72 1e-10
297gb|AY686661.1| Poa astonii voucher AK281038 18S ribosomal RNA ge... 72 1e-10
298gb|AY686660.1| Poa colensoi voucher AK282076 18S ribosomal RNA g... 72 1e-10
299gb|AY686659.1| Poa novae-zelandiae voucher AK282179 18S ribosoma... 72 1e-10
300gb|AY686658.1| Poa imbecilla voucher AK286463 18S ribosomal RNA ... 72 1e-10
301gb|AY686657.1| Poa kirkii voucher AK282065 18S ribosomal RNA gen... 72 1e-10
302gb|AY686656.1| Poa breviglumis voucher AK281888 18S ribosomal RN... 72 1e-10
303gb|AY686654.1| Poa buchanani voucher AK281045 18S ribosomal RNA ... 72 1e-10
304gb|AY591288.1| Antirrhinum majus 18S ribosomal RNA gene, partial... 72 1e-10
305gb|AY591287.1| Globularia trichosantha 18S ribosomal RNA gene, p... 72 1e-10
306gb|AY591286.1| Digitalis parviflora 18S ribosomal RNA gene, part... 72 1e-10
307gb|AY591285.1| Digitalis lanata subsp. lanata 18S ribosomal RNA ... 72 1e-10
308gb|AY591284.1| Digitalis lanata subsp. leucophaea 18S ribosomal ... 72 1e-10
309gb|AY591283.1| Digitalis nervosa 18S ribosomal RNA gene, partial... 72 1e-10
310gb|AY591282.1| Digitalis cariensis subsp. trojana 18S ribosomal ... 72 1e-10
311gb|AY591281.1| Digitalis laevigata subsp. laevigata 18S ribosoma... 72 1e-10
312gb|AY591280.1| Digitalis laevigata subsp. graeca 18S ribosomal R... 72 1e-10
313gb|AY591279.1| Digitalis ferruginea subsp. ferruginea 18S riboso... 72 1e-10
314gb|AY591278.1| Digitalis ferruginea subsp. schischkinii 18S ribo... 72 1e-10
315gb|AY591277.1| Digitalis lutea subsp. australis 18S ribosomal RN... 72 1e-10
316gb|AY591276.1| Digitalis subalpina 18S ribosomal RNA gene, parti... 72 1e-10
317gb|AY591275.1| Digitalis subalpina var. subalpina 18S ribosomal ... 72 1e-10
318gb|AY591274.1| Digitalis obscura subsp. laciniata 18S ribosomal ... 72 1e-10
319gb|AY591273.1| Digitalis obscura subsp. obscura 18S ribosomal RN... 72 1e-10
320gb|AY591272.1| Isoplexis canariensis f. trichomana 18S ribosomal... 72 1e-10
321gb|AY591270.1| Isoplexis isabelliana 18S ribosomal RNA gene, par... 72 1e-10
322gb|AY591269.1| Isoplexis chalcantha 18S ribosomal RNA gene, part... 72 1e-10
323gb|AY591268.1| Isoplexis sceptrum 18S ribosomal RNA gene, partia... 72 1e-10
324gb|AY591264.1| Digitalis ciliata 18S ribosomal RNA gene, partial... 72 1e-10
325gb|AY591255.1| Digitalis minor 18S ribosomal RNA gene, partial s... 72 1e-10
326gb|AY560319.1| Jacquemontia mexicana 18S ribosomal RNA gene, par... 72 1e-10
327gb|AY560316.1| Convolvulus tricolor 18S ribosomal RNA gene, part... 72 1e-10
328gb|AY560315.1| Convolvulus trabutianus 18S ribosomal RNA gene, p... 72 1e-10
329gb|AY633696.1|AY560314S2 Convolvulus trabutianus 5.8S ribosomal ... 72 1e-10
330gb|AY633695.1|AY560311S2 Convolvulus scoparius 5.8S ribosomal RN... 72 1e-10
331gb|AY633693.1|AY560309S2 Convolvulus prostratus 5.8S ribosomal R... 72 1e-10
332gb|AY633692.1|AY560308S2 Convolvulus oxyphyllus 5.8S ribosomal R... 72 1e-10
333gb|AY633691.1|AY560307S2 Convolvulus oxyphyllus 5.8S ribosomal R... 72 1e-10
334gb|AY560306.1| Convolvulus oleifolius 18S ribosomal RNA gene, pa... 72 1e-10
335gb|AY560305.1| Convolvulus nodiflorus 18S ribosomal RNA gene, pa... 72 1e-10
336gb|AY633690.1|AY560304S2 Convolvulus mazicum 5.8S ribosomal RNA ... 72 1e-10
337gb|AY633686.1|AY560300S2 Convolvulus lineatus 5.8S ribosomal RNA... 72 1e-10
338gb|AY633685.1|AY560299S2 Convolvulus lineatus 5.8S ribosomal RNA... 72 1e-10
339gb|AY633684.1|AY560298S2 Convolvulus leucochnous 5.8S ribosomal ... 72 1e-10
340gb|AY633683.1|AY560297S2 Convolvulus leucochnous 5.8S ribosomal ... 72 1e-10
341gb|AY633682.1|AY560296S2 Convolvulus leiocalycinus 5.8S ribosoma... 72 1e-10
342gb|AY560295.1| Convolvulus lanuginosus 18S ribosomal RNA gene, p... 72 1e-10
343gb|AY633681.1|AY560294S2 Convolvulus humilis 5.8S ribosomal RNA ... 72 1e-10
344gb|AY633680.1|AY560293S2 Convolvulus holosericeus 5.8S ribosomal... 72 1e-10
345gb|AY633676.1|AY560287S2 Convolvulus floridus 5.8S ribosomal RNA... 72 1e-10
346gb|AY633675.1|AY560285S2 Convolvulus dorycnium 5.8S ribosomal RN... 72 1e-10
347gb|AY633674.1|AY560284S2 Convolvulus desertii 5.8S ribosomal RNA... 72 1e-10
348gb|AY633673.1|AY560283S2 Convolvulus compactus 5.8S ribosomal RN... 72 1e-10
349gb|AY633672.1|AY560282S2 Convolvulus cneorum 5.8S ribosomal RNA ... 72 1e-10
350gb|AY633671.1|AY560281S2 Convolvulus cephalopodus 5.8S ribosomal... 72 1e-10
351gb|AY560280.1| Convolvulus caput-medusae 18S ribosomal RNA gene,... 72 1e-10
352gb|AY633670.1|AY560279S2 Convolvulus cantabrica 5.8S ribosomal R... 72 1e-10
353gb|AY560278.1| Convolvulus cantabrica 18S ribosomal RNA gene, pa... 72 1e-10
354gb|AY633668.1|AY560275S2 Convolvulus boissieri 5.8S ribosomal RN... 72 1e-10
355gb|AY560274.1| Convolvulus arvensis 18S ribosomal RNA gene, part... 72 1e-10
356gb|AY560273.1| Convolvulus argyrothamnos 18S ribosomal RNA gene,... 72 1e-10
357gb|AY560272.1| Convolvulus althaeoides 18S ribosomal RNA gene, p... 72 1e-10
358gb|AY560271.1| Convolvulus althaeoides 18S ribosomal RNA gene, p... 72 1e-10
359gb|AY560270.1| Convolvulus acanthocladus 18S ribosomal RNA gene,... 72 1e-10
360gb|AY560269.1| Calystegia silvatica 18S ribosomal RNA gene, part... 72 1e-10
361gb|AY560268.1| Calystegia soldanella 18S ribosomal RNA gene, par... 72 1e-10
362gb|AY633667.1|AY560267S2 Calystegia sepium 5.8S ribosomal RNA ge... 72 1e-10
363gb|AY327538.1| Senecio delphinifolius 18S ribosomal RNA gene, pa... 72 1e-10
364gb|AY423078.1| Tetranema mexicanum isolate DNA-CW5 26S ribosomal... 72 1e-10
