ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet48g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X60343.1|HVGADPH H.vulgare GADPH mRNA for glycolytic glycera... 686 0.0
2gb|AF273738.1|AF273738 Triticum aestivum glyceraldehyde-3-phosph... 595 e-167
3gb|BT016387.1| Zea mays clone Contig220 mRNA sequence 412 e-112
4gb|BT017186.1| Zea mays clone EL01N0370B09.c mRNA sequence 412 e-112
5gb|U45855.1|ZMU45855 Zea mays glyceraldehyde-3-phosphate dehydro... 412 e-112
6gb|AY109359.1| Zea mays CL2022_2 mRNA sequence 404 e-110
7ref|XM_479895.1| Oryza sativa (japonica cultivar-group), mRNA 396 e-107
8ref|XM_507107.1| PREDICTED Oryza sativa (japonica cultivar-group... 396 e-107
9dbj|AK103777.1| Oryza sativa (japonica cultivar-group) cDNA clon... 396 e-107
10dbj|AK100159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 396 e-107
11dbj|AK071097.1| Oryza sativa (japonica cultivar-group) cDNA clon... 396 e-107
12gb|U31676.1|OSU31676 Oryza sativa clone glyceraldehyde-3-phospha... 396 e-107
13gb|BT016419.1| Zea mays clone Contig252 mRNA sequence 385 e-104
14emb|X07156.1|ZMCGAPDH Maize mRNA for cytosolic GAPDH (GapC) glyc... 385 e-104
15gb|BT024142.1| Zea mays clone EL01N0441H10 mRNA sequence 385 e-104
16gb|AY109397.1| Zea mays CL2022_1 mRNA sequence 343 3e-91
17gb|BT018263.1| Zea mays clone EL01T0202D09.c mRNA sequence 309 4e-81
18ref|XM_472949.1| Oryza sativa (japonica cultivar-group), predic... 244 2e-61
19dbj|AK064960.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 2e-61
20gb|AY349291.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 234 2e-58
21gb|AY349297.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 226 4e-56
22gb|AY349296.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 226 4e-56
23gb|AY349294.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 226 4e-56
24gb|AY349293.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 226 4e-56
25gb|AY349289.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 226 4e-56
26gb|AY349287.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 226 4e-56
27gb|AY349286.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 226 4e-56
28gb|AY349285.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 226 4e-56
29gb|AY349284.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 226 4e-56
30gb|AY349281.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 226 4e-56
31gb|AY349280.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 226 4e-56
32gb|AY349279.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 226 4e-56
33gb|AY349278.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 226 4e-56
34gb|AY349277.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 226 4e-56
35gb|AY349275.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 226 4e-56
36gb|AY349274.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 226 4e-56
37gb|AY349273.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 226 4e-56
38gb|AY349272.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 226 4e-56
39ref|NM_111283.2| Arabidopsis thaliana GAPC (GLYCERALDEHYDE-3-PHO... 220 3e-54
40gb|AY857765.1| Triticum monococcum glyceraldehyde-3-phosphate de... 220 3e-54
41gb|AY140084.1| Arabidopsis thaliana unknown protein mRNA, comple... 220 3e-54
42gb|AY060521.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, com... 220 3e-54
43gb|AY052267.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, com... 220 3e-54
44gb|AY087651.1| Arabidopsis thaliana clone 37355 mRNA, complete s... 220 3e-54
45gb|M64116.1|ATHGAPAC Arabidopsis thaliana glyceraldehyde-3-phosp... 220 3e-54
46gb|AY349295.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 218 1e-53
47gb|AY349292.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 218 1e-53
48gb|AY349290.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 218 1e-53
49gb|AY349288.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 218 1e-53
50gb|AY349283.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 218 1e-53
51gb|AY349282.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 218 1e-53
52gb|AY349276.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 218 1e-53
53gb|BT016420.1| Zea mays clone Contig253 mRNA sequence 208 1e-50
54gb|U45857.1|ZMU45857 Zea mays glyceraldehyde-3-phosphate dehydro... 208 1e-50
55gb|DQ318775.1| Lilium longiflorum glyceraldehyde-3-phosphate deh... 202 6e-49
56emb|X04301.1|SAGAPDHR Mustard mRNA for cytosolic glyceraldehyde-... 192 6e-46
57gb|AY821550.1| Musa acuminata glyceraldehyde-3-phosphate dehydro... 186 4e-44
58ref|XM_506852.1| PREDICTED Oryza sativa (japonica cultivar-group... 186 4e-44
59ref|XM_466582.1| Oryza sativa (japonica cultivar-group), mRNA 186 4e-44
60dbj|AK099086.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
61dbj|AK062215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 186 4e-44
62gb|BT016360.1| Zea mays clone Contig193 mRNA sequence 182 6e-43
63gb|U45856.1|ZMU45856 Zea mays glyceraldehyde-3-phosphate dehydro... 180 2e-42
64ref|NM_101214.2| Arabidopsis thaliana NAD binding / glyceraldehy... 167 4e-38
65gb|AY090275.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, comp... 167 4e-38
66gb|AF410271.1|AF410271 Arabidopsis thaliana At1g13440/F13B4_8 mR... 167 4e-38
67gb|AY049259.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, comp... 167 4e-38
68dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
69dbj|AP003886.3| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
70dbj|AP004166.3| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
71emb|X15596.1|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phospha... 149 8e-33
72emb|X73151.1|ZMGAPC2 Z.mays GapC2 gene 147 3e-32
73gb|U45858.1|ZMU45858 Zea mays glyceraldehyde-3-phosphate dehydro... 147 3e-32
74emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4,... 141 2e-30
75dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
76emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 141 2e-30
77dbj|D21280.1|RICAD18 Oryza sativa AD18 mRNA for glyceraldehyde-3... 137 3e-29
78emb|X60347.1|MLGADPH M.liliiflora GADPH mRNA for glycolytic glyc... 133 5e-28
79gb|M36650.1|BLYGAPDH Barley glyceraldehyde-3-phosphate dehydroge... 129 8e-27
80emb|X75597.1|ANDAP3DH A.nummularia mRNA for glyceraldehyde-3-pho... 123 5e-25
81gb|U02886.1|ANGAPDH Atriplex nummularia glyceraldehyde-3-phospha... 123 5e-25
82gb|J05223.1|CIPNADGAPD M.crystallinum glyceraldehyde-3-phosphate... 121 2e-24
83gb|M29956.1|CIPGPDNAD Common ice plant (M.crystallinum) NAD-glyc... 121 2e-24
84emb|X60346.1|PHGADPHR P.hybrida GADPH mRNA for glycolytic glycer... 115 1e-22
85emb|X73152.1|ZMGAPC4 Z.mays GapC4 gene 109 7e-21
86gb|U45859.1|ZMU45859 Zea mays glyceraldehyde-3-phosphate dehydro... 109 7e-21
87dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
88dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic D... 107 3e-20
89gb|DQ267444.1| Elaeis guineensis glyceraldehyde 3-phosphate dehy... 105 1e-19
90emb|AJ133422.1|NTA133422 Nicotiana tabacum mRNA for glyceraldehy... 101 2e-18
91gb|DQ355800.1| Glycine max glyceraldehyde-3-phosphate dehydrogen... 92 2e-15
92emb|AJ246011.1|CAN246011 Capsicum annuum mRNA for partial glycer... 90 7e-15
93gb|BT012693.1| Lycopersicon esculentum clone 113563F, mRNA sequence 86 1e-13
94gb|AC016829.7|ATAC016829 Arabidopsis thaliana chromosome III BAC... 86 1e-13
95gb|U97257.1|LEU97257 Lycopersicon esculentum glyceraldehyde 3-ph... 86 1e-13
96gb|DQ252489.1| Solanum tuberosum clone 056C03 glyceraldehyde 3-p... 86 1e-13
97gb|M64119.1|ATHGAPCA Arabidopsis thaliana cytosolic glyceraldehy... 86 1e-13
98gb|DQ173770.1| Populus maximowiczii x Populus nigra glyceraldehy... 84 4e-13
99gb|U96623.1|SLU96623 Selaginella lepidophylla glyceraldehyde-3-p... 84 4e-13
100gb|M14419.1|TOBGAPC Tobacco (N.tabacum) GapC mRNA encoding cytos... 84 4e-13
101gb|L13432.1|MZEGAPDB Zea mays GAPC2 glyceraldehyde-3-phosphate d... 80 6e-12
102gb|AF527779.1| Solanum tuberosum glyceraldehyde 3-phosphate dehy... 78 3e-11
103gb|DQ241857.1| Solanum tuberosum clone 014E02 glyceraldehyde 3-p... 78 3e-11
104gb|DQ268845.1| Solanum tuberosum clone 147E07 glyceraldehyde 3-p... 78 3e-11
105dbj|AB110609.1| Lycopersicon esculentum GAPDH gene for glycerald... 76 1e-10
106emb|X60344.1|PHGADPH P.hortense GADPH mRNA for glycolytic glycer... 74 4e-10
107dbj|AB164359.1| Periploca sepium PsGAPDH mRNA for D-glyceraldehy... 74 4e-10
108ref|XM_450090.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
109gb|AY491512.2| Daucus carota glyceraldehyde 3-phosphate dehydrog... 72 2e-09
110dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
111dbj|AP005746.3| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
112dbj|AK066284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
113emb|CT573421.5| M.truncatula DNA sequence from clone MTH2-27B10 ... 72 2e-09
114gb|U17005.1|STU17005 Solanum tuberosum glyceraldehyde 3-phosphat... 70 6e-09
115gb|AY436595.1| Anas platyrhynchos glyceraldehyde-3-phosphate deh... 68 2e-08
116gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J... 68 2e-08
117gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13... 68 2e-08
118ref|XM_501515.1| Yarrowia lipolytica CLIB122, YALI0C06369g predi... 66 1e-07
119emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 66 1e-07
120gb|L07500.1|PEAGAPCI Pea glyceraldehyde-3-phosphate dehydrogenas... 66 1e-07
121emb|AJ938036.1| Lupinus albus mRNA for glyceraldehyde-3-phosphat... 64 4e-07
122dbj|AB164360.1| Periploca sepium PsGAPDH gene for D-glyceraldehy... 64 4e-07
123ref|XR_003569.1| PREDICTED: Mus musculus similar to Glyceraldehy... 62 1e-06
124gb|AY292378.1| Phytophthora palmivora glyceraldehyde-3-phosphate... 62 1e-06
125gb|AC161826.5| Mus musculus 6 BAC RP23-411G8 (Roswell Park Cance... 62 1e-06
126gb|AY364464.1| Phaeosphaeria nodorum isolate S-82-13 glyceraldeh... 60 6e-06
127gb|AY364463.1| Phaeosphaeria avenaria f. sp. triticae isolate Sa... 60 6e-06
128gb|AY364462.1| Phaeosphaeria nodorum isolate 9074 glyceraldehyde... 60 6e-06
129gb|AY364461.1| Phaeosphaeria nodorum isolate S74-20A glyceraldeh... 60 6e-06
130gb|AY364459.1| Phaeosphaeria avenaria f. sp. avenaria strain ATC... 60 6e-06
131gb|AY364458.1| Stagonospora sp. Sn48-1 glyceraldehyde 3-phosphat... 60 6e-06
132gb|AY364456.1| Phaeosphaeria avenaria f. sp. triticae isolate S8... 60 6e-06
133gb|AY345228.1| Panax ginseng glyceraldehyde-3-phosphate dehydrog... 60 6e-06
134emb|X72381.1|PPGAPC1 P.patens gapC1 mRNA 60 6e-06
135gb|DQ383974.1| Ascochyta sp. Georgia16 glyceraldehyde-3-phosphat... 60 6e-06
136gb|DQ383972.1| Ascochyta sp. Georgia3 glyceraldehyde-3-phosphate... 60 6e-06
137gb|DQ383971.1| Ascochyta sp. Georgia2 glyceraldehyde-3-phosphate... 60 6e-06
138gb|DQ383970.1| Ascochyta fabae f. sp. viciae strain AV11 glycera... 60 6e-06
139gb|DQ383969.1| Ascochyta sp. AV8 glyceraldehyde-3-phosphate dehy... 60 6e-06
140gb|DQ383968.1| Ascochyta sp. AV1 glyceraldehyde-3-phosphate dehy... 60 6e-06
141gb|DQ383967.1| Ascochyta sp. Georgia12 glyceraldehyde-3-phosphat... 60 6e-06
142gb|DQ383966.1| Ascochyta sp. Georgia6 glyceraldehyde-3-phosphate... 60 6e-06
143gb|DQ383965.1| Ascochyta pisi strain AP5 glyceraldehyde-3-phosph... 60 6e-06
144gb|DQ383964.1| Ascochyta pisi strain AP4 glyceraldehyde-3-phosph... 60 6e-06
145gb|DQ383963.1| Ascochyta pisi strain AP1 glyceraldehyde-3-phosph... 60 6e-06
146gb|DQ383962.1| Didymella lentis strain AL11 glyceraldehyde-3-pho... 60 6e-06
147gb|DQ383961.1| Didymella lentis strain AL1 glyceraldehyde-3-phos... 60 6e-06
148gb|DQ383960.1| Didymella fabae strain AF8 glyceraldehyde-3-phosp... 60 6e-06
149gb|DQ383959.1| Didymella fabae strain AF1 glyceraldehyde-3-phosp... 60 6e-06
150dbj|AK103261.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
151dbj|AK069457.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
152gb|AY066007.1| Meriones unguiculatus glyceraldehyde-3-phosphate ... 58 2e-05
153gb|M81724.1|SCOGLYC Schizophyllum commune glyceraldehyde-3-phosp... 58 2e-05
154gb|M81754.1|PHAGLYC Phanerochaete chrysosporium glyceraldehyde-3... 58 2e-05
155dbj|AB070217.1| Meriones unguiculatus GAPD mRNA for Glyceraldehy... 58 2e-05
156gb|AF081393.1|AF081393 Curvularia gudauskasii DAOM 165085 glycer... 58 2e-05
157dbj|AB040445.1| Meriones unguiculatus GAPDH mRNA for glyceraldeh... 58 2e-05
158dbj|D14518.1|TRRGLYDE1 Trichoderma koningii mRNA for glyceraldeh... 58 2e-05
159ref|XM_676218.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 9e-05
160emb|X59517.1|AMGADPH A.majus GADPH mRNA for glycolytic glycerald... 56 9e-05
161emb|AL607000.3|OSJN00132 Oryza sativa genomic DNA, chromosome 4,... 56 9e-05
162dbj|AB237762.1| Microdochium nivale GPD gene for glyceraldehyde ... 56 9e-05
163gb|AY654895.1| Spermophilus citellus glyceraldehyde-3-phosphate ... 56 9e-05
164gb|AF232729.2|AF232729 Marmota monax glyceraldehyde 3-phosphate ... 56 9e-05
165gb|AY562407.1| Alternaria tagetica strain BMP 0179 glyceraldehyd... 56 9e-05
166gb|M33539.1|EMEGPDAA A.nidulans glyceraldehyde-3-phosphate dehyd... 56 9e-05
167gb|M19694.1|EMEGPDA A.nidulans gpdA gene encoding glyceraldehyde... 56 9e-05
168gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, co... 54 4e-04
169gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, c... 54 4e-04
170gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, c... 54 4e-04
171ref|XM_529173.1| PREDICTED: Pan troglodytes similar to Glycerald... 54 4e-04
172gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosom... 54 4e-04
173gb|BC085275.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
174gb|BC085274.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
175gb|BC085315.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
176gb|BC083080.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
177gb|BC083149.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
178gb|BC083079.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
179gb|BC083065.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
180gb|AF297874.1| Coriolopsis gallica glyceraldehyde-3-phosphate de... 54 4e-04
181gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosom... 54 4e-04
182gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, com... 54 4e-04
183gb|BC082592.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
184gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, com... 54 4e-04
185gb|AY551074.1| Drosophila buzzatii glyceraldehyde-3-phosphate de... 54 4e-04
186ref|NG_005470.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
187ref|NG_005467.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
188ref|NG_005469.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
189ref|NG_005233.2| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
190gb|AC124377.4| Mus musculus BAC clone RP24-396N12 from chromosom... 54 4e-04
191ref|NM_008084.1| Mus musculus similar to glyceraldehyde-3-phosph... 54 4e-04
192gb|AC124113.9| Mus musculus chromosome 5, clone RP24-354P12, com... 54 4e-04
193gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Can... 54 4e-04
194gb|AC164428.4| Mus musculus BAC clone RP24-150D18 from chromosom... 54 4e-04
195gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, compl... 54 4e-04
196ref|XR_003802.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
197ref|XM_484732.3| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
198ref|XM_973383.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
199ref|XM_982955.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
200ref|XR_003790.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
201ref|XM_484436.4| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
202ref|XM_904634.2| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
203ref|XR_004746.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
204ref|XR_002153.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
205ref|XM_987944.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
206ref|XR_003390.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
207ref|XR_001931.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
208gb|AC102352.9| Mus musculus chromosome 14, clone RP23-30H7, comp... 54 4e-04
209ref|XM_620532.3| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
210ref|XR_002367.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
211gb|L26924.1|GBIGLYADEH Ginkgo biloba glyceraldehyde-phosphate de... 54 4e-04
212ref|XM_906931.2| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
213gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome... 54 4e-04
214ref|XR_003202.1| PREDICTED: Mus musculus similar to Glyceraldehy... 54 4e-04
215gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome... 54 4e-04
216gb|AY363102.1|AY363102S1 Mus musculus diadenosine triphosphate h... 54 4e-04
217gb|AC115124.6| Mus musculus BAC clone RP24-349M22 from chromosom... 54 4e-04
218gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosom... 54 4e-04
219gb|AC132391.3| Mus musculus BAC clone RP23-454N21 from chromosom... 54 4e-04
220gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome... 54 4e-04
221gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosom... 54 4e-04
222gb|AC122039.4| Mus musculus BAC clone RP24-432H3 from chromosome... 54 4e-04
223gb|AC125177.4| Mus musculus BAC clone RP23-315H8 from chromosome... 54 4e-04
224gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complet... 54 4e-04
225gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complet... 54 4e-04
226gb|AC118474.10| Mus musculus chromosome 8, clone RP23-288O12, co... 54 4e-04
227gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, comp... 54 4e-04
228gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosom... 54 4e-04
229emb|AL732579.5| Human DNA sequence from clone RP11-274K13 on chr... 54 4e-04
230gb|BC098095.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
231gb|AC160632.5| Mus musculus chromosome 8, clone RP24-319F9, comp... 54 4e-04
232ref|XM_969088.1| PREDICTED: Tribolium castaneum similar to Glyce... 54 4e-04
233gb|AC163619.2| Mus musculus BAC clone RP24-164P4 from chromosome... 54 4e-04
234emb|AJ512345.1|ODA512345 Ochromonas danica partial gapC gene for... 54 4e-04
235emb|AL607064.16| Mouse DNA sequence from clone RP23-314K19 on ch... 54 4e-04
236emb|AL935328.14| Mouse DNA sequence from clone RP23-227C11 on ch... 54 4e-04
237emb|AL662926.19| Mouse DNA sequence from clone RP23-403O15 on ch... 54 4e-04
238emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chro... 54 4e-04
239gb|BC095932.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
240gb|AC158345.8| Mus musculus chromosome 7, clone RP23-271M19, com... 54 4e-04
241gb|BC092252.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
242dbj|AB194120.1| Zelkova serrata DNA, satellite marker: bczs336b 54 4e-04
243dbj|AK140794.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 54 4e-04
244dbj|AK146435.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 54 4e-04
245ref|NM_001001303.1| Mus musculus glyceraldehyde-3-phosphate dehy... 54 4e-04
246dbj|AK147969.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 54 4e-04
247dbj|AK147891.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 54 4e-04
248dbj|AK160399.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 54 4e-04
249dbj|AK147738.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 54 4e-04
250dbj|AK164415.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 54 4e-04
251dbj|AK169742.1| Mus musculus 2 days neonate thymus thymic cells ... 54 4e-04
252gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, co... 54 4e-04
253dbj|AK168217.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 54 4e-04
