>ref|XM_550032.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1980

 Score =  113 bits (57), Expect = 7e-23
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
           ||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||
Sbjct: 598 cgattacttgctgggattggtattggcatatcttctgctcttgtgcccctttacatatct 657

                            
Query: 61  gagatctcaccaactga 77
           ||||| ||||| |||||
Sbjct: 658 gagatttcacccactga 674

>gb|BT018814.1| Zea mays clone EL01N0531A02.d mRNA sequence
          Length = 2008

 Score =  113 bits (57), Expect = 7e-23
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
           ||||| |||||||| |||||||||||| |||| ||||||||||| |||||||||||||||
Sbjct: 717 cgattgcttgctggaattggtatcggggtctcatctgctcttgtacccctttacatatct 776

                            
Query: 61  gagatctcaccaactga 77
           |||||||||||||||||
Sbjct: 777 gagatctcaccaactga 793

>gb|AF215854.1|AF215854 Zea mays hexose transporter (pGlcT) mRNA, partial cds; nuclear gene
           for chloroplast product
          Length = 1874

 Score =  113 bits (57), Expect = 7e-23
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
           ||||| |||||||| |||||||||||| |||| ||||||||||| |||||||||||||||
Sbjct: 599 cgattgcttgctggaattggtatcggggtctcatctgctcttgtacccctttacatatct 658

                            
Query: 61  gagatctcaccaactga 77
           |||||||||||||||||
Sbjct: 659 gagatctcaccaactga 675

>dbj|AK065247.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002J01, full
           insert sequence
          Length = 1982

 Score =  113 bits (57), Expect = 7e-23
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
           ||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||
Sbjct: 598 cgattacttgctgggattggtattggcatatcttctgctcttgtgcccctttacatatct 657

                            
Query: 61  gagatctcaccaactga 77
           ||||| ||||| |||||
Sbjct: 658 gagatttcacccactga 674

>gb|AY112449.1| Zea mays CL1214_1 mRNA sequence
          Length = 1905

 Score =  113 bits (57), Expect = 7e-23
 Identities = 72/77 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
           ||||| |||||||| |||||||||||| |||| ||||||||||| |||||||||||||||
Sbjct: 599 cgattgcttgctggaattggtatcggggtctcatctgctcttgtacccctttacatatct 658

                            
Query: 61  gagatctcaccaactga 77
           |||||||||||||||||
Sbjct: 659 gagatctcaccaactga 675

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  101 bits (51), Expect = 3e-19
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                           
Query: 1       cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
               ||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||
Sbjct: 1845441 cgattacttgctgggattggtattggcatatcttctgctcttgtgcccctttacatatct 1845500

                  
Query: 61      gag 63
               |||
Sbjct: 1845501 gag 1845503

>dbj|AP003214.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0083M16
          Length = 179428

 Score =  101 bits (51), Expect = 3e-19
 Identities = 60/63 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cgattacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatct 60
             ||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||
Sbjct: 86823 cgattacttgctgggattggtattggcatatcttctgctcttgtgcccctttacatatct 86882

                
Query: 61    gag 63
             |||
Sbjct: 86883 gag 86885

>gb|AY608701.1| Vitis vinifera plastid hexose transporter mRNA, complete cds;
           nuclear gene for plastid product
          Length = 2044

 Score = 91.7 bits (46), Expect = 2e-16
 Identities = 67/74 (90%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatctgag 63
           ||||||||||| ||||| || || ||||| ||||| |||||||| |||||||||||||||
Sbjct: 664 ttacttgctggcattggaattggcatctcatctgcacttgtgccactttacatatctgag 723

                         
Query: 64  atctcaccaactga 77
           ||||||||||||||
Sbjct: 724 atctcaccaactga 737

>gb|AY036055.1| Olea europaea hexose transporter pGlT mRNA, complete cds; nuclear
           gene for plastid product
          Length = 2039

 Score = 75.8 bits (38), Expect = 1e-11
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatctgag 63
           ||||||||||| ||||| || || || || |||||| ||||||| ||||| |||||||||
Sbjct: 739 ttacttgctggaattggaattggtatatcgtctgctattgtgccactttatatatctgag 798

                         
Query: 64  atctcaccaactga 77
           ||||||||||||||
Sbjct: 799 atctcaccaactga 812

>gb|AF215853.1|AF215853 Solanum tuberosum hexose transporter (pGlcT) mRNA, partial cds;
           nuclear gene for chloroplast product
          Length = 1650

 Score = 75.8 bits (38), Expect = 1e-11
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatctgag 63
           |||||| |||| ||||| || || ||||| |||||| ||||||| |||||||||||||||
Sbjct: 387 ttacttactggaattggcattggcatctcatctgctattgtgccactttacatatctgag 446

                         
Query: 64  atctcaccaactga 77
           |||||||| |||||
Sbjct: 447 atctcacccactga 460

>gb|BT012878.1| Lycopersicon esculentum clone 113977R, mRNA sequence
          Length = 2099