365gb|AY423076.1| Schizanthus x wisetonensis 26S ribosomal RNA gene... 72 1e-10
366gb|AY524824.1| Austrofestuca littoralis MEL 2154455 18S ribosoma... 72 1e-10
367gb|AY968415.1| Gynostemma pentaphyllum 26S ribosomal RNA gene, p... 72 1e-10
368gb|AY548215.1| Angelica tenuissima isolate um04 18S ribosomal RN... 72 1e-10
369gb|AY275656.1| Cineraria aspera 18S ribosomal RNA gene, partial ... 72 1e-10
370gb|AY275655.1| Cineraria albicans 18S ribosomal RNA gene, partia... 72 1e-10
371gb|AY271924.1| Panax vietnamensis specimen-voucher Wen 5638_2(F)... 72 1e-10
372gb|AY271923.1| Panax variabilis specimen-voucher Wen 5694_17(F) ... 72 1e-10
373gb|AY271922.1| Panax stipuleanatus specimen-voucher Wen 5631_5(F... 72 1e-10
374gb|AY271921.1| Panax stipuleanatus specimen-voucher Wen 5588_1(F... 72 1e-10
375gb|AY271920.1| Panax sinensis specimen-voucher Wen 3035a(F) 18S ... 72 1e-10
376gb|AY271919.1| Panax notoginseng specimen-voucher Wen 1211(CS) 1... 72 1e-10
377gb|AY271918.1| Panax japonicus specimen-voucher Wen 2459(CS) 18S... 72 1e-10
378gb|AY271917.1| Panax pseudoginseng var. elegantior specimen-vouc... 72 1e-10
379gb|AY271916.1| Panax pseudoginseng var. angustifolius specimen-v... 72 1e-10
380gb|AY271915.1| Panax pseudoginseng var. angustifolius specimen-v... 72 1e-10
381gb|AY271914.1| Panax pseudoginseng var. bipinnatifidus specimen-... 72 1e-10
382gb|AY271913.1| Panax pseudoginseng var. bipinnatifidus specimen-... 72 1e-10
383gb|AY271912.1| Panax pseudoginseng var. bipinnatifidus specimen-... 72 1e-10
384gb|AY271911.1| Panax pseudoginseng var. bipinnatifidus specimen-... 72 1e-10
385gb|AY271909.1| Aralia franchetii specimen-voucher Wen5698(F) 18S... 72 1e-10
386gb|AY548233.1| Cryptotaenia japonica isolate um22 18S ribosomal ... 72 1e-10
387gb|AY548232.1| Peucedanum terebinthaceum subsp. deltoideum isola... 72 1e-10
388gb|AY548231.1| Ligusticum chuanxiong isolate um20 18S ribosomal ... 72 1e-10
389gb|AY548230.1| Pimpinella brachycarpa isolate um19 18S ribosomal... 72 1e-10
390gb|AY548229.1| Angelica purpureifolia isolate um18 18S ribosomal... 72 1e-10
391gb|AY548227.1| Angelica acutiloba isolate um16 18S ribosomal RNA... 72 1e-10
392gb|AY548226.1| Heracleum moellendorffii isolate um15 18S ribosom... 72 1e-10
393gb|AY548225.1| Anethum graveolens isolate um14 18S ribosomal RNA... 72 1e-10
394gb|AY548224.1| Dystaenia takesimana isolate um13 18S ribosomal R... 72 1e-10
395gb|AY548223.1| Torilis japonica isolate um12 18S ribosomal RNA g... 72 1e-10
396gb|AY548222.1| Angelica cartilagino-marginata var. distans isola... 72 1e-10
397gb|AY548221.1| Saposhnikovia divaricata isolate um10 18S ribosom... 72 1e-10
398gb|AY548220.1| Angelica decursiva isolate um09 18S ribosomal RNA... 72 1e-10
399gb|AY548219.1| Ostericum sieboldii isolate um08 18S ribosomal RN... 72 1e-10
400gb|AY548218.1| Ligusticum jeholense isolate um07 18S ribosomal R... 72 1e-10
401gb|AY548216.1| Peucedanum terebinthaceum isolate um05 18S riboso... 72 1e-10
402gb|AY548214.1| Angelica japonica isolate um03 18S ribosomal RNA ... 72 1e-10
403gb|AY548213.1| Sium suave isolate um02 18S ribosomal RNA gene, p... 72 1e-10
404gb|AY548212.1| Ostericum koreanum isolate um01 18S ribosomal RNA... 72 1e-10
405gb|AY548210.1| Taraxacum mongolicum isolate ta1 18S ribosomal RN... 72 1e-10
406gb|AY548206.1| Atractylodes macrocephala isolate at5 18S ribosom... 72 1e-10
407gb|AY548204.1| Atractylodes lancea isolate at2 18S ribosomal RNA... 72 1e-10
408gb|AY548203.1| Atractylodes japonica isolate at1 18S ribosomal R... 72 1e-10
409gb|AY548202.1| Artemisia iwayomogi isolate ar5 18S ribosomal RNA... 72 1e-10
410gb|AY548201.1| Artemisia capillaris isolate ar4 18S ribosomal RN... 72 1e-10
411gb|AY548200.1| Artemisia japonica isolate ar3 18S ribosomal RNA ... 72 1e-10
412gb|AY548199.1| Artemisia annua isolate ar2 18S ribosomal RNA gen... 72 1e-10
413gb|AY548198.1| Artemisia apiacea isolate ar1 18S ribosomal RNA g... 72 1e-10
414gb|AY548196.1| Adenophora trachelioides isolate ad4 18S ribosoma... 72 1e-10
415gb|AY548194.1| Adenophora triphylla isolate ad2 18S ribosomal RN... 72 1e-10
416gb|AY548193.1| Adenophora triphylla var. japonica isolate ad1 18... 72 1e-10
417gb|AY548192.1| Panax ginseng isolate ac22 18S ribosomal RNA gene... 72 1e-10
418gb|AY548191.1| Eleutherococcus trifoliatus f. spinifolia isolate... 72 1e-10
419gb|AY548190.1| Eleutherococcus sieboldianus isolate ac20 18S rib... 72 1e-10
420gb|AY548189.1| Eleutherococcus trifoliatus isolate ac19 18S ribo... 72 1e-10
421gb|AY548188.1| Eleutherococcus sessiliflorus f. chungbuensis iso... 72 1e-10
422gb|AY548187.1| Eleutherococcus seoulensis isolate ac15 18S ribos... 72 1e-10
423gb|AY548186.1| Eleutherococcus senticosus f. inermis isolate ac1... 72 1e-10
424gb|AY548185.1| Eleutherococcus senticosus isolate ac11 18S ribos... 72 1e-10
425gb|AY548184.1| Eleutherococcus koreanus isolate ac10 18S ribosom... 72 1e-10
426gb|AY548183.1| Eleutherococcus japonicus f. kiusianus isolate ac... 72 1e-10
427gb|AY548182.1| Eleutherococcus gracilistylus isolate ac8 18S rib... 72 1e-10
428gb|AY548181.1| Eleutherococcus giraldii isolate ac7 18S ribosoma... 72 1e-10
429gb|AY548180.1| Eleutherococcus divaricatus f. tristigmatis isola... 72 1e-10
430gb|AY548179.1| Eleutherococcus divaricatus f. sachunense isolate... 72 1e-10
431gb|AY548178.1| Eleutherococcus divaricatus var. flavi-flos isola... 72 1e-10
432gb|AY548177.1| Eleutherococcus divaricatus f. distigmatis isolat... 72 1e-10
433gb|AY548176.1| Eleutherococcus divaricatus f. albeofructus isola... 72 1e-10