254gb|BC093508.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
255dbj|AK013857.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 54 4e-04
256gb|AC157651.3| Mus musculus BAC clone RP24-363O21 from chromosom... 54 4e-04
257dbj|AK081405.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 54 4e-04
258dbj|AK002273.1| Mus musculus adult male kidney cDNA, RIKEN full-... 54 4e-04
259gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; put... 54 4e-04
260gb|BC096440.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
261gb|BC061210.1| Mus musculus RIKEN cDNA 3000002C10 gene, mRNA (cD... 54 4e-04
262dbj|AK082178.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 54 4e-04
263gb|AC153557.8| Mus musculus 10 BAC RP23-203H20 (Roswell Park Can... 54 4e-04
264gb|BC094037.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
265gb|AC156283.6| Mus musculus 6 BAC RP24-327I4 (Roswell Park Cance... 54 4e-04
266gb|AF157626.1|AF157626 Equus caballus glyceraldehyde-3-phosphate... 54 4e-04
267gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome ... 54 4e-04
268gb|BC092294.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
269gb|BC092264.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
270gb|BC092267.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
271ref|NR_002890.1| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
272dbj|AK198590.1| Mus musculus cDNA, clone:Y1G0128J17, strand:plus... 54 4e-04
273dbj|AK188366.1| Mus musculus cDNA, clone:Y0G0144O14, strand:plus... 54 4e-04
274gb|BC092063.1| Mus musculus cDNA clone IMAGE:4195104 54 4e-04
275emb|AL805956.22| Mouse DNA sequence from clone RP23-239F1 on chr... 54 4e-04
276gb|BC091768.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
277emb|BX649512.4| Mouse DNA sequence from clone RP24-87G15 on chro... 54 4e-04
278emb|AL845336.9| Mouse DNA sequence from clone RP23-391P24 on chr... 54 4e-04
279ref|NG_005468.1| Mus musculus glyceraldehyde-3-phosphate dehydro... 54 4e-04
280gb|BC110311.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
281emb|CT009534.18| Mouse DNA sequence from clone RP23-106A16 on ch... 54 4e-04
282gb|AY608675.1| Phaeodactylum tricornutum mitochondrial glycerald... 54 4e-04
283gb|AC102493.8| Mus musculus chromosome 8, clone RP24-546F2, comp... 54 4e-04
284emb|AL831714.14| Mouse DNA sequence from clone RP23-311D24 on ch... 54 4e-04
285gb|AC164560.3| Mus musculus BAC clone RP23-192D6 from chromosome... 54 4e-04
286gb|AC158396.2| Mus musculus BAC clone RP23-255D19 from chromosom... 54 4e-04
287gb|AC148327.3| Mus musculus BAC clone RP24-322E6 from 5, complet... 54 4e-04
288gb|AC150744.2| Mus musculus BAC clone RP24-98O8 from 7, complete... 54 4e-04
289gb|BC020407.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
290gb|BC023196.1| Mus musculus glyceraldehyde-3-phosphate dehydroge... 54 4e-04
291ref|NM_001001978.1| Mus musculus similar to glyceraldehyde-3-pho... 54 4e-04
292gb|BC096590.1| Mus musculus similar to glyceraldehyde-3-phosphat... 54 4e-04
293gb|AC134867.3| Mus musculus BAC clone RP23-18L24 from 10, comple... 54 4e-04
294gb|AC134918.5| Mus musculus BAC clone RP23-71G16 from 3, complet... 54 4e-04
295gb|AC148983.2| Mus musculus BAC clone RP23-189G7 from 18, comple... 54 4e-04
296gb|AC134337.3| Mus musculus BAC clone RP23-252I24 from 8, comple... 54 4e-04
297gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, comple... 54 4e-04
298emb|AL929179.6| Mouse DNA sequence from clone RP23-428M4 on chro... 54 4e-04
299gb|AC109165.11| Mus musculus chromosome 5, clone RP23-30B3, comp... 54 4e-04
300gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosom... 54 4e-04
301gb|AC171241.2| Mus musculus BAC clone RP23-94E5 from chromosome ... 54 4e-04
302emb|AL772328.13| Mouse DNA sequence from clone RP23-270A19 on ch... 54 4e-04
303emb|AL808132.5| Mouse DNA sequence from clone RP23-125A12 on chr... 54 4e-04
304emb|AL732526.8| Mouse DNA sequence from clone RP23-338O4 on chro... 54 4e-04
305gb|M32599.1|MUSGAPDH Mouse glyceraldehyde-3-phosphate dehydrogen... 54 4e-04
306gb|AC159709.8| Mus musculus 10 BAC RP23-136O17 (Roswell Park Can... 54 4e-04
307gb|AY578058.1| Petromyzon marinus clone PmGAPDH glyceraldehyde 3... 52 0.001
308gb|AY364460.1| Phaeosphaeria nodorum isolate Sn37-1 glyceraldehy... 52 0.001
309emb|Z19086.1|CCGLYDEHA C.coturnix encoding glyceraldehydephospha... 52 0.001
310emb|X85332.1|SPRNAGPD1 S.pombe mRNA for glyceraldehyde-3-phosph... 52 0.001
311emb|X78307.1|CPHGPD C.plantagineum Hochst mRNA for glyceraldehyd... 52 0.001
312emb|X60345.1|RAGADPHR R.acer GADPH mRNA for glycolytic glycerald... 52 0.001
313emb|X58718.1|CLGPDG C.lunata gpd gene for glyceraldehyde-3-phosp... 52 0.001
314emb|X01578.1|GGGAPDH1 Gallus gallus partial mRNA homologous to g... 52 0.001
315emb|V00407.1|GGGAPD Gallus gallus mRNA encoding glyceraldehyde-3... 52 0.001
316emb|AL023796.1|SPBC32F12 S.pombe chromosome II cosmid c32F12 52 0.001
317emb|AJ271155.1|SNO271155 Stagonospora nodorum GDP1 gene for glyc... 52 0.001
318gb|AY004839.1| Pyrenophora bromi strain DAOM 127414 glyceraldehy... 52 0.001
319gb|AY004838.1| Pyrenophora tritici-repentis strain DAOM 107224 g... 52 0.001
320gb|AY004836.1| Drechslera dictyoides strain DAOM 63666 glycerald... 52 0.001
321gb|AY004835.1| Drechslera andersenii strain CBS 258.80 glycerald... 52 0.001
322gb|AY004834.1| Drechslera catenaria strain CBS 191.29 glyceralde... 52 0.001
323gb|AY004833.1| Drechslera catenaria strain DAOM 63665A glycerald... 52 0.001
324gb|AY004828.1| Drechslera avenae strain CBS 279.31 glyceraldehyd... 52 0.001
325gb|AY004827.1| Drechslera avenae strain CBS 189.29 glyceraldehyd... 52 0.001
326gb|DQ383973.1| Ascochyta sp. Georgia11 glyceraldehyde-3-phosphat... 52 0.001
327gb|AF047874.1|AF047874 Gallus gallus glyceraldehyde-3-phosphate ... 52 0.001
328ref|NM_001022073.1| Schizosaccharomyces pombe 972h- hypothetical... 52 0.001
329ref|NM_204305.1| Gallus gallus glyceraldehyde-3-phosphate dehydr... 52 0.001
330gb|AF246461.1|AF246461 Mastigamoeba balamuthi glyceraldehyde-3-p... 52 0.001
331gb|AF246460.1|AF246460 Mastigamoeba balamuthi glyceraldehyde-3-p... 52 0.001
332dbj|AK108644.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
333gb|AF081415.1|AF081415 Cochliobolus hawaiiensis Alcorn 7612(b)-7... 52 0.001
334gb|AF081411.1|AF081411 Cochliobolus lunatus UAMH 4378 glyceralde... 52 0.001
335gb|AF081410.1|AF081410 Cochliobolus nisikadoi CBS 192.29 glycera... 52 0.001
336gb|AF081409.1|AF081409 Bipolaris australis Turgeon 77139 glycera... 52 0.001
337gb|AF081408.1|AF081408 Cochliobolus australiensis Alcorn 8320b g... 52 0.001
338gb|AF081406.1|AF081406 Bipolaris indica BRIP17439 glyceraldehyde... 52 0.001
339gb|AF081403.1|AF081403 Cochliobolus cymbopogonis Alcorn 88109-1 ... 52 0.001
340gb|AF081394.1|AF081394 Cochliobolus lunatus UAMH 1349 glyceralde... 52 0.001
341gb|AF081378.1|AF081378 Cochliobolus hawaiiensis Alcorn 7612(b)-6... 52 0.001
342gb|AF081377.1|AF081377 Cochliobolus ellisii Alcorn 81154-1 glyce... 52 0.001
343gb|AF081376.1|AF081376 Cochliobolus dactyloctenii Alcorn 7938-9 ... 52 0.001
344gb|AF081371.1|AF081371 Pyrenophora chaetomioides DAOM 208989 gly... 52 0.001
345gb|AF081370.1|AF081370 Pyrenophora tritici-repentis DAOM 208990 ... 52 0.001
346gb|J00850.1|CHKGAPDHC chicken gapdh(glyceraldehyde-3-phosphate d... 52 0.001
347gb|K01458.1|CHKGAPDHA Chicken GAPDH (glyceraldehyde-3-phosphate ... 52 0.001
348gb|M11213.1|CHKGADPHE Chicken glyceraldehyde-3-phosphate dehydro... 52 0.001
349gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 50 0.006
350ref|XR_003524.1| PREDICTED: Mus musculus similar to Glyceraldehy... 50 0.006
351ref|XM_753545.1| Ustilago maydis 521 glyceraldehyde 3-phosphate ... 50 0.006
352gb|AY364457.1| Phaeosphaeria avenaria f. sp. triticae strain ATC... 50 0.006
353gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, comp... 50 0.006
354emb|Y08366.1|PRGPDGENE Xanthophyllomyces dendrorhous gpd gene 50 0.006
355emb|X07879.1|UMGAPD Ustilaga maydis gene for glyceraldehyde-3-ph... 50 0.006
356emb|AJ246015.1|CVU246015 Chara vulgaris mRNA for partial glycera... 50 0.006
357emb|AJ133016.1|NPA133016 Neurospora pannonica gpd gene (partial)... 50 0.006
358gb|AY004826.1| Pyrenophora semeniperda strain DAOM 213153 glycer... 50 0.006
359gb|AF388936.1|AF388936 Gelasinospora sp. FGSC 8239 glyceraldehyd... 50 0.006
360gb|AF388934.1|AF388934 Gelasinospora cerealis glyceraldehyde 3-p... 50 0.006
361gb|DQ383979.1| Phoma pinodella strain PMP4 glyceraldehyde-3-phos... 50 0.006
362gb|DQ383978.1| Phoma pinodella strain PMP3 glyceraldehyde-3-phos... 50 0.006
363gb|DQ383977.1| Ascochyta pinodes strain MP19 glyceraldehyde-3-ph... 50 0.006
364gb|AC163694.2| Mus musculus BAC clone RP24-80O2 from chromosome ... 50 0.006
365dbj|AB177405.1| Oncorhynchus tshawytscha GAPDH mRNA for glyceral... 50 0.006
366dbj|AK109097.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
367gb|AF006483.1|AF006483 Phaffia rhodozyma glyceraldehyde-3-phosph... 50 0.006
368dbj|AP005241.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 50 0.006
369gb|AY533686.1| Talaromyces wortmannii isolate W35 glyceraldehyde... 48 0.023
370gb|AY762953.1| Ulocladium obovoideum strain HSAUP_XF031238 glyce... 48 0.023
371gb|AY618568.1| Mus musculus glyceraldehyde-3-phosphate-dehydroge... 48 0.023
372ref|XM_368160.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 48 0.023
373gb|AY650282.1| Cervus elaphus glyceraldehyde-3-phosphate dehydro... 48 0.023
374gb|AY278807.1| Alternaria solani glyceraldehyde 3-phosphate dehy... 48 0.023
375gb|AY278806.1| Alternaria porri glyceraldehyde 3-phosphate dehyd... 48 0.023
376gb|AY278803.1| Alternaria dauci glyceraldehyde 3-phosphate dehyd... 48 0.023
377ref|XR_003710.1| PREDICTED: Mus musculus similar to Glyceraldehy... 48 0.023
378ref|XR_001858.1| PREDICTED: Mus musculus similar to Glyceraldehy... 48 0.023
379ref|XR_004487.1| PREDICTED: Mus musculus similar to Glyceraldehy... 48 0.023
380ref|XR_001586.1| PREDICTED: Mus musculus similar to Glyceraldehy... 48 0.023
381ref|XR_001552.1| PREDICTED: Mus musculus similar to Glyceraldehy... 48 0.023
382ref|XR_002755.1| PREDICTED: Mus musculus similar to glyceraldehy... 48 0.023
383ref|XR_001750.1| PREDICTED: Mus musculus similar to glyceraldehy... 48 0.023
384ref|XM_847439.1| PREDICTED: Canis familiaris similar to glyceral... 48 0.023
385gb|AF030943.1| Ovis aries glyceraldehyde 3-phosphate dehydrogena... 48 0.023
386gb|AC100149.12| Mus musculus chromosome 10, clone RP23-43F3, com... 48 0.023
387gb|DQ128083.1| Xenosporium berkeleyi strain ZGZII03217-1 glycera... 48 0.023
388emb|X53996.1|CPGPD1 C.parasitica gpd-1 gene for glyceraldehyde-3... 48 0.023
389emb|AJ431207.1|CHI431207 Capra hircus partial mRNA for glycerald... 48 0.023
390gb|AC161592.2| Mus musculus BAC clone RP24-252H17 from chromosom... 48 0.023
391dbj|AK135747.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 48 0.023
392gb|AY004825.1| Drechslera nobleae strain CBS 316.69 glyceraldehy... 48 0.023
393gb|AY004824.1| Drechslera nobleae strain CBS 966.87 glyceraldehy... 48 0.023
394gb|AY004823.1| Drechslera nobleae strain CBS 259.80 glyceraldehy... 48 0.023
395gb|AC175202.2| Sporobolomyces roseus clone JGIBAIF-37E14, comple... 48 0.023
396gb|AY219884.1| Anguilla anguilla glyceraldehyde-3-phosphate dehy... 48 0.023
397gb|AY004169.1| Ascocalyx abietina strain CF84-0301 glyceraldehyd... 48 0.023
398gb|AY004168.1| Ascocalyx abietina strain CF82-0493 glyceraldehyd... 48 0.023
399gb|AY004167.1| Ascocalyx abietina strain CF87-0065 glyceraldehyd... 48 0.023
400gb|AY004166.1| Ascocalyx abietina strain NS72-0600 glyceraldehyd... 48 0.023
401gb|AY004165.1| Ascocalyx abietina strain NB71-530 glyceraldehyde... 48 0.023
402gb|AY004164.1| Ascocalyx abietina strain C62 glyceraldehyde phos... 48 0.023
403gb|AY004163.1| Ascocalyx abietina strain C51 glyceraldehyde phos... 48 0.023
404gb|AY004162.1| Ascocalyx abietina strain US15 glyceraldehyde pho... 48 0.023
405gb|AY004161.1| Ascocalyx abietina strain M1024 glyceraldehyde ph... 48 0.023
406gb|AY004160.1| Ascocalyx abietina strain Fi0003 glyceraldehyde p... 48 0.023
407gb|AY004159.1| Ascocalyx abietina strain P80 glyceraldehyde phos... 48 0.023
408gb|AY004158.1| Gremmeniella laricina strain CF84-484 glyceraldeh... 48 0.023
409gb|AY004157.1| Gremmeniella laricina strain CF82-639 glyceraldeh... 48 0.023
410gb|AY004156.1| Gremmeniella laricina strain M1070 glyceraldehyde... 48 0.023
411gb|AF272837.1|AF272837 Ovis aries glyceraldehyde-3-phosphate deh... 48 0.023
412gb|AY818545.1| Cenococcum geophilum isolate 3-4-2 glyceraldehyde... 48 0.023
413gb|AY818543.1| Cenococcum geophilum isolate 1-14-5 glyceraldehyd... 48 0.023
414gb|AY818542.1| Cenococcum geophilum isolate 3-19-1 glyceraldehyd... 48 0.023
415gb|AY818539.1| Cenococcum geophilum isolate 2-6-7 glyceraldehyde... 48 0.023
416gb|AY818537.1| Cenococcum geophilum isolate 1-6-4 glyceraldehyde... 48 0.023
417gb|AY818536.1| Cenococcum geophilum isolate 1-7-11 glyceraldehyd... 48 0.023
418gb|AY818535.1| Cenococcum geophilum isolate 3-6-1 glyceraldehyde... 48 0.023
419gb|AY818532.1| Cenococcum geophilum isolate 1-2-1 glyceraldehyde... 48 0.023
420gb|AY818528.1| Cenococcum geophilum isolate 3-11-1 glyceraldehyd... 48 0.023
421gb|AY818524.1| Cenococcum geophilum isolate 1-17-4 glyceraldehyd... 48 0.023
422gb|AY818523.1| Cenococcum geophilum isolate 3-2-3 glyceraldehyde... 48 0.023
423gb|AY818520.1| Cenococcum geophilum isolate 2-9-3 glyceraldehyde... 48 0.023
424gb|AY818516.1| Cenococcum geophilum isolate 1-6-2 glyceraldehyde... 48 0.023
425gb|AY818514.1| Cenococcum geophilum isolate 3-2-5 glyceraldehyde... 48 0.023
426gb|AY818512.1| Cenococcum geophilum isolate 1-7-7 glyceraldehyde... 48 0.023
427gb|AY818508.1| Cenococcum geophilum isolate 2-9-1 glyceraldehyde... 48 0.023
428gb|AY818506.1| Cenococcum geophilum isolate 1-11-1 glyceraldehyd... 48 0.023
429gb|AY818505.1| Cenococcum geophilum isolate 1-1-2 glyceraldehyde... 48 0.023
430gb|AY818503.1| Cenococcum geophilum isolate 2-13-2 glyceraldehyd... 48 0.023
431gb|AY818501.1| Cenococcum geophilum isolate 1-14-2 glyceraldehyd... 48 0.023
432gb|AY818500.1| Cenococcum geophilum isolate 3-8-3 glyceraldehyde... 48 0.023
433gb|AY818498.1| Cenococcum geophilum isolate 2-11-1 glyceraldehyd... 48 0.023
434gb|AY818495.1| Cenococcum geophilum isolate 1-14-6 glyceraldehyd... 48 0.023
435gb|AY818494.1| Cenococcum geophilum isolate 1-5-5 glyceraldehyde... 48 0.023
436gb|AY818491.1| Cenococcum geophilum isolate 2-12-1 glyceraldehyd... 48 0.023
437gb|AY818490.1| Cenococcum geophilum isolate 3-5-1 glyceraldehyde... 48 0.023
438gb|AY818488.1| Cenococcum geophilum isolate 1-16-2 glyceraldehyd... 48 0.023
439gb|AY818481.1| Cenococcum geophilum isolate 1-1-3 glyceraldehyde... 48 0.023
440gb|AY818478.1| Cenococcum geophilum isolate 2-11-2 glyceraldehyd... 48 0.023
441gb|AY818476.1| Cenococcum geophilum isolate 2-6-1 glyceraldehyde... 48 0.023
442gb|AY818474.1| Cenococcum geophilum isolate 1-1-4 glyceraldehyde... 48 0.023
443gb|AY818473.1| Cenococcum geophilum isolate 1-6-5 glyceraldehyde... 48 0.023
444gb|AY818468.1| Cenococcum geophilum isolate 1-18-3 glyceraldehyd... 48 0.023
445gb|AY818463.1| Cenococcum geophilum isolate 1-5-1 glyceraldehyde... 48 0.023
446gb|AY818462.1| Cenococcum geophilum isolate 3-8-1 glyceraldehyde... 48 0.023
447gb|AY818460.1| Cenococcum geophilum isolate 1-19-1 glyceraldehyd... 48 0.023
448gb|AY818457.1| Cenococcum geophilum isolate 1-17-3 glyceraldehyd... 48 0.023
449gb|AY818452.1| Cenococcum geophilum isolate 3-11-2 glyceraldehyd... 48 0.023
450gb|AY818450.1| Cenococcum geophilum isolate 1-6-3 glyceraldehyde... 48 0.023
451gb|AY818449.1| Cenococcum geophilum isolate 3-10-3 glyceraldehyd... 48 0.023
452gb|AY818446.1| Cenococcum geophilum isolate 2-14-2 glyceraldehyd... 48 0.023
453gb|AY818444.1| Cenococcum geophilum isolate 2-10-1 glyceraldehyd... 48 0.023
454gb|AY818438.1| Cenococcum geophilum isolate 1-5-6 glyceraldehyde... 48 0.023
455gb|AY818436.1| Cenococcum geophilum isolate 2-3-1 glyceraldehyde... 48 0.023
456gb|AY849708.1| Magnaporthe grisea glyceraldehyde 3-phosphate deh... 48 0.023
457gb|U94718.1|OAU94718 Ovis aries glyceraldehyde-3-phosphate dehyd... 48 0.023
458gb|AY562400.1| Alternaria argyranthemi strain BMP 0035 glycerald... 48 0.023
459gb|U40816.1|DAU40816 Diplomonad ATCC50380 glyceraldehyde-3-phosp... 48 0.023
460gb|AF035421.1|AF035421 Ovis aries glyceraldehyde 3-phosphate deh... 48 0.023
461gb|AC131737.3| Mus musculus BAC clone RP23-106E9 from 7, complet... 48 0.023
462gb|AF000310.1|CLAF000310 Colletotrichum lindemuthianum glycerald... 48 0.023
463dbj|AB075021.1| Anguilla japonica GAPDH mRNA for glyceraldehyde-... 48 0.023
464gb|M93427.1|COGGPD Glomerella cingulata glyceraldehyde-3-phospha... 48 0.023
465gb|M88109.1|COGG3PD Colletotrichum gloeosporioides glyceraldehyd... 48 0.023
466gb|AF396657.2| Paracoccidioides brasiliensis glyceraldehyde-3-ph... 46 0.089
467gb|AY061958.1| Paracoccidioides brasiliensis glyceraldehyde-3-ph... 46 0.089
468gb|AC114678.20| Mus musculus chromosome 10, clone RP24-213L12, c... 46 0.089
469gb|AC136455.3| Mus musculus BAC clone RP24-481H2 from chromosome... 46 0.089
470gb|AC135080.2| Mus musculus BAC clone RP24-369P14 from chromosom... 46 0.089
471gb|AC140286.3| Mus musculus BAC clone RP24-573E14 from chromosom... 46 0.089
472gb|AY393882.1| Metschnikowia lochheadii strain UWO(PS)00-133.2 g... 46 0.089
473gb|AC166827.2| Mus musculus BAC clone RP23-359M9 from chromosome... 46 0.089
474gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome... 46 0.089
475ref|XM_848221.1| PREDICTED: Canis familiaris similar to glyceral... 46 0.089
476ref|XM_844961.1| PREDICTED: Canis familiaris similar to Glyceral... 46 0.089
477ref|XM_847161.1| PREDICTED: Canis familiaris similar to glyceral... 46 0.089
478ref|XR_003992.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
479ref|XM_980907.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
480ref|XR_002080.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
481ref|XR_002602.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
482ref|XR_001896.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
483ref|XR_003138.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
484ref|XR_001914.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
485ref|XR_005121.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
486ref|XM_848225.1| PREDICTED: Canis familiaris similar to glyceral... 46 0.089
487ref|XM_990888.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
488ref|XM_914987.2| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
489ref|XM_985296.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
490ref|XM_888028.2| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
491ref|XR_005133.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
492ref|XM_973946.1| PREDICTED: Mus musculus similar to glyceraldehy... 46 0.089
493ref|XR_003618.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
494ref|XM_993548.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
495gb|AC115705.13| Mus musculus chromosome 3, clone RP23-390C13, co... 46 0.089
496ref|XM_844513.1| PREDICTED: Canis familiaris similar to glyceral... 46 0.089
497ref|XM_917294.2| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089
498ref|XM_848580.1| PREDICTED: Canis familiaris similar to Glyceral... 46 0.089
499ref|XR_003452.1| PREDICTED: Mus musculus hypothetical protein LO... 46 0.089
500ref|XR_002396.1| PREDICTED: Mus musculus similar to Glyceraldehy... 46 0.089