 Score = 71.9 bits (36), Expect = 2e-10
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatctgag 63
           |||||| |||| ||||| || || ||||| |||||| ||||||| |||||||||||||||
Sbjct: 775 ttacttactggaattggcattggcatctcatctgctattgtgccactttacatatctgag 834

                   
Query: 64  atctcacc 71
           ||||||||
Sbjct: 835 atctcacc 842

>gb|AF215852.1|AF215852 Nicotiana tabacum hexose transporter (pGlcT) mRNA, partial cds;
           nuclear gene for chloroplast product
          Length = 1795

 Score = 63.9 bits (32), Expect = 5e-08
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 4   ttacttgctgggattggtatcgggatctcttctgctcttgtgcccctttacatatctgag 63
           |||||| |||| ||||| || || ||||| |||||| ||||||| |||||||||||||||
Sbjct: 578 ttacttactggaattggcattggtatctcatctgctattgtgccactttacatatctgag 637

                   
Query: 64  atctcacc 71
           || |||||
Sbjct: 638 atttcacc 645

>ref|NM_203058.1| Arabidopsis thaliana carbohydrate transporter/ sugar porter
           AT5G16150 transcript variant AT5G16150.3 mRNA, complete
           cds
          Length = 1995

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 875 ctttacatatctgagatatcaccaactga 903

>ref|NM_180497.1| Arabidopsis thaliana carbohydrate transporter/ sugar porter
           AT5G16150 transcript variant AT5G16150.2 mRNA, complete
           cds
          Length = 1864

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 744 ctttacatatctgagatatcaccaactga 772

>ref|NM_121620.2| Arabidopsis thaliana carbohydrate transporter/ sugar porter
           AT5G16150 transcript variant AT5G16150.1 mRNA, complete
           cds
          Length = 1880

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 760 ctttacatatctgagatatcaccaactga 788

>gb|AY117359.1| Arabidopsis thaliana putative sugar transporter (At5g16150) mRNA,
           complete cds
          Length = 1672

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 658 ctttacatatctgagatatcaccaactga 686

>gb|AY091052.1| Arabidopsis thaliana putative sugar transporter (At5g16150) mRNA,
           complete cds
          Length = 1876

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 744 ctttacatatctgagatatcaccaactga 772

>gb|AY058152.1| Arabidopsis thaliana AT5g16150/T21H19_70 mRNA, complete cds
          Length = 1877

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 760 ctttacatatctgagatatcaccaactga 788

>emb|BX830471.1|CNS09YQR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB84ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1954

 Score = 50.1 bits (25), Expect = 8e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||||||||||||||| |||||||||||
Sbjct: 879 ctttacatatctgagatatcaccaactga 907

>gb|AF000952.1|AF000952 Prunus armeniaca putative sugar transporter mRNA, complete cds
          Length = 2065

 Score = 42.1 bits (21), Expect = 0.20
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 49  ctttacatatctgagatctcaccaactga 77
           ||||| |||||||||||||| ||||||||
Sbjct: 807 ctttatatatctgagatctctccaactga 835

>gb|AC149347.2| Phakopsora pachyrhizi clone JGIAFNA-33E15, complete sequence
          Length = 44825

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 30  ctcttctgctcttgtgccc 48
           |||||||||||||||||||
Sbjct: 201 ctcttctgctcttgtgccc 219

>gb|AC149676.2| Bos taurus  BAC CH240-43C16 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 168416

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     atatctgagatctcaccaa 73
              |||||||||||||||||||
Sbjct: 136261 atatctgagatctcaccaa 136243

>emb|AL391318.21| Human DNA sequence from clone RP11-496H23 on chromosome 10, complete
             sequence
          Length = 45312

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    acatatctgagatctcacc 71
             |||||||||||||||||||
Sbjct: 43196 acatatctgagatctcacc 43178

>emb|AL121771.17|HSJ548G19 Human DNA sequence from clone RP4-548G19 on chromosome 20 Contains the
             5' end of the ZFP64 gene for zinc finger protein 64
             homolog (mouse) and a CpG island, complete sequence
          Length = 61579

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    tatctgagatctcaccaac 74
             |||||||||||||||||||
Sbjct: 55582 tatctgagatctcaccaac 55600

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 5       tacttgctgggattggtatcggg 27
               ||||||||||||||||| |||||
Sbjct: 1703480 tacttgctgggattggtgtcggg 1703458

>emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, complete sequence
          Length = 181542

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 35     ctgctcttgtgcccctttacatatctg 61
              ||||||||||||||||||  |||||||
Sbjct: 152440 ctgctcttgtgcccctttgtatatctg 152466

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 38.2 bits (19), Expect = 3.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 39      tcttgtgcccctttacata 57
               |||||||||||||||||||
Sbjct: 2891301 tcttgtgcccctttacata 2891319


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 619,953
Number of Sequences: 3902068
Number of extensions: 619953
Number of successful extensions: 35684
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35638
Number of HSP's gapped (non-prelim): 46
length of query: 77
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 56
effective length of database: 17,151,101,840
effective search space: 960461703040
effective search space used: 960461703040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)