434gb|AY548175.1| Eleutherococcus divaricatus var. chiisanensis iso... 72 1e-10
435gb|AY558827.1| Cuscuta epilinum 18S ribosomal RNA gene, partial ... 72 1e-10
436gb|AY558826.1| Convolvulus arvensis 18S ribosomal RNA gene, part... 72 1e-10
437gb|AY558823.1| Cuscuta reflexa 18S ribosomal RNA gene, partial s... 72 1e-10
438gb|AY558822.1| Cuscuta planiflora 18S ribosomal RNA gene, partia... 72 1e-10
439gb|AY554406.1| Cuscuta palaestina 18S ribosomal RNA gene, partia... 72 1e-10
440gb|AY554404.1| Cuscuta lupuliformis 18S ribosomal RNA gene, part... 72 1e-10
441gb|AY554401.1| Cuscuta europaea 18S ribosomal RNA gene, partial ... 72 1e-10
442gb|AY552527.1| Daucus carota 18S ribosomal RNA gene, partial seq... 72 1e-10
443gb|AY551294.1| Bupleurum scorzonerifolium isolate um28 18S ribos... 72 1e-10
444gb|AY551293.1| Bupleurum chinense isolate um27 18S ribosomal RNA... 72 1e-10
445gb|AY551292.1| Bupleurum latissimum isolate um26 18S ribosomal R... 72 1e-10
446gb|AY551289.1| Foeniculum vulgare isolate um23 18S ribosomal RNA... 72 1e-10
447gb|DQ159944.1| Atractylodes lancea 18S ribosomal RNA gene, parti... 72 1e-10
448gb|AY534622.1| Ostericum koreanum 18S ribosomal RNA gene, partia... 72 1e-10
449gb|AY079520.1| Typha domingensis 26S ribosomal RNA gene, partial... 72 1e-10
450gb|AY080892.2| Datisca glomerata 26S ribosomal RNA gene, partial... 72 1e-10
451gb|AY256560.1| Ruprechtia triflora isolate 2 internal transcribe... 72 1e-10
452gb|AY256549.1| Ruprechtia cruegerii isolate 2 internal transcrib... 72 1e-10
453gb|AY256548.1| Ruprechtia tenuiflora isolate 2 internal transcri... 72 1e-10
454gb|AY256544.1| Ruprechtia laevigata isolate 4 internal transcrib... 72 1e-10
455gb|AY256543.1| Ruprechtia tangarana internal transcribed spacer ... 72 1e-10
456gb|AY256538.1| Ruprechtia albida isolate 2 internal transcribed ... 72 1e-10
457gb|AY256537.1| Ruprechtia albida isolate 1 internal transcribed ... 72 1e-10
458gb|AY256536.1| Ruprechtia fagifolia internal transcribed spacer ... 72 1e-10
459gb|AY256532.1| Ruprechtia apetala isolate 1 internal transcribed... 72 1e-10
460gb|AY256531.1| Ruprechtia fusca isolate 3 internal transcribed s... 72 1e-10
461gb|AY256530.1| Ruprechtia fusca isolate 4 internal transcribed s... 72 1e-10
462gb|AY256529.1| Ruprechtia fusca isolate 1 internal transcribed s... 72 1e-10
463gb|AY256528.1| Ruprechtia pallida internal transcribed spacer 1,... 72 1e-10
464gb|AY256523.1| Ruprechtia ramiflora isolate 1 internal transcrib... 72 1e-10
465gb|AY256520.1| Triplaris gardneriana internal transcribed spacer... 72 1e-10
466emb|AJ492448.1|NTA492448 Nicotiana tabacum var. AWA 5.8S rRNA ge... 72 1e-10
467emb|AJ231320.1|KAJ31320 Kalanchoe blossfeldiana 5.8S rRNA gene a... 72 1e-10
468emb|AJ231314.1|KAJ31314 Kalanchoe beharensis 5.8S rRNA gene and ... 72 1e-10
469emb|X64764.1|PS58SRDNA P.deltoides gene for 18S rRNA (partial), ... 72 1e-10
470gb|DQ397957.1| Oserya coulteriana voucher CTP 3235 internal tran... 72 1e-10
471gb|AY428812.1| Quercus suber 26S large subunit ribosomal RNA gen... 72 1e-10
472gb|AY155612.1| Senecio othonnae 18S ribosomal RNA gene, partial ... 72 1e-10
473gb|AY155611.1| Senecio leucophyllus 18S ribosomal RNA gene, part... 72 1e-10
474gb|AY155609.1| Senecio incanus 18S ribosomal RNA gene, partial s... 72 1e-10
475gb|AY155603.1| Senecio boissieri 18S ribosomal RNA gene, partial... 72 1e-10
476gb|AY260040.1| Cardiandra alternifolia 26S ribosomal RNA gene, c... 72 1e-10
477gb|AY260039.1| Broussaisia arguta 26S ribosomal RNA gene, comple... 72 1e-10
478gb|AY260038.1| Pileostegia sp. Qiu 1992 26S ribosomal RNA gene, ... 72 1e-10
479gb|AY260037.1| Philadelphus caucasicus 26S ribosomal RNA gene, c... 72 1e-10
480gb|AY260036.1| Philadelphus hirsutus 26S ribosomal RNA gene, com... 72 1e-10
481gb|AY260035.1| Fendlerella utahensis 26S ribosomal RNA gene, com... 72 1e-10
482gb|AY260034.1| Deutzia rubens 26S ribosomal RNA gene, complete s... 72 1e-10
483gb|AY260033.1| Platycrater arguta 26S ribosomal RNA gene, comple... 72 1e-10
484gb|AY260031.1| Eucnide urens 26S ribosomal RNA gene, complete se... 72 1e-10
485gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complet... 72 1e-10
486gb|AY260019.1| Grubbia rosmarinifolia 26S ribosomal RNA gene, pa... 72 1e-10
487gb|AY260017.1| Mastixia eugenioides 26S ribosomal RNA gene, comp... 72 1e-10
488gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, comple... 72 1e-10
489gb|AY260014.1| Diplopanax stachyanthus 26S ribosomal RNA gene, c... 72 1e-10
490gb|AY260013.1| Davidia involucrata 26S ribosomal RNA gene, compl... 72 1e-10
491gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete... 72 1e-10
492gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet... 72 1e-10
493gb|AY260010.1| Camptotheca acuminata 26S ribosomal RNA gene, com... 72 1e-10
494gb|AY256898.1| Brassaiopsis tripteris 18S ribosomal RNA gene, pa... 72 1e-10
495gb|AF551739.1| Eleutherococcus trifoliatus 18S ribosomal RNA gen... 72 1e-10
496gb|AF551738.1| Macropanax rosthornii 18S ribosomal RNA gene, par... 72 1e-10
497gb|AF551736.1| Trevesia burckii 18S ribosomal RNA gene, partial ... 72 1e-10
498gb|AF551735.1| Trevesia palmata 18S ribosomal RNA gene, partial ... 72 1e-10
499gb|AF551734.1| Trevesia palmata 18S ribosomal RNA gene, partial ... 72 1e-10
500gb|AF551733.1| Trevesia longipedicellata 18S ribosomal RNA gene,... 72 1e-10 
>gb|AF363918.1| Oryza officinalis clone 9-5 25S ribosomal RNA gene, partial
          sequence
          Length = 906