>emb|X60343.1|HVGADPH H.vulgare GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1365

 Score =  686 bits (346), Expect = 0.0
 Identities = 358/362 (98%)
 Strand = Plus / Plus

                                                                       
Query: 49  ccatctcgcgtcgcggcgtcagttccactccttcgccatgggcaagattaagaccggaat 108
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 8   ccatctcgcgtcgcggcgtcagttccactccttcgccatgggcaagattaagatcggaat 67

                                                                       
Query: 109 caacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgt 168
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  caacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgt 127

                                                                       
Query: 169 cgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaa 228
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128 cgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaa 187

                                                                       
Query: 229 gtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgacaagac 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 188 gtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgacaagac 247

                                                                       
Query: 289 gctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatccc 348
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 248 gctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatccc 307

                                                                       
Query: 349 gtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgacaagga 408
           ||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 308 gtggggtgaggctggtgctgattacgttgtggaatccaccggtgtcttcactgacaagga 367

             
Query: 409 ca 410
           ||
Sbjct: 368 ca 369



to top

>gb|AF273738.1|AF273738 Triticum aestivum glyceraldehyde-3-phosphate dehydrogenase-like
           mRNA, complete sequence
          Length = 770

 Score =  595 bits (300), Expect = e-167
 Identities = 367/388 (94%), Gaps = 1/388 (0%)
 Strand = Plus / Plus

                                                                       
Query: 23  cccgtccccagcgaacctccccaccaccatctcgcgtcgcggcgtcagttccactccttc 82
           |||||||||||| |||||||| | | || ||||||||||||||| |||||||||||| ||
Sbjct: 8   cccgtccccagccaacctccc-atctccgtctcgcgtcgcggcggcagttccactccctc 66

                                                                       
Query: 83  gccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcc 142
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 67  gccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtcgcc 126

                                                                       
Query: 143 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 202
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 agggtagccctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 186

                                                                       
Query: 203 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 262
           |||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 187 accgagtacatgacctacatgttcaagtacgacaccgttcacggccactggaagcacagt 246

                                                                       
Query: 263 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 322
           |||||||||||||| ||||||||||| |||||||| ||||||||||||||||| ||||| 
Sbjct: 247 gacatcaagctcaaggacgacaagactctgctctttggcgagaagccagttaccgtcttc 306

                                                                       
Query: 323 ggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggag 382
           ||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||
Sbjct: 307 ggcgtcaggaaccctgaggagatcccgtggggtgaggctggtgccgattacgttgtggag 366

                                       
Query: 383 tccaccggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||||||||
Sbjct: 367 tccaccggtgtcttcactgacaaggaca 394



to top

>gb|BT016387.1| Zea mays clone Contig220 mRNA sequence
          Length = 1571

 Score =  412 bits (208), Expect = e-112
 Identities = 298/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 83  gccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcc 142
           |||||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |||
Sbjct: 224 gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 283

                                                                       
Query: 143 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 202
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 284 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 343

                                                                       
Query: 203 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 262
           || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 344 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 403

                                                                       
Query: 263 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 322
           |||||||  ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 404 gacatcaccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 463

                                                                       
Query: 323 ggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggag 382
           ||| |||||||||| |||||||||||||| |||||||| |||||||| || || ||||||
Sbjct: 464 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 523

                                       
Query: 383 tccaccggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||||||||
Sbjct: 524 tccaccggtgtcttcactgacaaggaca 551



to top

>gb|BT017186.1| Zea mays clone EL01N0370B09.c mRNA sequence
          Length = 1377

 Score =  412 bits (208), Expect = e-112
 Identities = 298/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 83  gccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcc 142
           |||||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |||
Sbjct: 50  gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 109

                                                                       
Query: 143 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 202
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 110 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 169

                                                                       
Query: 203 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 262
           || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 170 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 229

                                                                       
Query: 263 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 322
           |||||||  ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 230 gacatcaccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 289

                                                                       
Query: 323 ggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggag 382
           ||| |||||||||| |||||||||||||| |||||||| |||||||| || || ||||||
Sbjct: 290 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 349

                                       
Query: 383 tccaccggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||||||||
Sbjct: 350 tccaccggtgtcttcactgacaaggaca 377



to top

>gb|U45855.1|ZMU45855 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC2 (gpc2)
           mRNA, complete cds
          Length = 1307

 Score =  412 bits (208), Expect = e-112
 Identities = 298/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 83  gccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcc 142
           |||||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |||
Sbjct: 64  gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 123

                                                                       
Query: 143 agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 202
           |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 124 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 183

                                                                       
Query: 203 accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 262
           || || ||||||||||||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 184 acggattacatgacgtacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 243

                                                                       
Query: 263 gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 322
           ||||||   ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 244 gacatcgccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 303

                                                                       
Query: 323 ggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggag 382
           ||| |||||||||| |||||||||||||| |||||||| |||||||| || || ||||||
Sbjct: 304 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 363

                                       
Query: 383 tccaccggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||||||||
Sbjct: 364 tccaccggtgtcttcactgacaaggaca 391



to top

>gb|AY109359.1| Zea mays CL2022_2 mRNA sequence
          Length = 3495

 Score =  404 bits (204), Expect = e-110
 Identities = 297/328 (90%)
 Strand = Plus / Plus

                                                                        
Query: 83   gccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcc 142
            |||||||||||||| |||| ||||||||||||||||||||||||||| |||||||| |||
Sbjct: 2104 gccatgggcaagatcaagatcggaatcaacggtttcggaaggatcggcaggctcgtggcc 2163

                                                                        
Query: 143  agggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacc 202
            |||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 2164 agggtcgccctgcagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatcacc 2223

                                                                        
Query: 203  accgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagt 262
            || || |||||||| |||||||||||||||||||| || |||||||| ||||||||||| 
Sbjct: 2224 acggattacatgacctacatgttcaagtacgacaccgtgcacggccaatggaagcacagc 2283

                                                                        
Query: 263  gacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtcttt 322
            ||||||   ||||| |||  ||||||||| ||||||||||||||||| || || ||||||
Sbjct: 2284 gacatcgccctcaaggactccaagacgcttctcttcggcgagaagccggtcaccgtcttt 2343

                                                                        
Query: 323  ggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggag 382
            ||| |||||||||| |||||||||||||| |||||||| |||||||| || || ||||||
Sbjct: 2344 ggcatcaggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggag 2403

                                        
Query: 383  tccaccggtgtcttcactgacaaggaca 410
            ||||||||||||||||||||||||||||
Sbjct: 2404 tccaccggtgtcttcactgacaaggaca 2431



to top

>ref|XM_479895.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1356

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 40  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 99

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 159

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 160 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 219

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 220 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 279

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 280 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 339

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 340 agtccaccggtgtcttcactgacaagga 367



to top

>ref|XM_507107.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1163_G08.15
           mRNA
          Length = 1518

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 73  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 132

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 133 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 192

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 193 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 252

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 253 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 312

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 313 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 372

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 373 agtccaccggtgtcttcactgacaagga 400



to top

>dbj|AK103777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033144F10, full
           insert sequence
          Length = 1356

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 40  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 99

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 159

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 160 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 219

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 220 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 279

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 280 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 339

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 340 agtccaccggtgtcttcactgacaagga 367



to top

>dbj|AK100159.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020L08, full
           insert sequence
          Length = 1783

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 511 tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 570

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 571 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 630

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 631 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 690

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 691 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 750

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 751 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 810

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 811 agtccaccggtgtcttcactgacaagga 838



to top

>dbj|AK071097.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023080G06, full
           insert sequence
          Length = 1518

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 73  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 132

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 133 ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 192

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 193 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 252

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 253 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 312

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 313 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 372

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 373 agtccaccggtgtcttcactgacaagga 400



to top

>gb|U31676.1|OSU31676 Oryza sativa clone glyceraldehyde-3-phosphate dehydrogenase (Gpc)
           mRNA, complete cds
          Length = 1326

 Score =  396 bits (200), Expect = e-107
 Identities = 296/328 (90%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 24  tcgccatgggcaagattaagatcggaatcaacggtttcggaaggatcgggaggctcgtgg 83

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           ||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 84  ccagggtggccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 143

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           ||||||| |||||||| ||||||||||||||||| || || |||||||| ||||||||||
Sbjct: 144 ccaccgactacatgacctacatgttcaagtacgataccgtgcacggccaatggaagcaca 203

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | ||||||||| |||| |||  |||||| |||||||| ||||||||||| || || || |
Sbjct: 204 gcgacatcaagatcaaggactccaagactctgctcttgggcgagaagccggtcaccgttt 263

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           | ||| ||||||||||||| ||||| ||||| | |||||| |||||||| || || ||||
Sbjct: 264 tcggcatcaggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtgg 323

                                       
Query: 381 agtccaccggtgtcttcactgacaagga 408
           ||||||||||||||||||||||||||||
Sbjct: 324 agtccaccggtgtcttcactgacaagga 351



to top

>gb|BT016419.1| Zea mays clone Contig252 mRNA sequence
          Length = 1442

 Score =  385 bits (194), Expect = e-104
 Identities = 296/330 (89%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |
Sbjct: 62  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 121

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 122 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 181

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 182 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 241

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 242 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 301

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           ||||| |||||||||||||||| |||||||| |||||||| || ||||| || || ||||
Sbjct: 302 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 361

                                         
Query: 381 agtccaccggtgtcttcactgacaaggaca 410
           |||||||||| |||||||||||||||||||
Sbjct: 362 agtccaccggcgtcttcactgacaaggaca 391



to top

>emb|X07156.1|ZMCGAPDH Maize mRNA for cytosolic GAPDH (GapC) glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1305

 Score =  385 bits (194), Expect = e-104
 Identities = 296/330 (89%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |
Sbjct: 70  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 129

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 130 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 189

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 190 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 249

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 250 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 309

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           ||||| |||||||||||||||| |||||||| |||||||| || ||||| || || ||||
Sbjct: 310 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 369

                                         
Query: 381 agtccaccggtgtcttcactgacaaggaca 410
           |||||||||| |||||||||||||||||||
Sbjct: 370 agtccaccggcgtcttcactgacaaggaca 399



to top

>gb|BT024142.1| Zea mays clone EL01N0441H10 mRNA sequence
          Length = 1302

 Score =  385 bits (194), Expect = e-104
 Identities = 296/330 (89%)
 Strand = Plus / Plus

                                                                       
Query: 81  tcgccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcg 140
           ||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |
Sbjct: 71  tcgccatgggcaagattaagatcggaatcaacggcttcggaaggatcggcaggctcgtgg 130

                                                                       
Query: 141 ccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatca 200
           |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 131 ccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgaccccttcatca 190

                                                                       
Query: 201 ccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcaca 260
           |||| || |||||||| |||||||||||||||||||| || |||||||| ||||||||||
Sbjct: 191 ccacggactacatgacctacatgttcaagtacgacaccgtccacggccactggaagcaca 250

                                                                       
Query: 261 gtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtct 320
           | |||||||  ||||| |||  |||||| || |||||||| || ||||| || || ||||
Sbjct: 251 gcgacatcacactcaaggactccaagacccttctcttcggtgacaagccggtcaccgtct 310

                                                                       
Query: 321 ttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtgg 380
           ||||| |||||||||||||||| |||||||| |||||||| || ||||| || || ||||
Sbjct: 311 ttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgagtatgtcgtgg 370

                                         
Query: 381 agtccaccggtgtcttcactgacaaggaca 410
           |||||||||| |||||||||||||||||||
Sbjct: 371 agtccaccggcgtcttcactgacaaggaca 400



to top

>gb|AY109397.1| Zea mays CL2022_1 mRNA sequence
          Length = 2408

 Score =  343 bits (173), Expect = 3e-91
 Identities = 287/325 (88%)
 Strand = Plus / Plus

                                                                        
Query: 84   ccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcca 143
            |||||| |||||| |||| ||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 890  ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 949

                                                                        
Query: 144  gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 203
            |||| || || ||||||||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 950  gggtggccctgcagagcgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 1009

                                                                        
Query: 204  ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 263
            |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||||||
Sbjct: 1010 ccgactacatgacctacatgttcaagtacgacaccgtgcacggacagtggaagcacagtg 1069

                                                                        
Query: 264  acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 323
            |||||| | | || |||  |||||| || |||||||| |||||||| ||||| |||||||
Sbjct: 1070 acatcacggtgaaggactccaagacccttctcttcggtgagaagccggttaccgtctttg 1129

                                                                        
Query: 324  gcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagt 383
            || ||||||||||||||||||||||||| |||||||| |||||||| || ||||| ||||
Sbjct: 1130 gcatcaggaaccctgaggagatcccgtggggtgaggctggtgctgagtatgttgttgagt 1189

                                     
Query: 384  ccaccggtgtcttcactgacaagga 408
            |||||||||||||||||||||||||
Sbjct: 1190 ccaccggtgtcttcactgacaagga 1214



to top

>gb|BT018263.1| Zea mays clone EL01T0202D09.c mRNA sequence
          Length = 1302

 Score =  309 bits (156), Expect = 4e-81
 Identities = 249/280 (88%)
 Strand = Plus / Plus

                                                                       
Query: 131 aggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgac 190
           |||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 11  aggctcgtggccagggtcgccctccagagcgaggatgtcgagctcgtcgccgtcaacgac 70

                                                                       
Query: 191 cccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagttcacggccat 250
           |||||||||||||| || |||||||| |||||||||||||||||||| || |||||||| 
Sbjct: 71  cccttcatcaccacggactacatgacctacatgttcaagtacgacaccgtccacggccac 130

                                                                       
Query: 251 tggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagcca 310
           ||||||||||| |||||||  ||||| |||  |||||| || |||||||| || ||||| 
Sbjct: 131 tggaagcacagcgacatcacactcaaggactccaagacccttctcttcggtgacaagccg 190

                                                                       
Query: 311 gttactgtctttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgat 370
           || || ||||||||| |||||||||||||||| |||||||| |||||||| || ||||| 
Sbjct: 191 gtcaccgtctttggcatcaggaaccctgaggaaatcccgtggggtgaggctggcgctgag 250

                                                   
Query: 371 tacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           || || |||||||||||||| |||||||||||||||||||
Sbjct: 251 tatgtcgtggagtccaccggcgtcttcactgacaaggaca 290



to top

>ref|XM_472949.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1014

 Score =  244 bits (123), Expect = 2e-61
 Identities = 270/319 (84%)
 Strand = Plus / Plus

                                                                       
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 151
           |||||||||| ||| ||||| || ||||| ||||||||||||||||| |||||||| || 
Sbjct: 7   aagattaagatcgggatcaatgggttcgggaggatcgggaggctcgtggccagggtggcc 66

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           || ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 67  ctgcagagcgacgacgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactac 126

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||| ||||| || |||||||| ||||||||   |||  | |||
Sbjct: 127 atgacatacatgttcaagtatgacactgtgcacggccagtggaagcatcatgaggttaag 186

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            | || |||  |||||| || |||||||| ||||||   || || || || |||  ||||
Sbjct: 187 gtgaaggactccaagacccttctcttcggtgagaaggaggtcaccgtgttcggctgcagg 246

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||||||||| || |||||| | || ||||| |  |||||||||||||| |||
Sbjct: 247 aaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtccactggt 306

                              
Query: 392 gtcttcactgacaaggaca 410
           || ||||||||||||||||
Sbjct: 307 gttttcactgacaaggaca 325



to top

>dbj|AK064960.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001A14, full
           insert sequence
          Length = 1326

 Score =  244 bits (123), Expect = 2e-61
 Identities = 270/319 (84%)
 Strand = Plus / Plus

                                                                       
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 151
           |||||||||| ||| ||||| || ||||| ||||||||||||||||| |||||||| || 
Sbjct: 90  aagattaagatcgggatcaatgggttcgggaggatcgggaggctcgtggccagggtggcc 149

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           || ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 150 ctgcagagcgacgacgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactac 209

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||| ||||| || |||||||| ||||||||   |||  | |||
Sbjct: 210 atgacatacatgttcaagtatgacactgtgcacggccagtggaagcatcatgaggttaag 269

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            | || |||  |||||| || |||||||| ||||||   || || || || |||  ||||
Sbjct: 270 gtgaaggactccaagacccttctcttcggtgagaaggaggtcaccgtgttcggctgcagg 329

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||||||||| || |||||| | || ||||| |  |||||||||||||| |||
Sbjct: 330 aaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtccactggt 389

                              
Query: 392 gtcttcactgacaaggaca 410
           || ||||||||||||||||
Sbjct: 390 gttttcactgacaaggaca 408



to top

>gb|AY349291.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2007

 Score =  234 bits (118), Expect = 2e-58
 Identities = 118/118 (100%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 459

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 517



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 593 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 652

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 653 cggtgtcttcactgacaaggaca 675



to top

>gb|AY349297.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349296.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349294.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2007

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 459

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 517



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 593 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 652

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 653 cggtgtcttcactgacaaggaca 675



to top

>gb|AY349293.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349289.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349287.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349286.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349285.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349284.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349281.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349280.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349279.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349278.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349277.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349275.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349274.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349273.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>gb|AY349272.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  226 bits (114), Expect = 4e-56
 Identities = 117/118 (99%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 453

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 454 caaggacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 511



 Score =  202 bits (102), Expect = 6e-49
 Identities = 102/102 (100%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 587 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 646

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 647 cggtgtcttcactgacaaggaca 669



to top

>ref|NM_111283.2| Arabidopsis thaliana GAPC (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE
           C SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase
           AT3G04120 (GAPC) mRNA, complete cds
          Length = 1540

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 197 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 256

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 257 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 316

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 317 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 376

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 377 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 436

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 437 gtcttcactgacaaagaca 455



to top

>gb|AY857765.1| Triticum monococcum glyceraldehyde-3-phosphate dehydrogenase (GPD1)
           mRNA, partial cds
          Length = 630

 Score =  220 bits (111), Expect = 3e-54
 Identities = 261/311 (83%)
 Strand = Plus / Plus

                                                                       
Query: 98  aagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccag 157
           |||| ||| ||||| ||||||||  ||||||| ||||| || |||||||| || ||||||
Sbjct: 85  aagatcggcatcaatggtttcggccggatcggcaggcttgtggccagggttgcgctccag 144

                                                                       
Query: 158 agcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacg 217
           |||  ||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 145 agccccgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgactacatgacc 204

                                                                       
Query: 218 tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
           |||||||||||||| ||||| || || || || |||||||||  |||  | ||| | || 
Sbjct: 205 tacatgttcaagtatgacactgtccatggacagtggaagcaccatgaagttaaggtgaag 264

                                                                       
Query: 278 gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccct 337
           |||  |||||| || ||||| |||||||||   ||  |||| ||||||  ||||||||||
Sbjct: 265 gactccaagacccttctctttggcgagaaggaggtagctgtgtttggctgcaggaaccct 324

                                                                       
Query: 338 gaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttc 397
           ||||||||||| || | ||  || |||||||| |||||||| |||||||||||||| |||
Sbjct: 325 gaggagatcccatgggctgctgctggtgctgagtacgttgttgagtccaccggtgttttc 384

                      
Query: 398 actgacaagga 408
           |||||||||||
Sbjct: 385 actgacaagga 395



to top

>gb|AY140084.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 1322

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 151 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 210

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 211 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 270

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 271 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 330

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 331 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 390

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 391 gtcttcactgacaaagaca 409



to top

>gb|AY060521.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, complete cds
          Length = 1017

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 73  ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 132

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 133 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 192

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 193 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 252

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 253 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 312

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 313 gtcttcactgacaaagaca 331



to top

>gb|AY052267.1| Arabidopsis thaliana AT3g04120/T6K12_26 mRNA, complete cds
          Length = 1324

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 148 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 207

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 208 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 267

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 268 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 327

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 328 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 387

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 388 gtcttcactgacaaagaca 406



to top

>gb|AY087651.1| Arabidopsis thaliana clone 37355 mRNA, complete sequence
          Length = 1324

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 152 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 211

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 212 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 271

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 272 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 331

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 332 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 391

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 392 gtcttcactgacaaagaca 410



to top

>gb|M64116.1|ATHGAPAC Arabidopsis thaliana glyceraldehyde-3-phosphate dehydrogenase C
           subunit (GapC) gene, complete cds
          Length = 1295