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363917.1| Oryza australiensis clone 12-17 25S ribosomal RNA gene, partial
          sequence
          Length = 953

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363916.1| Oryza granulata clone 16-4 25S ribosomal RNA gene, partial
          sequence
          Length = 953

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363915.1| Oryza granulata clone 16-18 25S ribosomal RNA gene, partial
          sequence
          Length = 953

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363909.1| Oryza longistaminata clone 4-2 25S ribosomal RNA gene, partial
          sequence
          Length = 960

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363900.1| Oryza ridleyi clone 8-13 25S ribosomal RNA gene, partial sequence
          Length = 937

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363899.1| Oryza malampuzhaensis clone 10-8 25S ribosomal RNA gene, partial
          sequence
          Length = 962

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363898.1| Oryza malampuzhaensis clone 10-31 25S ribosomal RNA gene, partial
          sequence
          Length = 958

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363892.1| Oryza granulata clone 16-3 25S ribosomal RNA gene, partial
          sequence
          Length = 956

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363891.1| Oryza longistaminata clone 4-29 25S ribosomal RNA gene, partial
          sequence
          Length = 959

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363890.1| Oryza longistaminata clone 4-4 25S ribosomal RNA gene, partial
          sequence
          Length = 959

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363889.1| Oryza officinalis clone 9Nep-5 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363888.1| Oryza officinalis clone 9Nep-15 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363887.1| Oryza officinalis clone 9Nep-29 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363886.1| Oryza officinalis clone 9Nep-1 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363885.1| Oryza officinalis clone 9Nep-9 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363884.1| Oryza officinalis clone 9Nep-24 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363883.1| Oryza officinalis clone 9Nep-18 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363882.1| Oryza officinalis clone 9-14 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363881.1| Oryza officinalis clone 9-28 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363880.1| Oryza officinalis clone 9-12 25S ribosomal RNA gene, partial
          sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363879.1| Oryza granulata clone 16-7 25S ribosomal RNA gene, partial
          sequence
          Length = 956

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363878.1| Oryza granulata clone 16-22 25S ribosomal RNA gene, partial
          sequence
          Length = 956

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363876.1| Oryza glaberrima clone 1-29 25S ribosomal RNA gene, partial
          sequence
          Length = 941

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363875.1| Oryza punctata clone 5-27 25S ribosomal RNA gene, partial
          sequence
          Length = 943

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363874.1| Oryza glaberrima clone 1-5 25S ribosomal RNA gene, partial
          sequence
          Length = 943

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363873.1| Oryza nivara clone 15-3 25S ribosomal RNA gene, partial sequence
          Length = 889

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363872.1| Oryza nivara clone 15-34 25S ribosomal RNA gene, partial sequence
          Length = 892

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363871.1| Oryza australiensis clone 12-29 25S ribosomal RNA gene, partial
          sequence
          Length = 892

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363870.1| Oryza australiensis clone 12-1 25S ribosomal RNA gene, partial
          sequence
          Length = 892

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363869.1| Oryza malampuzhaensis clone 10-49 25S ribosomal RNA gene, partial
          sequence
          Length = 891

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363868.1| Oryza rufipogon clone 7-9 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363867.1| Oryza grandiglumis clone 14-7 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363866.1| Oryza glaberrima clone 1-20 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363865.1| Oryza punctata clone 5-21 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363864.1| Oryza glaberrima clone 1-22 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363863.1| Oryza punctata clone 5-13 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363862.1| Oryza glaberrima clone 1-11 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363861.1| Oryza glaberrima clone 1-13 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363860.1| Oryza alta clone 11-31 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363859.1| Oryza australiensis clone 12-23 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363858.1| Oryza nivara clone 15-18 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363857.1| Oryza nivara clone 15-4 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363856.1| Oryza rufipogon clone 7-19 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363855.1| Oryza malampuzhaensis clone 10-55 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363854.1| Oryza grandiglumis clone 14-14 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363853.1| Oryza malampuzhaensis clone 10-21 25S ribosomal RNA gene, partial
          sequence
          Length = 889

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363850.1| Oryza rufipogon clone 7-20 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363849.1| Oryza rufipogon clone 7-30 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363848.1| Oryza rufipogon clone 7-22 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363847.1| Oryza rufipogon clone 7-7 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363846.1| Oryza rufipogon clone 7-18 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363845.1| Oryza sativa subsp. indica clone IR36-16 25S ribosomal RNA gene,
          partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363844.1| Oryza sativa subsp. indica clone IR36-2 25S ribosomal RNA gene,
          partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363843.1| Oryza sativa subsp. indica clone IR36-10 25S ribosomal RNA gene,
          partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363842.1| Oryza sativa subsp. indica clone IR36-13 25S ribosomal RNA gene,
          partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363841.1| Oryza officinalis clone 9Nep-31 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363839.1| Oryza grandiglumis clone 14-17 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363838.1| Oryza latifolia clone 6-61 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363837.1| Oryza latifolia clone 6-27 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363836.1| Oryza sativa subsp. indica clone IR36-9 25S ribosomal RNA gene,
          partial sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF363835.1| Oryza latifolia clone 6-6 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaagcatataaataa 46
to top
>gb|AF375551.1| Oryza glaberrima clone 1-6 25S ribosomal RNA gene, partial
          sequence
          Length = 816