 Score =  220 bits (111), Expect = 3e-54
 Identities = 222/259 (85%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 115 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 174

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||||||||  |||||||| || ||||| |||| |||  |||||
Sbjct: 175 atgacctacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaag 234

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||| || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 235 atcaaggatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 294

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           ||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || |||
Sbjct: 295 aaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctactggt 354

                              
Query: 392 gtcttcactgacaaggaca 410
           |||||||||||||| ||||
Sbjct: 355 gtcttcactgacaaagaca 373



to top

>gb|AY349295.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349292.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2003

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349290.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349288.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2001

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349283.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349282.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|AY349276.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388
           glyceraldehyde-3-phosphate dehydrogenase gene, partial
           cds
          Length = 2002

 Score =  218 bits (110), Expect = 1e-53
 Identities = 116/118 (98%)
 Strand = Plus / Plus

                                                                       
Query: 214 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 461

                                                                     
Query: 274 caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
           ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 462 caaggacgacaagacgctgctctttggcgagaagccagttactgtctttggcgtcagg 519



 Score =  178 bits (90), Expect = 9e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggttttggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 60

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61  ctcgtcgccgtcaacgaccctttcatcacgaccgagtacatg 102



 Score =  149 bits (75), Expect = 8e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 595 caggaaccctgaggagatcccgtggggtgaggctggtgctgattacgttgtggagtccac 654

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
           |||||||||||||||||||||||
Sbjct: 655 cggtgtcttcactgacaaggaca 677



to top

>gb|BT016420.1| Zea mays clone Contig253 mRNA sequence
          Length = 1831

 Score =  208 bits (105), Expect = 1e-50
 Identities = 270/325 (83%)
 Strand = Plus / Plus

                                                                       
Query: 84  ccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcca 143
           |||||| |||||| |||| ||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 73  ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 132

                                                                       
Query: 144 gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 203
           |||| || || ||||| ||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 133 gggtggccctgcagagtgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 192

                                                                       
Query: 204 ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 263
           |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||  ||
Sbjct: 193 ccgactacatgacctacatgttcaagtacgacactgtgcacggacagtggaagcaccatg 252

                                                                       
Query: 264 acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 323
           |  ||||| | || |||  ||| || || ||||| || ||||||   ||| |||| ||||
Sbjct: 253 aagtcaaggtgaaggactccaaaacccttctctttggtgagaaggaggttgctgtgtttg 312

                                                                       
Query: 324 gcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagt 383
           ||  |||||||||||||||||||||||| |||  ||  |||||||| || ||||| ||||
Sbjct: 313 gctgcaggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagt 372

                                    
Query: 384 ccaccggtgtcttcactgacaagga 408
           | || ||||| ||||||||| ||||
Sbjct: 373 ctactggtgttttcactgaccagga 397



to top

>gb|U45857.1|ZMU45857 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC4 (gpc4)
           mRNA, complete cds
          Length = 1232

 Score =  208 bits (105), Expect = 1e-50
 Identities = 270/325 (83%)
 Strand = Plus / Plus

                                                                       
Query: 84  ccatgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgcca 143
           |||||| |||||| |||| ||| ||||| || ||||| |||||||| ||||| || ||||
Sbjct: 8   ccatggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggcca 67

                                                                       
Query: 144 gggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcacca 203
           |||| || || ||||| ||||||||||||||||||||||| |||||||||||||||| ||
Sbjct: 68  gggtggctctgcagagtgacgatgtcgagctcgtcgccgtgaacgaccccttcatcagca 127

                                                                       
Query: 204 ccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtg 263
           |||| |||||||| |||||||||||||||||||| || ||||| || |||||||||  ||
Sbjct: 128 ccgactacatgacctacatgttcaagtacgacactgtacacggacagtggaagcaccatg 187

                                                                       
Query: 264 acatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttg 323
           |  ||||| | || |||  ||| || || ||||| || ||||||   ||| |||| ||||
Sbjct: 188 aagtcaaggtgaaggactccaaaacccttctctttggtgagaaggaggttgctgtgtttg 247

                                                                       
Query: 324 gcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagt 383
           ||  |||||||||||||||||||||||| |||  ||  |||||||| || ||||| ||||
Sbjct: 248 gctgcaggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagt 307

                                    
Query: 384 ccaccggtgtcttcactgacaagga 408
           | || ||||| ||||||||| ||||
Sbjct: 308 ctactggtgttttcactgaccagga 332



to top

>gb|DQ318775.1| Lilium longiflorum glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
           mRNA, partial cds
          Length = 977

 Score =  202 bits (102), Expect = 6e-49
 Identities = 252/302 (83%)
 Strand = Plus / Plus

                                                                       
Query: 107 atcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgat 166
           ||||| || ||||||||||||||| |  | || || ||||| |||||||||||||| || 
Sbjct: 6   atcaatggattcggaaggatcgggcgcttggttgctagggttgcactccagagcgatgac 65

                                                                       
Query: 167 gtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttc 226
            |||||||||| ||||||||||| || |||||||| || || |||||||| |||||||||
Sbjct: 66  atcgagctcgttgccgtcaacgatccgttcatcacgactgattacatgacatacatgttc 125

                                                                       
Query: 227 aagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgacaag 286
           ||||| |||||||| ||||| || |||||||||  ||| || ||| | || |||   |||
Sbjct: 126 aagtatgacacagtgcacggtcagtggaagcaccatgagataaaggtgaaggactcgaag 185

                                                                       
Query: 287 acgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatc 346
           || || ||||| |||||||||||||| ||  ||||||| || ||||| ||||||||||||
Sbjct: 186 actctcctctttggcgagaagccagtcaccatctttggtgttaggaatcctgaggagatc 245

                                                                       
Query: 347 ccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgacaag 406
           || || |||||||| |||||||| | |||||||||||| || ||||| ||||||||||||
Sbjct: 246 ccatggggtgaggctggtgctgacttcgttgtggagtctactggtgtattcactgacaag 305

             
Query: 407 ga 408
           ||
Sbjct: 306 ga 307



to top

>emb|X04301.1|SAGAPDHR Mustard mRNA for cytosolic glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH, NAD-specific; EC 1.2.1.12)
          Length = 1091

 Score =  192 bits (97), Expect = 6e-46
 Identities = 211/249 (84%)
 Strand = Plus / Plus

                                                                       
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtaca 221
           ||||||| ||||||||||| || ||||| |||||||||||||||||||||||||||||||
Sbjct: 90  acgatgttgagctcgtcgctgttaacgatcccttcatcaccaccgagtacatgacgtaca 149

                                                                       
Query: 222 tgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacg 281
           |||| ||||| ||||  ||||| || || |||||||||| |||  ||||| | || || |
Sbjct: 150 tgtttaagtatgacagtgttcatggtcagtggaagcacaatgagctcaaggtgaaggatg 209

                                                                       
Query: 282 acaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagg 341
           | || || || |||||||| |||||||| || ||||| || ||| |||||||||||||||
Sbjct: 210 agaaaacacttctcttcggagagaagcctgtcactgttttcggcatcaggaaccctgagg 269

                                                                       
Query: 342 agatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactg 401
           | ||||| || ||||||||||| ||||| |  ||||| ||||| || |||||||||||||
Sbjct: 270 atatcccatggggtgaggccggagctgactttgttgttgagtctactggtgtcttcactg 329

                    
Query: 402 acaaggaca 410
           |||||||||
Sbjct: 330 acaaggaca 338



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgg 129
           |||||||||| ||||||||||||||||||||| |||||
Sbjct: 20  aagattaagatcggaatcaacggtttcggaagaatcgg 57



to top

>gb|AY821550.1| Musa acuminata glyceraldehyde-3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 993

 Score =  186 bits (94), Expect = 4e-44
 Identities = 133/146 (91%)
 Strand = Plus / Plus

                                                                       
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 151
           |||||||||| |||||||||||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 1   aagattaagatcggaatcaacgggttcggaaggatcgggaggctggtcgccagagtcgca 60

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           || ||||| |||||||| |||||||| || ||||||||||||||||||||||| || |||
Sbjct: 61  cttcagagtgacgatgtggagctcgttgctgtcaacgaccccttcatcaccactgattac 120

                                     
Query: 212 atgacgtacatgttcaagtacgacac 237
           |||||||||||||| ||||| |||||
Sbjct: 121 atgacgtacatgtttaagtatgacac 146



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 327 tcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtcca 386
           |||||||||||||||||||||| || |||||| | ||||| || ||||| ||||| || |
Sbjct: 236 tcaggaaccctgaggagatcccatggggtgagtctggtgccgagtacgtcgtggaatcaa 295

                                   
Query: 387 ccggtgtcttcactgacaaggaca 410
           | |||||||| |||||||||||||
Sbjct: 296 ctggtgtctttactgacaaggaca 319



to top

>ref|XM_506852.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1791_B03.34
           mRNA
          Length = 1460

 Score =  186 bits (94), Expect = 4e-44
 Identities = 154/174 (88%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||||||||||||||| ||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 218 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 277

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 278 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 337

                                                                 
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 338 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 391



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           ||||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| ||
Sbjct: 461 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 520

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
            ||||| ||||| ||||||||||
Sbjct: 521 tggtgttttcaccgacaaggaca 543



to top

>ref|XM_466582.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1456

 Score =  186 bits (94), Expect = 4e-44
 Identities = 154/174 (88%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||||||||||||||| ||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 234 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 293

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 294 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 353

                                                                 
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 354 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 407



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           ||||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| ||
Sbjct: 477 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 536

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
            ||||| ||||| ||||||||||
Sbjct: 537 tggtgttttcaccgacaaggaca 559



to top

>dbj|AK099086.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023009G10, full
           insert sequence
          Length = 1460

 Score =  186 bits (94), Expect = 4e-44
 Identities = 154/174 (88%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||||||||||||||| ||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 218 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 277

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 278 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 337

                                                                 
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 338 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 391



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           ||||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| ||
Sbjct: 461 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 520

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
            ||||| ||||| ||||||||||
Sbjct: 521 tggtgttttcaccgacaaggaca 543



to top

>dbj|AK062215.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A09, full
           insert sequence
          Length = 1455

 Score =  186 bits (94), Expect = 4e-44
 Identities = 154/174 (88%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||||||||||||||| ||||||||| || |||||  | ||||| ||||| || |||||
Sbjct: 234 catgggcaagattaagatcggaatcaatgggttcggccgcatcggcaggctggtggccag 293

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || |||||||| |||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 294 ggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgatcccttcatcaccac 353

                                                                 
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           |||||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 354 cgagtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 407



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
           ||||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| ||
Sbjct: 476 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctac 535

                                  
Query: 388 cggtgtcttcactgacaaggaca 410
            ||||| ||||| ||||||||||
Sbjct: 536 tggtgttttcaccgacaaggaca 558



to top

>gb|BT016360.1| Zea mays clone Contig193 mRNA sequence
          Length = 1293

 Score =  182 bits (92), Expect = 6e-43
 Identities = 221/264 (83%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||| |||||| |||| ||| ||||| || ||||| |||||||| ||||| || |||||
Sbjct: 61  catggccaagatcaagatcgggatcaatgggttcggcaggatcggaaggctggtggccag 120

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || ||||||||||| ||||||||||||||||| |||||||||||||||| |||
Sbjct: 121 ggtggccctgcagagcgacgacgtcgagctcgtcgccgtgaacgaccccttcatcagcac 180

                                                                       
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtga 264
           ||| |||||||| |||||||||||||| ||||| || ||||| || |||||||||  |||
Sbjct: 181 cgattacatgacctacatgttcaagtatgacactgtgcacggacagtggaagcaccatga 240

                                                                       
Query: 265 catcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttgg 324
             ||||| | || |||  |||||| || ||||| || ||||||   ||| |||| |||||
Sbjct: 241 ggtcaaggtgaaggactccaagacccttctctttggtgagaaggaggttgctgtgtttgg 300

                                   
Query: 325 cgtcaggaaccctgaggagatccc 348
           |  |||||||||||||||||||||
Sbjct: 301 ctgcaggaaccctgaggagatccc 324



to top

>gb|U45856.1|ZMU45856 Zea mays glyceraldehyde-3-phosphate dehydrogenase GAPC3 (gpc3)
           mRNA, complete cds
          Length = 1281

 Score =  180 bits (91), Expect = 2e-42
 Identities = 262/319 (82%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           ||||| |||||| |||| ||| ||||| || || || |||||||| ||||| || |||||
Sbjct: 73  catggccaagatcaagatcgggatcaatgggtttggcaggatcggaaggctggtggccag 132

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
           ||| || || ||||||||||| ||||||||||||||||| |||||||||||||||| |||
Sbjct: 133 ggtggccctgcagagcgacgacgtcgagctcgtcgccgtgaacgaccccttcatcagcac 192

                                                                       
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtga 264
           ||| |||||||| |||||||||||||| ||||| || ||||| || |||||||||  |||
Sbjct: 193 cgattacatgacctacatgttcaagtatgacactgtgcacggacagtggaagcaccatga 252

                                                                       
Query: 265 catcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttgg 324
             ||||| | || |||  |||||| || ||||| || ||||||   ||| |||| |||||
Sbjct: 253 ggtcaaggtgaaggactccaagacccttctctttggtgagaaggaggttgctgtgtttgg 312

                                                                       
Query: 325 cgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtc 384
           |  ||||||||||||||||||||| || |||  ||  || ||||| || ||||| |||||
Sbjct: 313 ctgcaggaaccctgaggagatcccatggggttcggttggcgctgaatatgttgttgagtc 372

                              
Query: 385 caccggtgtcttcactgac 403
            || ||||| |||||||||
Sbjct: 373 tactggtgttttcactgac 391



to top

>ref|NM_101214.2| Arabidopsis thaliana NAD binding / glyceraldehyde-3-phosphate
           dehydrogenase (phosphorylating)/
           glyceraldehyde-3-phosphate dehydrogenase AT1G13440 mRNA,
           complete cds
          Length = 1333

 Score =  167 bits (84), Expect = 4e-38
 Identities = 252/308 (81%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||||||||| |||||  |  | || || || || |  || ||||| ||
Sbjct: 98  cggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagaggga 157

                                                                       
Query: 163 cgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacat 222
            ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 158 tgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatacat 217

                                                                       
Query: 223 gttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacga 282
           ||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || ||
Sbjct: 218 gtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggatga 277

                                                                       
Query: 283 caagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagga 342
           ||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||||
Sbjct: 278 caaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgagga 337

                                                                       
Query: 343 gatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactga 402
            ||||| || |||||||| || ||||| |  ||||| ||||| || ||||||||||||||
Sbjct: 338 catcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcactga 397

                   
Query: 403 caaggaca 410
           ||| ||||
Sbjct: 398 caaagaca 405



to top

>gb|AY090275.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1017

 Score =  167 bits (84), Expect = 4e-38
 Identities = 252/308 (81%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||||||||| |||||  |  | || || || || |  || ||||| ||
Sbjct: 24  cggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagaggga 83

                                                                       
Query: 163 cgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacat 222
            ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 84  tgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatacat 143

                                                                       
Query: 223 gttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacga 282
           ||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || ||
Sbjct: 144 gtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggatga 203

                                                                       
Query: 283 caagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagga 342
           ||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||||
Sbjct: 204 caaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgagga 263

                                                                       
Query: 343 gatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactga 402
            ||||| || |||||||| || ||||| |  ||||| ||||| || ||||||||||||||
Sbjct: 264 catcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcactga 323

                   
Query: 403 caaggaca 410
           ||| ||||
Sbjct: 324 caaagaca 331



to top

>gb|AF410271.1|AF410271 Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1305

 Score =  167 bits (84), Expect = 4e-38
 Identities = 252/308 (81%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||||||||| |||||  |  | || || || || |  || ||||| ||
Sbjct: 95  cggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagaggga 154

                                                                       
Query: 163 cgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacat 222
            ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 155 tgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatacat 214

                                                                       
Query: 223 gttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacga 282
           ||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || ||
Sbjct: 215 gtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggatga 274

                                                                       
Query: 283 caagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagga 342
           ||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||||
Sbjct: 275 caaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgagga 334

                                                                       
Query: 343 gatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactga 402
            ||||| || |||||||| || ||||| |  ||||| ||||| || ||||||||||||||
Sbjct: 335 catcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcactga 394

                   
Query: 403 caaggaca 410
           ||| ||||
Sbjct: 395 caaagaca 402



to top

>gb|AY049259.1| Arabidopsis thaliana At1g13440/F13B4_8 mRNA, complete cds
          Length = 1306

 Score =  167 bits (84), Expect = 4e-38
 Identities = 252/308 (81%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||||||||| |||||  |  | || || || || |  || ||||| ||
Sbjct: 95  cggaatcaacggtttcggaagaatcggtcgtttggttgctagagttgttcttcagaggga 154

                                                                       
Query: 163 cgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacat 222
            ||||| ||||||||||| || ||||| || ||||||||||||||||||||||| |||||
Sbjct: 155 tgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatgacatacat 214

                                                                       
Query: 223 gttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacga 282
           ||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || || ||
Sbjct: 215 gtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaaggatga 274

                                                                       
Query: 283 caagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagga 342
           ||| || || |||||||| ||||||||||| ||||| || ||| ||||||||||||||||
Sbjct: 275 caaaactcttctcttcggtgagaagccagtcactgttttcggcatcaggaaccctgagga 334

                                                                       
Query: 343 gatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactga 402
            ||||| || |||||||| || ||||| |  ||||| ||||| || ||||||||||||||
Sbjct: 335 catcccatggggtgaggctggagctgactttgttgttgagtctactggtgtcttcactga 394

                   
Query: 403 caaggaca 410
           ||| ||||
Sbjct: 395 caaagaca 402



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  163 bits (82), Expect = 6e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                           
Query: 113     ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
               |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 1519416 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 1519475

                                                         
Query: 173     ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
               ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1519476 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 1519517



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                           
Query: 329     aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
               ||||||||||| ||||| ||||| | |||||| |||||||| || || ||||||||||||
Sbjct: 1520011 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 1520070

                                   
Query: 389     ggtgtcttcactgacaagga 408
               ||||||||||||||||||||
Sbjct: 1520071 ggtgtcttcactgacaagga 1520090



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                           
Query: 218     tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
               ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 1519808 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 1519867

                                               
Query: 278     gacgacaagacgctgctcttcggcgagaagcc 309
               |||  |||||| |||||||| |||||||||||
Sbjct: 1519868 gactccaagactctgctcttgggcgagaagcc 1519899



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 89      ggcaagattaagaccggaatcaacggt 115
               ||||||||||||| |||||||||||||
Sbjct: 1519277 ggcaagattaagatcggaatcaacggt 1519303



to top

>dbj|AP003886.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1163_G08
          Length = 150676

 Score =  163 bits (82), Expect = 6e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                         
Query: 113   ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
             |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 46904 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 46963

                                                       
Query: 173   ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
             ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 46964 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 47005



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                         
Query: 329   aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
             ||||||||||| ||||| ||||| | |||||| |||||||| || || ||||||||||||
Sbjct: 47499 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 47558

                                 
Query: 389   ggtgtcttcactgacaagga 408
             ||||||||||||||||||||
Sbjct: 47559 ggtgtcttcactgacaagga 47578



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                         
Query: 218   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
             ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 47296 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 47355

                                             
Query: 278   gacgacaagacgctgctcttcggcgagaagcc 309
             |||  |||||| |||||||| |||||||||||
Sbjct: 47356 gactccaagactctgctcttgggcgagaagcc 47387



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 89    ggcaagattaagaccggaatcaacggt 115
             ||||||||||||| |||||||||||||
Sbjct: 46765 ggcaagattaagatcggaatcaacggt 46791



to top

>dbj|AP004166.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1499_A07
          Length = 132146

 Score =  163 bits (82), Expect = 6e-37
 Identities = 97/102 (95%)
 Strand = Plus / Plus

                                                                          
Query: 113    ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
              |||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||
Sbjct: 129321 ggtttcggaaggatcgggaggctcgtggccagggtggccctccagagcgaggatgtcgag 129380

                                                        
Query: 173    ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
              ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 129381 ctcgtcgccgtcaacgaccccttcatcaccaccgactacatg 129422



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Plus

                                                                          
Query: 329    aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
              ||||||||||| ||||| ||||| | |||||| |||||||| || || ||||||||||||
Sbjct: 129916 aggaaccctgacgagattccgtgggctgaggctggtgctgagtatgtcgtggagtccacc 129975

                                  
Query: 389    ggtgtcttcactgacaagga 408
              ||||||||||||||||||||
Sbjct: 129976 ggtgtcttcactgacaagga 129995



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                          
Query: 218    tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
              ||||||||||||||||| || || |||||||| ||||||||||| ||||||||| |||| 
Sbjct: 129713 tacatgttcaagtacgataccgtgcacggccaatggaagcacagcgacatcaagatcaag 129772

                                              
Query: 278    gacgacaagacgctgctcttcggcgagaagcc 309
              |||  |||||| |||||||| |||||||||||
Sbjct: 129773 gactccaagactctgctcttgggcgagaagcc 129804



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 89     ggcaagattaagaccggaatcaacggt 115
              ||||||||||||| |||||||||||||
Sbjct: 129182 ggcaagattaagatcggaatcaacggt 129208



to top

>emb|X15596.1|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phosphate dehydrogenase (GADPH)
            subunit C
          Length = 5955

 Score =  149 bits (75), Expect = 8e-33
 Identities = 93/99 (93%)
 Strand = Plus / Plus

                                                                        
Query: 116  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
            |||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||||
Sbjct: 2836 ttcggaaggatcggcaggctcgtggccagggtcgccctccagagcgaggatgtcgagctc 2895

                                                   
Query: 176  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
            ||||||||||||||||||||||||||||| || ||||||
Sbjct: 2896 gtcgccgtcaacgaccccttcatcaccacggactacatg 2934



 Score =  109 bits (55), Expect = 7e-21
 Identities = 76/83 (91%)
 Strand = Plus / Plus

                                                                        
Query: 328  caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
            ||||||||||||||| |||||||| |||||||| || ||||| ||||| |||||||||||
Sbjct: 3520 caggaaccctgaggaaatcccgtggggtgaggctggcgctgagtacgtcgtggagtccac 3579

                                   
Query: 388  cggtgtcttcactgacaaggaca 410
            ||| |||||||||||||||||||
Sbjct: 3580 cggcgtcttcactgacaaggaca 3602



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                        
Query: 218  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
            |||||||||||||||||||| || |||||||| ||||||||||| |||||||  ||||| 
Sbjct: 3326 tacatgttcaagtacgacaccgtccacggccactggaagcacagcgacatcacactcaag 3385

                                                                  
Query: 278  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||  |||||| || |||||||| || ||||| || || ||||||||| |||||
Sbjct: 3386 gactccaagacccttctcttcggtgacaagccggtcaccgtctttggcatcagg 3439



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 89   ggcaagattaagaccggaatcaacggt 115
            ||||||||||||| |||||||||||||
Sbjct: 2692 ggcaagattaagatcggaatcaacggt 2718



to top

>emb|X73151.1|ZMGAPC2 Z.mays GapC2 gene
          Length = 6166

 Score =  147 bits (74), Expect = 3e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                        
Query: 113  ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
            ||||||||||||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 2389 ggtttcggaaggatcggcaggctcgtggccagggtcgccctgcagagcgaggatgtcgag 2448

                                                      
Query: 173  ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
            |||||||||||||||||||||||||||||||| || ||||||
Sbjct: 2449 ctcgtcgccgtcaacgaccccttcatcaccacggattacatg 2490



 Score =  117 bits (59), Expect = 3e-23
 Identities = 77/83 (92%)
 Strand = Plus / Plus

                                                                        
Query: 328  caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
            ||||||||| |||||||||||||| |||||||| |||||||| || || |||||||||||
Sbjct: 3031 caggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggagtccac 3090

                                   
Query: 388  cggtgtcttcactgacaaggaca 410
            |||||||||||||||||||||||
Sbjct: 3091 cggtgtcttcactgacaaggaca 3113



 Score =  107 bits (54), Expect = 3e-20
 Identities = 99/114 (86%)
 Strand = Plus / Plus

                                                                        
Query: 218  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
            |||||||||||||||||||| || |||||||| ||||||||||| ||||||   ||||| 
Sbjct: 2830 tacatgttcaagtacgacaccgtgcacggccaatggaagcacagcgacatcgccctcaag 2889

                                                                  
Query: 278  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            |||  ||||||||| ||||||||||||||||| || || ||||||||| |||||
Sbjct: 2890 gactccaagacgcttctcttcggcgagaagccggtcaccgtctttggcatcagg 2943



to top

>gb|U45858.1|ZMU45858 Zea mays glyceraldehyde-3-phosphate dehydrogenase (gpc2) gene,
           complete cds
          Length = 4590

 Score =  147 bits (74), Expect = 3e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                       
Query: 113 ggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgag 172
           ||||||||||||||||| |||||||| ||||||||||| || |||||||| |||||||||
Sbjct: 798 ggtttcggaaggatcggcaggctcgtggccagggtcgccctgcagagcgaggatgtcgag 857

                                                     
Query: 173 ctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           |||||||||||||||||||||||||||||||| || ||||||
Sbjct: 858 ctcgtcgccgtcaacgaccccttcatcaccacggattacatg 899



 Score =  117 bits (59), Expect = 3e-23
 Identities = 77/83 (92%)
 Strand = Plus / Plus

                                                                        
Query: 328  caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
            ||||||||| |||||||||||||| |||||||| |||||||| || || |||||||||||
Sbjct: 1445 caggaaccccgaggagatcccgtggggtgaggctggtgctgagtatgtcgtggagtccac 1504

                                   
Query: 388  cggtgtcttcactgacaaggaca 410
            |||||||||||||||||||||||
Sbjct: 1505 cggtgtcttcactgacaaggaca 1527



 Score =  115 bits (58), Expect = 1e-22
 Identities = 103/118 (87%)
 Strand = Plus / Plus

                                                                        
Query: 214  gacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagct 273
            |||||||||||||||||||||||| || |||||||| ||||||||||| ||||||   ||
Sbjct: 1240 gacgtacatgttcaagtacgacaccgtgcacggccaatggaagcacagcgacatcgccct 1299

                                                                      
Query: 274  caaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            ||| |||  ||||||||| ||||||||||||||||| || || ||||||||| |||||
Sbjct: 1300 caaggactccaagacgcttctcttcggcgagaagccggtcaccgtctttggcatcagg 1357



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 390  gtgtcttcactgacaaggaca 410
            |||||||||||||||||||||
Sbjct: 1567 gtgtcttcactgacaaggaca 1587



to top

>emb|AL606998.3|OSJN00125 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000223_09, complete
              sequence
          Length = 120583

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                          
Query: 116    ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
              ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 103437 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 103496

                                                     
Query: 176    gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
              |||||||||||||||||||||||||||||||| ||||||
Sbjct: 103497 gtcgccgtcaacgaccccttcatcaccaccgactacatg 103535



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                          
Query: 327    tcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtcca 386
              |||||||||||||||||||||| || |||||| | || ||||| |  |||||||||||||
Sbjct: 104277 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 104336

                                      
Query: 387    ccggtgtcttcactgacaaggaca 410
              | ||||| ||||||||||||||||
Sbjct: 104337 ctggtgttttcactgacaaggaca 104360



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 218    tacatgttcaagtacgacacagttcacggccattggaagca 258
              |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 104082 tacatgttcaagtatgacactgtgcacggccagtggaagca 104122



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                            
Query: 116      ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
                ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 24281025 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 24281084

                                                       
Query: 176      gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
                |||||||||||||||||||||||||||||||| ||||||
Sbjct: 24281085 gtcgccgtcaacgaccccttcatcaccaccgactacatg 24281123



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                            
Query: 327      tcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtcca 386
                |||||||||||||||||||||| || |||||| | || ||||| |  |||||||||||||
Sbjct: 24281865 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 24281924

                                        
Query: 387      ccggtgtcttcactgacaaggaca 410
                | ||||| ||||||||||||||||
Sbjct: 24281925 ctggtgttttcactgacaaggaca 24281948



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 155      cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
                ||||| || ||||||||| | |||||| |||||||| ||||||||||| | |||||||||
Sbjct: 18605737 cagagtgaggatgtcgagttggtcgccatcaacgactccttcatcaccgctgagtacatg 18605678



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 218      tacatgttcaagtacgacacagttcacggccattggaagca 258
                |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 24281670 tacatgttcaagtatgacactgtgcacggccagtggaagca 24281710



to top

>emb|AL627350.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0302E05, complete
            sequence
          Length = 61795

 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                        
Query: 116  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
            ||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||
Sbjct: 9344 ttcgggaggatcgggaggctcgtggccagggtggccctgcagagcgacgacgtcgagctc 9403

                                                   
Query: 176  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
            |||||||||||||||||||||||||||||||| ||||||
Sbjct: 9404 gtcgccgtcaacgaccccttcatcaccaccgactacatg 9442



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                         
Query: 327   tcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtcca 386
             |||||||||||||||||||||| || |||||| | || ||||| |  |||||||||||||
Sbjct: 10169 tcaggaaccctgaggagatcccatggggtgagactggcgctgagtttgttgtggagtcca 10228

                                     
Query: 387   ccggtgtcttcactgacaaggaca 410
             | ||||| ||||||||||||||||
Sbjct: 10229 ctggtgttttcactgacaaggaca 10252



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 218   tacatgttcaagtacgacacagttcacggccattggaagca 258
             |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 9974  tacatgttcaagtatgacactgtgcacggccagtggaagca 10014



to top

>dbj|D21280.1|RICAD18 Oryza sativa AD18 mRNA for glyceraldehyde-3-phosphate
           dehydrogenase, partial sequence
          Length = 422

 Score =  137 bits (69), Expect = 3e-29
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 140 gccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||||||| || || |||||||| |||||||||||||| ||||||||||  |||||||||
Sbjct: 46  gccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtcaacgntcccttcatc 105

                                                                      
Query: 200 accaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           ||||||| ||||||||| |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 106 accaccgngtacatgacatacatgttcaagtatgacaccgtccacggccagtggaagca 164



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 69/81 (85%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                       
Query: 328 caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacg-ttgtggagtcca 386
           ||||||||||||||||||||| || | || ||| |||||||| |||| |||| ||||| |
Sbjct: 234 caggaaccctgaggagatcccatgggctgcggctggtgctgaatacgtttgttgagtcta 293

                                
Query: 387 ccggtgtcttcactgacaagg 407
           | ||||| ||||| |||||||
Sbjct: 294 ctggtgttttcaccgacaagg 314



to top

>emb|X60347.1|MLGADPH M.liliiflora GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1397

 Score =  133 bits (67), Expect = 5e-28
 Identities = 256/319 (80%)
 Strand = Plus / Plus

                                                                       
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgca 151
           ||||| |||| |||||||||||| || |||||||||||  |  | || || || ||||| 
Sbjct: 55  aagatcaagatcggaatcaacggatttggaaggatcggccgtttggtagcaagagtcgct 114

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           || ||||| || ||||| |||||||| |||||||| || |||||||| ||||| || |||
Sbjct: 115 ctgcagagggatgatgtggagctcgttgccgtcaatgatcccttcattaccacagattac 174

                                                                       
Query: 212 atgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaag 271
           ||||| |||||||||||||| || |  || || || || ||||||||   |||  |||||
Sbjct: 175 atgacttacatgttcaagtatgatagtgtccatgggcaatggaagcatcatgagctcaag 234

                                                                       
Query: 272 ctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            | || |||  |||||| || ||||| || ||||| |||||||| |||||||| ||||||
Sbjct: 235 gtgaaggactccaagacccttctctttggtgagaaaccagttaccgtctttggtgtcagg 294

                                                                       
Query: 332 aaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggt 391
           |||||||| ||||| || || |||||| | |||||||| |  ||||||||||| || || 
Sbjct: 295 aaccctgaagagattccatggggtgagactggtgctgaatttgttgtggagtcaactgga 354

                              
Query: 392 gtcttcactgacaaggaca 410
           || || |||||||||||||
Sbjct: 355 gtgtttactgacaaggaca 373



to top

>gb|M36650.1|BLYGAPDH Barley glyceraldehyde-3-phosphate dehydrogenase mRNA, 3' end
          Length = 1141