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
to top
>gb|AF375550.1| Oryza glaberrima clone 1-28 25S ribosomal RNA gene, partial
          sequence
          Length = 816

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
to top
>gb|AY752478.1| Microlaena polynoda 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 778

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 738 gtcaggcgggactacccgctgagtttaagcatataaataa 777
to top
>gb|AY752477.1| Microlaena avenacea 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 769

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 729 gtcaggcgggactacccgctgagtttaagcatataaataa 768
to top
>gb|AY237880.1| Dupontia fisheri c14 00-8-14 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237875.1| Dupontia fisheri c1 00-8-13 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237874.1| Dupontia fisheri c10 00-6-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237873.1| Dupontia fisheri c8 00-6-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237872.1| Dupontia fisheri c5 00-6-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237871.1| Dupontia fisheri c3 00-6-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237870.1| Dupontia fisheri c1 00-6-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237869.1| Dupontia fisheri c5 6954-7 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237868.1| Dupontia fisheri c3 6954-7 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237867.1| Dupontia fisheri c2 6954-7 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237866.1| Dupontia fisheri c1 6954-7 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237865.1| Dupontia fisheri c4 00-11-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237864.1| Dupontia fisheri c3 00-11-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237863.1| Dupontia fisheri c2 00-11-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237862.1| Dupontia fisheri c1 00-11-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237861.1| Dupontia fisheri c3 00-7-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237860.1| Dupontia fisheri c2 00-7-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237859.1| Dupontia fisheri c1 00-7-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237858.1| Dupontia fisheri c4 RB00-166 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237857.1| Dupontia fisheri c3 RB00-166 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237856.1| Dupontia fisheri c2 RB00-166 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237855.1| Dupontia fisheri c1 RB00-166 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237854.1| Dupontia fisheri c2 6954-10 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237853.1| Dupontia fisheri c1 6954-10 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237852.1| Dupontia fisheri c3 03/12-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237851.1| Dupontia fisheri c2 03/12-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237850.1| Dupontia fisheri c1 03/12-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237849.1| Dupontia fisheri c3 01/11-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237848.1| Dupontia fisheri c2 01/11-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237847.1| Dupontia fisheri c1 01/11-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 713

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237846.1| Deschampsia flexuosa 00-14-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 710

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 gtcaggcgggactacccgctgagtttaagcatataaataa 710
to top
>gb|AY237843.1| Arctagrostis latifolia 6586 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 709

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 670 gtcaggcgggactacccgctgagtttaagcatataaataa 709
to top
>gb|AY237832.1| Arctophila fulva 00-9-17 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237831.1| Arctophila fulva 00-9-15 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY705899.1| Elymus tenuis voucher AK282069 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY705898.1| Elymus sacandros voucher AK286643 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY705897.1| Elymus apricus voucher AK286417 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY705896.1| Elymus falcis voucher AK286908 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY705895.1| Elymus solandri voucher AK281159 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY705894.1| Elymus multiflorus voucher AK282082 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 761

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 721 gtcaggcgggactacccgctgagtttaagcatataaataa 760
to top
>gb|AY686655.1| Poa ramosissima voucher AK282001 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 753

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 713 gtcaggcgggactacccgctgagtttaagcatataaataa 752
to top
>gb|AY559123.1| Hookerochloa hookeriana voucher MEL 2123239 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 699

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 612 gtcaggcgggactacccgctgagtttaagcatataaataa 651
to top
>gb|AY559122.1| Festucella eriopoda voucher MEL 305017 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 700

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 612 gtcaggcgggactacccgctgagtttaagcatataaataa 651
to top
>gb|AY129731.1| Panicum whitei internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 704

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 gtcaggcgggactacccgctgagtttaagcatataaataa 676
to top
>gb|AY129725.1| Panicum subalbidum internal transcribed spacer 1, 5.8S ribosomal
           RNA and internal transcribed spacer 2, complete sequence
          Length = 702

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 634 gtcaggcgggactacccgctgagtttaagcatataaataa 673
to top
>gb|AY129724.1| Panicum stapfianum internal transcribed spacer 1, 5.8S ribosomal
           RNA and internal transcribed spacer 2, complete sequence
          Length = 704

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 gtcaggcgggactacccgctgagtttaagcatataaataa 675
to top
>gb|AY129723.1| Panicum schinzii internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 705

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 gtcaggcgggactacccgctgagtttaagcatataaataa 676
to top
>gb|AY129722.1| Panicum repens internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 705

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 gtcaggcgggactacccgctgagtttaagcatataaataa 676
to top
>gb|AY129721.1| Panicum queenslandicum internal transcribed spacer 1, 5.8S
           ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 703

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 gtcaggcgggactacccgctgagtttaagcatataaataa 674
to top
>gb|AY129718.1| Panicum natalense internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 716

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 645 gtcaggcgggactacccgctgagtttaagcatataaataa 684
to top
>gb|AY129716.1| Panicum miliaceum from Turkey internal transcribed spacer 1, 5.8S
           ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 703

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 gtcaggcgggactacccgctgagtttaagcatataaataa 674
to top
>gb|AY129715.1| Panicum miliaceum from China internal transcribed spacer 1, 5.8S
           ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 702

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 634 gtcaggcgggactacccgctgagtttaagcatataaataa 673
to top
>gb|AY129714.1| Panicum miliaceum from Bulgaria internal transcribed spacer 1, 5.8S
           ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 703

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 gtcaggcgggactacccgctgagtttaagcatataaataa 674
to top
>gb|AY129713.1| Panicum miliaceum from Australia internal transcribed spacer 1,
           5.8S ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 709

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 640 gtcaggcgggactacccgctgagtttaagcatataaataa 679
to top
>gb|AY129712.1| Panicum maximum internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 701

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 633 gtcaggcgggactacccgctgagtttaagcatataaataa 672
to top
>gb|AY129710.1| Panicum lanipes internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 700

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 632 gtcaggcgggactacccgctgagtttaagcatataaataa 671
to top
>gb|AY129708.1| Panicum grumosum internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 703

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 635 gtcaggcgggactacccgctgagtttaagcatataaataa 674
to top
>gb|AY129707.1| Panicum dregeanum internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 706

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 638 gtcaggcgggactacccgctgagtttaagcatataaataa 677
to top
>gb|AY129704.1| Panicum decompositum internal transcribed spacer 1, 5.8S ribosomal
           RNA and internal transcribed spacer 2, complete sequence
          Length = 705

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 gtcaggcgggactacccgctgagtttaagcatataaataa 676
to top
>gb|AY129701.1| Panicum coloratum var. coloratum internal transcribed spacer 1,
           5.8S ribosomal RNA and internal transcribed spacer 2,
           complete sequence
          Length = 704

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 gtcaggcgggactacccgctgagtttaagcatataaataa 675
to top
>gb|AY129699.1| Panicum bulbosum internal transcribed spacer 1, 5.8S ribosomal RNA
           and internal transcribed spacer 2, complete sequence
          Length = 701

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 633 gtcaggcgggactacccgctgagtttaagcatataaataa 672
to top
>gb|AY129691.1| Homopholis proluta internal transcribed spacer 1, 5.8S ribosomal
           RNA and internal transcribed spacer 2, complete sequence
          Length = 705

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 637 gtcaggcgggactacccgctgagtttaagcatataaataa 676
to top
>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
             fosmid clone:OSJNOa109J19
          Length = 30481

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 29091 gtcaggcgggactacccgctgagtttaagcatataaataa 29130



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 21163 gtcaggcgggactacccgctgagtttaagcatataaataa 21202



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 13235 gtcaggcgggactacccgctgagtttaagcatataaataa 13274



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                    
Query: 9    gtcaggcgggactacccgctgagtttaagcatataaataa 48
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 5307 gtcaggcgggactacccgctgagtttaagcatataaataa 5346
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                       
Query: 9       gtcaggcgggactacccgctgagtttaagcatataaataa 48
               ||||||||||||||||||||||||||||||||||||||||
Sbjct: 8376825 gtcaggcgggactacccgctgagtttaagcatataaataa 8376864
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                        
Query: 9        gtcaggcgggactacccgctgagtttaagcatataaataa 48
                ||||||||||||||||||||||||||||||||||||||||
Sbjct: 28740258 gtcaggcgggactacccgctgagtttaagcatataaataa 28740297
to top
>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0013K10
          Length = 129118

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 36747 gtcaggcgggactacccgctgagtttaagcatataaataa 36786



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 28819 gtcaggcgggactacccgctgagtttaagcatataaataa 28858



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 20891 gtcaggcgggactacccgctgagtttaagcatataaataa 20930



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 12963 gtcaggcgggactacccgctgagtttaagcatataaataa 13002



 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                    
Query: 9    gtcaggcgggactacccgctgagtttaagcatataaataa 48
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 5035 gtcaggcgggactacccgctgagtttaagcatataaataa 5074
to top
>dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0459B01
          Length = 163087

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                     
Query: 9     gtcaggcgggactacccgctgagtttaagcatataaataa 48
             ||||||||||||||||||||||||||||||||||||||||
Sbjct: 56831 gtcaggcgggactacccgctgagtttaagcatataaataa 56870
to top
>dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0603C10
          Length = 187620

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                      
Query: 9      gtcaggcgggactacccgctgagtttaagcatataaataa 48
              ||||||||||||||||||||||||||||||||||||||||
Sbjct: 170330 gtcaggcgggactacccgctgagtttaagcatataaataa 170369
to top
>dbj|AK108164.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-H03,
          full insert sequence
          Length = 1082

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 2  gtcaggcgggactacccgctgagtttaagcatataaataa 41
to top
>dbj|AK063745.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-G03,
          full insert sequence
          Length = 683

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 10 gtcaggcgggactacccgctgagtttaagcatataaataa 49
to top
>gb|M19228.1|RICRRM O.sativa 28S large subunit rRNA, 5' end
          Length = 367

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 12 gtcaggcgggactacccgctgagtttaagcatataaataa 51
to top
>gb|M16845.1|RICRGSBHA Rice gene encoding three ribosomal RNA's: the 17S, 3' end; 5.8S,
           complete; 25S, 5' end
          Length = 1044

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 795 gtcaggcgggactacccgctgagtttaagcatataaataa 834
to top
>gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene
          Length = 3377

 Score = 79.8 bits (40), Expect = 5e-13
 Identities = 40/40 (100%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||||||||||||||||||||||||||||
Sbjct: 13 gtcaggcgggactacccgctgagtttaagcatataaataa 52
to top
>gb|AY049797.1| Pyxidanthera barbulata internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene, complete sequence;
           and internal transcribed spacer 2, partial sequence
          Length = 751

 Score = 75.8 bits (38), Expect = 7e-12
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                         
Query: 3   cccccagtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 659 ccccaagtcaggcgggactacccgctgagtttaagcatatcaataa 704
to top
>emb|AJ550613.1|SRE550613 Sutera revoluta ITS1, 5.8S rRNA gene and ITS2, specimen voucher
           Kornhall 98 (UPS)
          Length = 788

 Score = 73.8 bits (37), Expect = 3e-11
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                        
Query: 4   ccccagtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||| |||||||||||||||||||||| |||||
Sbjct: 713 ccccagtcaggcgggattacccgctgagtttaagcatatcaataa 757
to top
>gb|AF479100.1| Shepherdia canadensis 26S ribosomal RNA gene, complete sequence
          Length = 3336

 Score = 73.8 bits (37), Expect = 3e-11
 Identities = 43/45 (95%)
 Strand = Plus / Plus

                                                       
Query: 4  ccccagtcaggcgggactacccgctgagtttaagcatataaataa 48
          ||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 1  ccccagtcaggcggggctacccgctgagtttaagcatatcaataa 45
to top
>gb|AF363922.1| Oryza latifolia clone 3-5 25S ribosomal RNA gene, partial
          sequence
          Length = 851

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||||||||| |||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacctgctgagtttaagcatataaataa 46
to top
>gb|AF363921.1| Oryza latifolia clone 3-3 25S ribosomal RNA gene, partial
          sequence
          Length = 851

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||||||||| |||||||||||||||||||||||
Sbjct: 7  gtcaggcgggactacctgctgagtttaagcatataaataa 46
to top
>gb|AF363897.1| Oryza latifolia clone 6-80 25S ribosomal RNA gene, partial
          sequence
          Length = 958

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||||||||||||||||||||| |||||||||||
Sbjct: 7  gtcaggcgggactacccgctgagtttaaacatataaataa 46
to top
>gb|AF363852.1| Oryza grandiglumis clone 14-16 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||| |||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcggggctacccgctgagtttaagcatataaataa 46
to top
>gb|AF363851.1| Oryza grandiglumis clone 14-11 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||| |||||||||||||||||||||||||||||
Sbjct: 7  gtcaggcggggctacccgctgagtttaagcatataaataa 46
to top
>gb|AF363840.1| Oryza latifolia clone 6-79 25S ribosomal RNA gene, partial
          sequence
          Length = 890

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                  
Query: 9  gtcaggcgggactacccgctgagtttaagcatataaataa 48
          |||||||||||||||||||||| |||||||||||||||||
Sbjct: 7  gtcaggcgggactacccgctgaatttaagcatataaataa 46
to top
>gb|AY548197.1| Adenophora remotiflora 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 794

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 747 gtcaggcgggactacccgctgagtttaagcatatcaataa 786
to top
>gb|AY460568.1| Henriettea succosa 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 940

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 731 gtcaggcgggactacccgctgagtttaagcatatcaataa 770
to top
>gb|AY460567.1| Henriettella rimosa 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 937