 Score =  129 bits (65), Expect = 8e-27
 Identities = 188/229 (82%)
 Strand = Plus / Plus

                                                                       
Query: 182 gtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagtt 241
           ||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| || 
Sbjct: 1   gtcaacgacccgttcatcaccaccgactacatgacctacatgttcaagtatgacactgtc 60

                                                                       
Query: 242 cacggccattggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggc 301
           ||||| || |||||||||  |||  | ||| | || |||  |||||| || |||||||| 
Sbjct: 61  cacggacagtggaagcaccatgaagttaaggtgaaggactccaagacccttctcttcggt 120

                                                                       
Query: 302 gagaagccagttactgtctttggcgtcaggaaccctgaggagatcccgtgaggtgaggcc 361
           ||||||   ||| |||| |||||   ||| ||||| |||||||| || || |  |  || 
Sbjct: 121 gagaaggaggttgctgtgtttggttgcagaaaccccgaggagattccatgggccgctgct 180

                                                            
Query: 362 ggtgctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           |||||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 181 ggtgctgagtacgttgtggagtccaccggtgttttcactgacaaggaca 229



to top

>emb|X75597.1|ANDAP3DH A.nummularia mRNA for glyceraldehyde-3-phosphate dehydrogenase
          Length = 1339

 Score =  123 bits (62), Expect = 5e-25
 Identities = 185/226 (81%)
 Strand = Plus / Plus

                                                                       
Query: 185 aacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagttcac 244
           ||||| |||||||| |||||||| |||||||| |||||||| ||||||||||  ||||||
Sbjct: 153 aacgatcccttcattaccaccgattacatgacctacatgtttaagtacgacagtgttcac 212

                                                                       
Query: 245 ggccattggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggcgag 304
           || || |||||||||  |||  | ||| | || || || ||||| || |||||||| |||
Sbjct: 213 ggtcaatggaagcaccatgagcttaaggttaaggatgagaagactcttctcttcggtgag 272

                                                                       
Query: 305 aagccagttactgtctttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggt 364
           | ||| || || || || ||   ||||||||| ||||||||||| || ||  || |||| 
Sbjct: 273 aggcccgtcaccgttttcggtaacaggaacccagaggagatcccatggggccagaccgga 332

                                                         
Query: 365 gctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           ||||| |||||||| |||||||| ||||||||||||||||||||||
Sbjct: 333 gctgactacgttgttgagtccactggtgtcttcactgacaaggaca 378



to top

>gb|U02886.1|ANGAPDH Atriplex nummularia glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1339

 Score =  123 bits (62), Expect = 5e-25
 Identities = 185/226 (81%)
 Strand = Plus / Plus

                                                                       
Query: 185 aacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgacacagttcac 244
           ||||| |||||||| |||||||| |||||||| |||||||| ||||||||||  ||||||
Sbjct: 153 aacgatcccttcattaccaccgattacatgacctacatgtttaagtacgacagtgttcac 212

                                                                       
Query: 245 ggccattggaagcacagtgacatcaagctcaaagacgacaagacgctgctcttcggcgag 304
           || || |||||||||  |||  | ||| | || || || ||||| || |||||||| |||
Sbjct: 213 ggtcaatggaagcaccatgagcttaaggttaaggatgagaagactcttctcttcggtgag 272

                                                                       
Query: 305 aagccagttactgtctttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggt 364
           | ||| || || || || ||   ||||||||| ||||||||||| || ||  || |||| 
Sbjct: 273 aggcccgtcaccgttttcggtaacaggaacccagaggagatcccatggggccagaccgga 332

                                                         
Query: 365 gctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           ||||| |||||||| |||||||| ||||||||||||||||||||||
Sbjct: 333 gctgactacgttgttgagtccactggtgtcttcactgacaaggaca 378



to top

>gb|J05223.1|CIPNADGAPD M.crystallinum glyceraldehyde-3-phosphate dehydrogenase (NAD-GAPDH)
           mRNA, complete cds
          Length = 1354

 Score =  121 bits (61), Expect = 2e-24
 Identities = 249/309 (80%), Gaps = 2/309 (0%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||| |||||||||||| |  | |||||||| ||    |||||||| ||
Sbjct: 72  cggaatcaacggttttggaaggatcgggcgtttggtcgccagagtgatcctccagaggga 131

                                                                       
Query: 163 cga-tgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtaca 221
            || ||| ||||||||||| |||||||||||||||||| ||||||| |||||||| ||||
Sbjct: 132 tgactgt-gagctcgtcgctgtcaacgaccccttcatctccaccgattacatgacataca 190

                                                                       
Query: 222 tgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacg 281
           |||||||||||||||  || ||||| || || |||  |  ||| |||||| | || ||||
Sbjct: 191 tgttcaagtacgacagtgtccacggtcagtgcaagagccatgagatcaagttgaaggacg 250

                                                                       
Query: 282 acaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagg 341
           | ||||| || |||||||| ||||  || ||  | ||||| ||   ||||||||| ||||
Sbjct: 251 agaagacccttctcttcggtgagaccccggtcgccgtcttcggatgcaggaacccagagg 310

                                                                       
Query: 342 agatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactg 401
           | ||||| || ||| |||| || || || | |||||| || |||||||| |||||||| |
Sbjct: 311 aaatcccatggggtcaggctggagccgacttcgttgtcgaatccaccggagtcttcaccg 370

                    
Query: 402 acaaggaca 410
           |||||||||
Sbjct: 371 acaaggaca 379



to top

>gb|M29956.1|CIPGPDNAD Common ice plant (M.crystallinum) NAD-glyceraldehyde-3-phosphate
           dehydrogenase mRNA, complete cds
          Length = 1354

 Score =  121 bits (61), Expect = 2e-24
 Identities = 249/309 (80%), Gaps = 2/309 (0%)
 Strand = Plus / Plus

                                                                       
Query: 103 cggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcga 162
           ||||||||||||||| |||||||||||| |  | |||||||| ||    |||||||| ||
Sbjct: 72  cggaatcaacggttttggaaggatcgggcgtttggtcgccagagtgatcctccagaggga 131

                                                                       
Query: 163 cga-tgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtaca 221
            || ||| ||||||||||| |||||||||||||||||| ||||||| |||||||| ||||
Sbjct: 132 tgactgt-gagctcgtcgctgtcaacgaccccttcatctccaccgattacatgacataca 190

                                                                       
Query: 222 tgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacg 281
           |||||||||||||||  || ||||| || || |||  |  ||| |||||| | || ||||
Sbjct: 191 tgttcaagtacgacagtgtccacggtcagtgcaagagccatgagatcaagttgaaggacg 250

                                                                       
Query: 282 acaagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgagg 341
           | ||||| || |||||||| ||||  || ||  | ||||| ||   ||||||||| ||||
Sbjct: 251 agaagacccttctcttcggtgagaccccggtcgccgtcttcggatgcaggaacccagagg 310

                                                                       
Query: 342 agatcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactg 401
           | ||||| || ||| |||| || || || | |||||| || |||||||| |||||||| |
Sbjct: 311 aaatcccatggggtcaggctggagccgacttcgttgtcgaatccaccggagtcttcaccg 370

                    
Query: 402 acaaggaca 410
           |||||||||
Sbjct: 371 acaaggaca 379



to top

>emb|X60346.1|PHGADPHR P.hybrida GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1476

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 209 tacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatc 268
           |||||||| |||||||||||||| ||||  || |||||||| ||||| |||  |||  ||
Sbjct: 306 tacatgacatacatgttcaagtatgacagtgtccacggccagtggaaacaccatgagctc 365

                                                                       
Query: 269 aagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtc 328
           |||   || || |||||||| || ||||| ||||||||||| ||||| || || ||| | 
Sbjct: 366 aaggctaaggatgacaagactcttctctttggcgagaagcctgttaccgtattcggcatt 425

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
           || ||||||||||||||||| || |||||||| || || |||||||| |||||||| || 
Sbjct: 426 agaaaccctgaggagatcccatggggtgaggctggagcagattacgtcgtggagtcgact 485

                         
Query: 389 ggtgtcttcactga 402
           ||||||||||||||
Sbjct: 486 ggtgtcttcactga 499



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 92  aagattaagaccggaatcaacggtttcggaag 123
           ||||||||||  |||||||||||||| |||||
Sbjct: 189 aagattaagattggaatcaacggttttggaag 220



to top

>emb|X73152.1|ZMGAPC4 Z.mays GapC4 gene
          Length = 4929

 Score =  109 bits (55), Expect = 7e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                        
Query: 116  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
            ||||| |||||||| ||||| || |||||||| || || ||||| |||||||||||||||
Sbjct: 1126 ttcggcaggatcggaaggctggtggccagggtggccctgcagagtgacgatgtcgagctc 1185

                                                   
Query: 176  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
            |||||||| |||||||||||||||| |||||| ||||||
Sbjct: 1186 gtcgccgtgaacgaccccttcatcagcaccgactacatg 1224



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 328  caggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccac 387
            |||||||||||||||||||||||| |||  ||  |||||||| || ||||| ||||| ||
Sbjct: 2888 caggaaccctgaggagatcccgtggggttcggttggtgctgaatatgttgttgagtctac 2947

                                 
Query: 388  cggtgtcttcactgacaagga 408
             ||||| ||||||||| ||||
Sbjct: 2948 tggtgttttcactgaccagga 2968



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                      
Query: 218  tacatgttcaagtacgacacagttcacggccattggaagcac 259
            |||||||||||||||||||| || ||||| || |||||||||
Sbjct: 2687 tacatgttcaagtacgacactgtgcacggacagtggaagcac 2728



to top

>gb|U45859.1|ZMU45859 Zea mays glyceraldehyde-3-phosphate dehydrogenase (gpc4) gene,
            partial cds
          Length = 4627

 Score =  109 bits (55), Expect = 7e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                        
Query: 116  ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
            ||||| |||||||| ||||| || |||||||| || || ||||| |||||||||||||||
Sbjct: 3423 ttcggcaggatcggaaggctggtggccagggtggctctgcagagtgacgatgtcgagctc 3482

                                                   
Query: 176  gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
            |||||||| |||||||||||||||| |||||| ||||||
Sbjct: 3483 gtcgccgtgaacgaccccttcatcagcaccgactacatg 3521



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                            
Query: 125      atcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtc 184
                ||||| ||||| || |||||||| || || |||||||| |||||||||||||| ||||||
Sbjct: 23547022 atcggcaggctggtggccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtc 23547081

                                              
Query: 185      aacgaccccttcatcaccaccgagtacatg 214
                ||||| ||||||||||||||||||||||||
Sbjct: 23547082 aacgatcccttcatcaccaccgagtacatg 23547111



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                            
Query: 329      aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
                |||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| || 
Sbjct: 23547895 aggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctact 23547954

                                      
Query: 389      ggtgtcttcactgacaaggaca 410
                ||||| ||||| ||||||||||
Sbjct: 23547955 ggtgttttcaccgacaaggaca 23547976



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                         
Query: 218      tacatgttcaagtacgacacagttcacggccattggaagca 258
                |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 23547698 tacatgttcaagtatgacaccgtccacggccagtggaagca 23547738



to top

>dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1791_B03
          Length = 166214

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 125    atcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtc 184
              ||||| ||||| || |||||||| || || |||||||| |||||||||||||| ||||||
Sbjct: 112705 atcggcaggctggtggccagggtggcgctgcagagcgaggatgtcgagctcgttgccgtc 112764

                                            
Query: 185    aacgaccccttcatcaccaccgagtacatg 214
              ||||| ||||||||||||||||||||||||
Sbjct: 112765 aacgatcccttcatcaccaccgagtacatg 112794



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                          
Query: 329    aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
              |||||||||||||||||||| || | || ||| |||||||| |||||||| ||||| || 
Sbjct: 113578 aggaaccctgaggagatcccatgggctgcggctggtgctgaatacgttgttgagtctact 113637

                                    
Query: 389    ggtgtcttcactgacaaggaca 410
              ||||| ||||| ||||||||||
Sbjct: 113638 ggtgttttcaccgacaaggaca 113659



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 218    tacatgttcaagtacgacacagttcacggccattggaagca 258
              |||||||||||||| ||||| || |||||||| ||||||||
Sbjct: 113381 tacatgttcaagtatgacaccgtccacggccagtggaagca 113421



to top

>gb|DQ267444.1| Elaeis guineensis glyceraldehyde 3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 1139

 Score =  105 bits (53), Expect = 1e-19
 Identities = 107/125 (85%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || ||||| |||||||||| ||| |||||||||||| | |||||||||||||||
Sbjct: 73  aagacccttctctttggcgagaagcaagtcactgtctttggcattaggaaccctgaggag 132

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || |||||  | ||||| || || ||||||||||| || |||||||| ||||||
Sbjct: 133 atcccatggggtgaaactggtgcagagtatgttgtggagtctactggtgtctttactgac 192

                
Query: 404 aagga 408
           |||||
Sbjct: 193 aagga 197



to top

>emb|AJ133422.1|NTA133422 Nicotiana tabacum mRNA for glyceraldehyde-3-phosphate dehydrogenase
          Length = 1420

 Score =  101 bits (51), Expect = 2e-18
 Identities = 216/271 (79%)
 Strand = Plus / Plus

                                                                       
Query: 140 gccagggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||||||| || ||||| || || ||||| ||||| ||||| || |||||||| ||||||
Sbjct: 187 gccagggttgctctccaaagagatgatgttgagcttgtcgcagttaacgaccctttcatc 246

                                                                       
Query: 200 accaccgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagcac 259
            |    || |||||||| || ||||||||||| || |  || |||||||| |||||||||
Sbjct: 247 tctgttgaatacatgacatatatgttcaagtatgatagtgtacacggccagtggaagcac 306

                                                                       
Query: 260 agtgacatcaagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtc 319
              ||  ||||| | || || |||||||| || ||||| || |||||| | |||||||| 
Sbjct: 307 cacgagctcaaggttaaggatgacaagacccttctctttggtgagaaggctgttactgtt 366

                                                                       
Query: 320 tttggcgtcaggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtg 379
           |||||| | |||||||| |||||||| || || ||  || | || || |||||| |||||
Sbjct: 367 tttggctttaggaacccagaggagattccatggggccagactggagcagattacattgtg 426

                                          
Query: 380 gagtccaccggtgtcttcactgacaaggaca 410
           ||||| || ||||||||||||||||||||||
Sbjct: 427 gagtcgactggtgtcttcactgacaaggaca 457



to top

>gb|DQ355800.1| Glycine max glyceraldehyde-3-phosphate dehydrogenase (GAPC1) mRNA,
           complete cds
          Length = 1508

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 85  catgggcaagattaagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccag 144
           |||||||||| | |||| |||||||||||| || ||||| || ||  |  | || |||||
Sbjct: 64  catgggcaaggtcaagatcggaatcaacggatttggaagaattggccgtttggtagccag 123

                                                                       
Query: 145 ggtcgcactccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccac 204
            || || || ||||| |||||||| || ||||| ||||| |||||||| |||||||||||
Sbjct: 124 agtggctctgcagagagacgatgttgaactcgttgccgttaacgaccctttcatcaccac 183

                                                                 
Query: 205 cgagtacatgacgtacatgttcaagtacgacacagttcacggccattggaagca 258
           ||| |||||||| |||||||| || |||||||  ||||| || || ||||||||
Sbjct: 184 cgattacatgacatacatgtttaaatacgacagtgttcatggacactggaagca 237



to top

>emb|AJ246011.1|CAN246011 Capsicum annuum mRNA for partial glyceraldehyde-3-phosphate
           dehydrogenase, subunit GapC1
          Length = 952

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 150/185 (81%)
 Strand = Plus / Plus

                                                                       
Query: 164 gatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatg 223
           ||||| |||||||| || || ||||| || |||||||||  ||| |||||||| ||||||
Sbjct: 67  gatgttgagctcgttgctgttaacgatcctttcatcaccgtcgattacatgacatacatg 126

                                                                       
Query: 224 ttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaagacgac 283
           || ||||| ||||  |||||||| || |||||| ||| |||  ||||| | || ||||| 
Sbjct: 127 tttaagtatgacagtgttcacggtcaatggaagaacaatgaagtcaaggttaaggacgag 186