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 729 gtcaggcgggactacccgctgagtttaagcatatcaataa 768
to top
>gb|AY460565.1| Henriettea spruceana 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 929

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 730 gtcaggcgggactacccgctgagtttaagcatatcaataa 769
to top
>gb|AY460564.1| Henriettea martiusii 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 935

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 727 gtcaggcgggactacccgctgagtttaagcatatcaataa 766
to top
>gb|AY460469.1| Clidemia alternifolia 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 898

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 689 gtcaggcgggactacccgctgagtttaagcatatcaataa 728
to top
>gb|DQ217771.1| Salix matsudana isolate HLJ 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 709

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 662 gtcaggcgggactacccgctgagtttaagcatatcaataa 701
to top
>gb|AY483213.1| Besseya wyomingensis internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 670

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 629 gtcaggcgggactacccgctgagtttaagcatataa 664
to top
>gb|AY483211.1| Besseya bullii internal transcribed spacer 1, partial sequence;
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 665

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 622 gtcaggcgggactacccgctgagtttaagcatataa 657
to top
>gb|AY483208.1| Besseya plantaginea internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 665

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 624 gtcaggcgggactacccgctgagtttaagcatatcaataa 663
to top
>gb|AY483207.1| Besseya wyomingensis internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 671

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 629 gtcaggcgggactacccgctgagtttaagcatatcaataa 668
to top
>gb|AY483206.1| Besseya wyomingensis internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 671

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 629 gtcaggcgggactacccgctgagtttaagcatatcaataa 668
to top
>gb|AY483204.1| Besseya wyomingensis internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 675

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 630 gtcaggcgggactacccgctgagtttaagcatatcaataa 669
to top
>gb|AY483203.1| Besseya wyomingensis internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 667

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 626 gtcaggcgggactacccgctgagtttaagcatatcaataa 665
to top
>gb|AY483202.1| Synthyris lanuginosa internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 651

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 611 gtcaggcgggactacccgctgagtttaagcatatcaataa 650
to top
>gb|AY483201.1| Besseya rubra internal transcribed spacer 1, partial sequence; 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 685

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 638 gtcaggcgggactacccgctgagtttaagcatatcaataa 677
to top
>gb|AY483200.1| Synthyris missurica subsp. stellata internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 641

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 597 gtcaggcgggactacccgctgagtttaagcatatcaataa 636
to top
>gb|AY483193.1| Synthyris schizantha internal transcribed spacer 1, partial
           sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 26S
           ribosomal RNA gene, partial sequence
          Length = 672

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 631 gtcaggcgggactacccgctgagtttaagcatatcaataa 670
to top
>gb|AY483185.1| Synthyris canbyi internal transcribed spacer 1, partial sequence;
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 648

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 609 gtcaggcgggactacccgctgagtttaagcatatcaataa 648
to top
>gb|BT016655.1| Zea mays clone Contig488 mRNA sequence
          Length = 1652

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 823 gtcagtcgggactacccgctgagtttaagcatataaataa 862
to top
>gb|AY752488.1| Trisetum youngii 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           18S ribosomal RNA gene, partial sequence
          Length = 749

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 709 gtcaggcgggactacccgctgaatttaagcatataaataa 748
to top
>gb|AY752487.1| Trisetum tenellum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 749

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 709 gtcaggcgggactacccgctgaatttaagcatataaataa 748
to top
>gb|AY752486.1| Trisetum spicatum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 748

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 708 gtcaggcgggactacccgctgaatttaagcatataaataa 747
to top
>gb|AY752485.1| Trisetum drucei 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           18S ribosomal RNA gene, partial sequence
          Length = 749

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 709 gtcaggcgggactacccgctgaatttaagcatataaataa 748
to top
>gb|AY752482.1| Rytidosperma setifolium 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 760

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 720 gtcaggcgggactacccgctgaatttaagcatataaataa 759
to top
>gb|AY752480.1| Rytidosperma petrosum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 760

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 720 gtcaggcgggactacccgctgaatttaagcatataaataa 759
to top
>gb|AY752476.1| Deschampsia chapmanii 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 714 gtcagacgggactacccgctgagtttaagcatataaataa 753
to top
>gb|AY752475.1| Deschampsia tenella 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 714 gtcagacgggactacccgctgagtttaagcatataaataa 753
to top
>gb|AY724700.1| Synthyris laciniata isolate Streit10 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 674

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 630 gtcaggcgggactacccgctgagtttaagcatatcaataa 669
to top
>gb|AY724696.1| Synthyris pinnatifida isolate Streit8 internal transcribed spacer
           1, partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 673

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 628 gtcaggcgggactacccgctgagtttaagcatatcaataa 667
to top
>gb|AY237885.1| Dupontia fisheri c12 00-8-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataa 708
to top
>gb|AY237884.1| Dupontia fisheri c9 00-8-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataa 709
to top
>gb|AY237883.1| Dupontia fisheri c7 00-8-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataa 709
to top
>gb|AY237882.1| Dupontia fisheri c5 00-8-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataa 708
to top
>gb|AY237881.1| Dupontia fisheri c1 00-8-1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataa 708
to top
>gb|AY237878.1| Dupontia fisheri c11 00-8-13 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatataa 709
to top
>gb|AY237877.1| Dupontia fisheri c9 00-8-13 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataa 708
to top
>gb|AY237876.1| Dupontia fisheri c2 00-8-13 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 36/36 (100%)
 Strand = Plus / Plus

                                               
Query: 9   gtcaggcgggactacccgctgagtttaagcatataa 44
           ||||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcaggcgggactacccgctgagtttaagcatataa 708
to top
>gb|AY237845.1| Deschampsia alpina 00-11-20 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 712

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 673 gtcagacgggactacccgctgagtttaagcatataaataa 712
to top
>gb|AY237844.1| Deschampsia sukatschewii subsp. borealis 00-7-10 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 713

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 674 gtcagacgggactacccgctgagtttaagcatataaataa 713
to top
>gb|AY237842.1| Poa arctica 5842 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 709

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 670 gtcaggcgggactacccgctgaatttaagcatataaataa 709
to top
>gb|AY237841.1| Poa hartzii subsp. hartzii 5945 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 707

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 668 gtcaggcgggactacccgctgaatttaagcatataaataa 707
to top
>gb|AY237840.1| Poa hartzii subsp. ammophila 5869 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 707

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 668 gtcaggcgggactacccgctgaatttaagcatataaataa 707
to top
>gb|AY237838.1| Poa flexuosa 96-1-20 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 707

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 668 gtcaggcgggactacccgctgaatttaagcatataaataa 707
to top
>gb|AY237837.1| Poa alpina var. alpina 96-1-4 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 672 gtcaggcgggactacccgctgaatttaagcatataaataa 711
to top
>gb|AY237836.1| Poa alpina var. vivipara 96-1-9 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 714

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 675 gtcaggcgggactacccgctgaatttaagcatataaataa 714
to top
>gb|AY237835.1| Poa abbreviata 5816 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 709

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 670 gtcaggcgggactacccgctgaatttaagcatataaataa 709
to top
>gb|AY237834.1| Poa pratensis subsp. alpigena 00-8-27 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 709

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 670 gtcaggcgggactacccgctgaatttaagcatataaataa 709
to top
>gb|AY237833.1| Poa pratensis subsp. alpigena 00-8-26 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 709

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 670 gtcaggcgggactacccgctgaatttaagcatataaataa 709
to top
>gb|AY576867.1| Ageratina adenophora 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1 and 5.8S ribosomal RNA
           gene, complete sequence; and internal transcribed spacer
           2, partial sequence
          Length = 720

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 674 gtcaggcgggactacccgctgagtttaagcatatcaataa 713
to top
>gb|AY576864.1| Chromolaena odorata isolate 84 from Australia 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576863.1| Campuloclinium macrocephalum 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 732

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 686 gtcaggcgggactacccgctgagtttaagcatatcaataa 725
to top
>gb|AY576862.1| Chromolaena odorata isolate 48 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576861.1| Chromolaena odorata isolate 81 from Australia 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576860.1| Chromolaena odorata isolate 96 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576859.1| Chromolaena odorata isolate 95 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576858.1| Chromolaena odorata isolate 88 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576857.1| Chromolaena odorata isolate 92 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576856.1| Chromolaena odorata isolate 52 from Guatemala 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576855.1| Chromolaena collina 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1 and 5.8S ribosomal RNA
           gene, complete sequence; and internal transcribed spacer
           2, partial sequence
          Length = 732

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 686 gtcaggcgggactacccgctgagtttaagcatatcaataa 725
to top
>gb|AY576853.1| Chromolaena squalida 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1 and 5.8S ribosomal RNA
           gene, complete sequence; and internal transcribed spacer
           2, partial sequence
          Length = 737

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 691 gtcaggcgggactacccgctgagtttaagcatatcaataa 730
to top
>gb|AY576852.1| Chromolaena odorata isolate 71 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576851.1| Chromolaena odorata isolate 69 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 733

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 687 gtcaggcgggactacccgctgagtttaagcatatcaataa 726
to top
>gb|AY576850.1| Chromolaena odorata isolate 55 from Trinidad and Tobago 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1 and 5.8S ribosomal RNA gene,
           complete sequence; and internal transcribed spacer 2,
           partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576849.1| Chromolaena odorata isolate 51 from Brazil 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576848.1| Chromolaena odorata isolate 50 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 732

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 686 gtcaggcgggactacccgctgagtttaagcatatcaataa 725
to top
>gb|AY576847.1| Chromolaena odorata isolate 102 from Puerto Rico 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576846.1| Chromolaena odorata isolate 100 from Puerto Rico 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576845.1| Chromolaena odorata isolate 97 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576844.1| Chromolaena borinquensis 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1 and 5.8S ribosomal RNA
           gene, complete sequence; and internal transcribed spacer
           2, partial sequence
          Length = 739

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 693 gtcaggcgggactacccgctgagtttaagcatatcaataa 732
to top
>gb|AY576843.1| Chromolaena odorata isolate 63 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576842.1| Chromolaena odorata isolate 62 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576841.1| Chromolaena odorata isolate 59 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 735

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 689 gtcaggcgggactacccgctgagtttaagcatatcaataa 728
to top
>gb|AY576840.1| Chromolaena odorata isolate 58 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576839.1| Chromolaena odorata isolate 56 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576838.1| Chromolaena odorata isolate 3 from Venezuela 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 733

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 687 gtcaggcgggactacccgctgagtttaagcatatcaataa 726
to top
>gb|AY576837.1| Chromolaena odorata isolate 57 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 733

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 687 gtcaggcgggactacccgctgagtttaagcatatcaataa 726
to top
>gb|AY576836.1| Chromolaena odorata isolate 54 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576835.1| Chromolaena odorata isolate 42 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576833.1| Chromolaena odorata isolate 38 from Indonesia 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576832.1| Chromolaena odorata isolate 45 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576831.1| Chromolaena odorata isolate 32 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 733

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 687 gtcaggcgggactacccgctgagtttaagcatatcaataa 726
to top
>gb|AY576830.1| Chromolaena odorata isolate 11 from Thailand 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576829.1| Chromolaena odorata isolate 36 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576828.1| Chromolaena odorata isolate 1 from Venezuela 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 691

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 645 gtcaggcgggactacccgctgagtttaagcatatcaataa 684
to top
>gb|AY576824.1| Chromolaena odorata isolate 18 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 667

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 621 gtcaggcgggactacccgctgagtttaagcatatcaataa 660
to top
>gb|AY576823.1| Chromolaena odorata isolate 23 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576822.1| Chromolaena odorata isolate 27 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576821.1| Chromolaena odorata isolate 17 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576819.1| Chromolaena odorata isolate 15 from Mauritius 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576818.1| Chromolaena odorata isolate 8 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576817.1| Chromolaena odorata isolate 28 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576815.1| Chromolaena odorata isolate 26 from South Africa 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576814.1| Chromolaena odorata isolate 9 from Jamaica 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576813.1| Chromolaena odorata isolate 6 from Costa Rica 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576812.1| Chromolaena odorata isolate 4 from Venezuela 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576811.1| Chromolaena odorata isolate 7 from Guatemala 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 734

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY576810.1| Chromolaena odorata isolate 5 from Brazil 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 735

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||||||||||||||| |||||
Sbjct: 688 gtcaggcgggactacccgctgagtttaagcatatcaataa 727
to top
>gb|AY705908.1| Lachnagrostis uda voucher AK282068 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 714 gtcaggcgggactacccgctgaatttaagcatataaataa 753
to top
>gb|AY705907.1| Lachnagrostis ammobia voucher AK247127 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 754

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 714 gtcaggcgggactacccgctgaatttaagcatataaataa 753
to top
>gb|AY705906.1| Lachnagrostis littoralis subsp. salaria voucher AK282150 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 752

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 712 gtcaggcgggactacccgctgaatttaagcatataaataa 751
to top
>gb|AY705905.1| Lachnagrostis littoralis subsp. littoralis voucher AK253019 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 752

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 9   gtcaggcgggactacccgctgagtttaagcatataaataa 48
           |||||||||||||||||||||| |||||||||||||||||
Sbjct: 712 gtcaggcgggactacccgctgaatttaagcatataaataa 751


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 288,697
Number of Sequences: 3902068
Number of extensions: 288697
Number of successful extensions: 82679
Number of sequences better than 10.0: 18794
Number of HSP's better than 10.0 without gapping: 18743
Number of HSP's successfully gapped in prelim test: 51
Number of HSP's that attempted gapping in prelim test: 63766
Number of HSP's gapped (non-prelim): 18905
length of query: 48
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 28
effective length of database: 17,155,003,908
effective search space: 480340109424
effective search space used: 480340109424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top