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || ||||| || |||||||| |||||||| | |||| | || ||||| ||||||
Sbjct: 187 aagactcttctctttggtgagaagcctgttactgtatatggcattagaaacccagaggag 246

                
Query: 344 atccc 348
           |||||
Sbjct: 247 atccc 251



to top

>gb|BT012693.1| Lycopersicon esculentum clone 113563F, mRNA sequence
          Length = 1323

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || ||||| || |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 292 aagacacttctctttggagagaaggctgttacagtttttggaatcaggaaccctgaagat 351

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || ||||| || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 352 atcccatggggtgaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 411

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 412 aaggaca 418



to top

>gb|AC016829.7|ATAC016829 Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence,
             complete sequence
          Length = 110804

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Minus

                                                                         
Query: 152   ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
             |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 79361 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 79302

                
Query: 212   atg 214
             |||
Sbjct: 79301 atg 79299



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                         
Query: 218   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
             |||||||||||||||||||  |||||||| || ||||| |||| |||  ||||| |||| 
Sbjct: 78932 tacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaagatcaag 78873

                                                                   
Query: 278   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
             || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 78872 gatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 78819



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 329   aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
             |||||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || 
Sbjct: 78727 aggaaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctact 78668

                                   
Query: 389   ggtgtcttcactgacaaggaca 410
             ||||||||||||||||| ||||
Sbjct: 78667 ggtgtcttcactgacaaagaca 78646



to top

>gb|U97257.1|LEU97257 Lycopersicon esculentum glyceraldehyde 3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1285

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || ||||| || |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 270 aagacacttctctttggagagaaggctgttacagtttttggaatcaggaaccctgaagat 329

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || ||||| || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 330 atcccatggggtgaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 389

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 390 aaggaca 396



to top

>gb|DQ252489.1| Solanum tuberosum clone 056C03 glyceraldehyde 3-phosphate
           dehydrogenase-like mRNA, complete cds
          Length = 1287

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 254 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 313

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || || || || |||||||| | |||||| || || ||||||||||||||||||
Sbjct: 314 atcccatggggagaagctggtgctgacttcgttgttgaatcaaccggtgtcttcactgac 373

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 374 aaggaca 380



to top

>gb|M64119.1|ATHGAPCA Arabidopsis thaliana cytosolic glyceraldehyde-3-phosphate
           dehydrogenase (GapC) gene, exons 1-9, complete cds
          Length = 2705

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 152 ctccagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac 211
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 677 ctccagagggacgatgttgagctcgtcgctgtcaacgaccccttcatcactactgagtac 736

              
Query: 212 atg 214
           |||
Sbjct: 737 atg 739



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                        
Query: 218  tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
            |||||||||||||||||||  |||||||| || ||||| |||| |||  ||||| |||| 
Sbjct: 1106 tacatgttcaagtacgacagtgttcacggtcaatggaaacacaatgaactcaagatcaag 1165

                                                                  
Query: 278  gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
            || || ||||| || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 1166 gatgagaagacccttctcttcggtgagaagccagtcactgttttcggcatcagg 1219



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 70/82 (85%)
 Strand = Plus / Plus

                                                                        
Query: 329  aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
            |||||||||||||| ||||| || |  ||||| || ||||| |||||||| ||||| || 
Sbjct: 1311 aggaaccctgaggatatcccatgggccgaggctggagctgactacgttgttgagtctact 1370

                                  
Query: 389  ggtgtcttcactgacaaggaca 410
            ||||||||||||||||| ||||
Sbjct: 1371 ggtgtcttcactgacaaagaca 1392



to top

>gb|DQ173770.1| Populus maximowiczii x Populus nigra glyceraldehyde-3-phosphate
           dehydrogenase (G3PDH) mRNA, complete cds
          Length = 1349

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 162/202 (80%)
 Strand = Plus / Plus

                                                                       
Query: 209 tacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatc 268
           |||||||| || |||||||| || || ||||||||||| |  ||||||||| ||||  ||
Sbjct: 225 tacatgacatatatgttcaaatatgatacagttcacggtcgctggaagcacggtgagctc 284

                                                                       
Query: 269 aagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtc 328
           ||| | || || || ||||| || ||||| || |||||| ||||  |||| |||||| ||
Sbjct: 285 aaggttaaggatgagaagacccttctctttggtgagaaggcagtcgctgtttttggcatc 344

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
           |||||||| ||||||||||| || | | | ||||||||||| |  || || |||||||| 
Sbjct: 345 aggaacccagaggagatcccatgggctcaagccggtgctgagtttgtcgttgagtccact 404

                                 
Query: 389 ggtgtcttcactgacaaggaca 410
           || || ||||| ||||||||||
Sbjct: 405 ggagttttcacagacaaggaca 426



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 92  aagattaagaccggaatcaacggtttcggaaggatcgg 129
           |||||||||| ||| |||||||| || |||||||||||
Sbjct: 108 aagattaagatcggtatcaacggatttggaaggatcgg 145



to top

>gb|U96623.1|SLU96623 Selaginella lepidophylla glyceraldehyde-3-phosphate-dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1159

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                       
Query: 159 gcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgt 218
           |||||||||| |||||||| ||||| ||||| || ||||||| ||| ||||||||| | |
Sbjct: 138 gcgacgatgttgagctcgttgccgtgaacgatccattcatcagcactgagtacatggctt 197

                             
Query: 219 acatgttcaagtacgaca 236
           ||||||||||||||||||
Sbjct: 198 acatgttcaagtacgaca 215



to top

>gb|M14419.1|TOBGAPC Tobacco (N.tabacum) GapC mRNA encoding cytosolic
           glyceraldehyde-3-phosphophate dehydrogenase, partial cds
          Length = 1174

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
           |||||||||||||| || || || | ||| || |||||||||| ||||||||| ||||| 
Sbjct: 211 aggaaccctgaggaaattccatgggctgaagctggtgctgatttcgttgtggaatccact 270

                                 
Query: 389 ggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||
Sbjct: 271 ggtgtcttcactgacaaggaca 292



to top

>gb|L13432.1|MZEGAPDB Zea mays GAPC2 glyceraldehyde-3-phosphate dehydrogenase mRNA,
           partial cds
          Length = 971

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 355 tgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           |||||| |||||||| || || ||||||||||||||||||||||||||||||||||
Sbjct: 1   tgaggctggtgctgagtatgtcgtggagtccaccggtgtcttcactgacaaggaca 56



to top

>gb|AF527779.1| Solanum tuberosum glyceraldehyde 3-phosphate dehydrogenase mRNA,
           complete cds
          Length = 1194

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 205 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 264

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || || || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 265 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 324

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 325 aaggaca 331



to top

>gb|DQ241857.1| Solanum tuberosum clone 014E02 glyceraldehyde 3-phosphate
           dehydrogenase-like mRNA, complete cds
          Length = 1202

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 266 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 325

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || || || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 326 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 385

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 386 aaggaca 392



to top

>gb|DQ268845.1| Solanum tuberosum clone 147E07 glyceraldehyde 3-phosphate
           dehydrogenase-like protein mRNA, complete cds
          Length = 1293

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 265 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 324

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || || || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 325 atcccatggggggaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 384

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 385 aaggaca 391



to top

>dbj|AB110609.1| Lycopersicon esculentum GAPDH gene for glyceraldehyde 3-phosphate
           dehydrogenase, partial cds
          Length = 1477

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
           ||||||||||| || ||||| || ||||| || |||||||| | |||||| || || |||
Sbjct: 161 aggaaccctgaagatatcccatggggtgaagctggtgctgacttcgttgttgaatcaacc 220

                                 
Query: 389 ggtgtcttcactgacaaggaca 410
           ||||||||||||||||||||||
Sbjct: 221 ggtgtcttcactgacaaggaca 242



to top

>emb|X60344.1|PHGADPH P.hortense GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1266

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 168 tcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttca 227
           ||||||| || ||||||||||| || ||||| ||||| ||||||||||| ||||||||||
Sbjct: 115 tcgagcttgttgccgtcaacgatccattcattaccactgagtacatgacctacatgttca 174

                    
Query: 228 agtacgaca 236
           | |||||||
Sbjct: 175 aatacgaca 183



to top

>dbj|AB164359.1| Periploca sepium PsGAPDH mRNA for D-glyceraldehyde-3-phosphate
           dehydrogenase, partial cds
          Length = 593

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 103/125 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || ||||| ||||||||||| || |  ||||| ||  |||||||||||||||||
Sbjct: 50  aagactcttctctttggcgagaagcctgtaaaggtcttcggaatcaggaaccctgaggag 109

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || |||||||| || ||||| | |||||| ||||| || ||||| || ||||| 
Sbjct: 110 atcccatggggtgaggctggagctgacttcgttgttgagtctactggtgtttttactgat 169

                
Query: 404 aagga 408
           |||||
Sbjct: 170 aagga 174



to top

>ref|XM_450090.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2136

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 155 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 747 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 806



to top

>gb|AY491512.2| Daucus carota glyceraldehyde 3-phosphate dehydrogenase (G3PDH)
           mRNA, complete cds
          Length = 1307

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 93/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 299 ggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatcccgtgaggtgag 358
           ||||||||||| ||| ||||||||||   ||||||||||||||||||||| || | |   
Sbjct: 278 ggcgagaagcctgttgctgtctttggttgcaggaaccctgaggagatcccttgggctagc 337

                                                               
Query: 359 gccggtgctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
            | ||||| || ||| ||||||||||||| ||||| ||||| ||||||||||
Sbjct: 338 actggtgcagagtacattgtggagtccactggtgtgttcaccgacaaggaca 389



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 98  aagaccggaatcaacggtttcggaaggatcgg 129
           |||| |||||||||||| |||||||| |||||
Sbjct: 77  aagatcggaatcaacggattcggaagaatcgg 108



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                           
Query: 155     cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
               ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 1561636 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 1561577



to top

>dbj|AP005746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0018I03
          Length = 145818

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                         
Query: 155   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
             ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 89880 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 89821



to top

>dbj|AK066284.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067C01, full
           insert sequence
          Length = 2137

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 155 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||||||  |||||||||| ||||||||||| ||| ||||||||||||| |||||||||
Sbjct: 747 cagagcgagtatgtcgagcttgtcgccgtcaatgactccttcatcaccactgagtacatg 806



to top

>emb|CT573421.5| M.truncatula DNA sequence from clone MTH2-27B10 on chromosome 3,
             complete sequence
          Length = 123669

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                         
Query: 329   aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
             ||||||||||||||||| || || |||||||  || |||||||||||| | ||||| || 
Sbjct: 55652 aggaaccctgaggagattccatggggtgaggttggagctgattacgttattgagtcaact 55593

                                 
Query: 389   ggtgtcttcactgacaagga 408
             ||||| ||||||||||||||
Sbjct: 55592 ggtgttttcactgacaagga 55573



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 221   atgttcaagtacgacacagttcacggccattggaagca 258
             ||||||||||| ||||| |||||||| || ||||||||
Sbjct: 55867 atgttcaagtatgacactgttcacggtcagtggaagca 55830



to top

>gb|U17005.1|STU17005 Solanum tuberosum glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 
           mRNA, complete cds
          Length = 900

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 104/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 284 aagacgctgctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggag 343
           ||||| || |||||||| |||||| | ||||| || |||||  ||||||||||||| || 
Sbjct: 163 aagacccttctcttcggtgagaaggctgttacagtttttggaatcaggaaccctgaagat 222

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || |  || || |||||||| | ||| || || || ||||||||||||||||||
Sbjct: 223 atcccatgggcagaagctggtgctgacttcgtcgttgaatcaaccggtgtcttcactgac 282

                  
Query: 404 aaggaca 410
           |||||||
Sbjct: 283 aaggaca 289



to top

>gb|AY436595.1| Anas platyrhynchos glyceraldehyde-3-phosphate dehydrogenase-like
           protein mRNA, complete cds
          Length = 738

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 362 ggtgctgattacgttgtggagtccaccggtgtcttcac 399
           |||||||| |||||||||||||||||||||||||||||
Sbjct: 167 ggtgctgaatacgttgtggagtccaccggtgtcttcac 204



to top

>gb|AC011810.8|AC011810 Arabidopsis thaliana chromosome I BAC T6J4 genomic sequence, complete
             sequence
          Length = 103157

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 329   aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
             |||||||||||||| ||||| || |||||||| || ||||| |  ||||| ||||| || 
Sbjct: 87880 aggaaccctgaggacatcccatggggtgaggctggagctgactttgttgttgagtctact 87821

                                   
Query: 389   ggtgtcttcactgacaaggaca 410
             ||||||||||||||||| ||||
Sbjct: 87820 ggtgtcttcactgacaaagaca 87799



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 155   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
             ||||| || ||||| ||||||||||| || ||||| || |||||||||||||||||||||
Sbjct: 88345 cagagggatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatg 88286



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                         
Query: 218   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
             |||||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || 
Sbjct: 88082 tacatgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaag 88023

                                                                   
Query: 278   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
             || ||||| || || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 88022 gatgacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcagg 87969



to top

>gb|AC027134.4|AC027134 Arabidopsis thaliana chromosome I BAC F13B4 genomic sequence, complete
             sequence
          Length = 102183

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 70/82 (85%)
 Strand = Plus / Minus

                                                                         
Query: 329   aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
             |||||||||||||| ||||| || |||||||| || ||||| |  ||||| ||||| || 
Sbjct: 40573 aggaaccctgaggacatcccatggggtgaggctggagctgactttgttgttgagtctact 40514

                                   
Query: 389   ggtgtcttcactgacaaggaca 410
             ||||||||||||||||| ||||
Sbjct: 40513 ggtgtcttcactgacaaagaca 40492



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 155   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
             ||||| || ||||| ||||||||||| || ||||| || |||||||||||||||||||||
Sbjct: 41038 cagagggatgatgttgagctcgtcgctgttaacgatcctttcatcaccaccgagtacatg 40979



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                         
Query: 218   tacatgttcaagtacgacacagttcacggccattggaagcacagtgacatcaagctcaaa 277
             |||||||| ||||| ||||  |||||||| || |||||||||  |||  | ||| | || 
Sbjct: 40775 tacatgtttaagtatgacagtgttcacggtcagtggaagcaccatgagcttaaggtgaag 40716

                                                                   
Query: 278   gacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtcagg 331
             || ||||| || || |||||||| ||||||||||| ||||| || ||| |||||
Sbjct: 40715 gatgacaaaactcttctcttcggtgagaagccagtcactgttttcggcatcagg 40662



to top

>ref|XM_501515.1| Yarrowia lipolytica CLIB122, YALI0C06369g predicted mRNA
          Length = 1017

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 344 atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
           ||||| || ||| |||||||||| || |||||||| |||||||||||||||||||| | |
Sbjct: 250 atcccctggggtaaggccggtgccgactacgttgtcgagtccaccggtgtcttcaccggc 309

                
Query: 404 aagga 408
           |||||
Sbjct: 310 aagga 314



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                       
Query: 167 gtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttc 226
           |||||| ||||||| || |||||||||||||||  ||||||||||    | |||||||||
Sbjct: 79  gtcgaggtcgtcgctgtgaacgaccccttcatcgacaccgagtacgctgcttacatgttc 138

                    
Query: 227 aagtacgac 235
           |||||||||
Sbjct: 139 aagtacgac 147



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                          
Query: 344    atcccgtgaggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcactgac 403
              ||||| || ||| |||||||||| || |||||||| |||||||||||||||||||| | |
Sbjct: 827162 atcccctggggtaaggccggtgccgactacgttgtcgagtccaccggtgtcttcaccggc 827221

                   
Query: 404    aagga 408
              |||||
Sbjct: 827222 aagga 827226



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                          
Query: 167    gtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttc 226
              |||||| ||||||| || |||||||||||||||  ||||||||||    | |||||||||
Sbjct: 826991 gtcgaggtcgtcgctgtgaacgaccccttcatcgacaccgagtacgctgcttacatgttc 827050

                       
Query: 227    aagtacgac 235
              |||||||||
Sbjct: 827051 aagtacgac 827059



to top

>gb|L07500.1|PEAGAPCI Pea glyceraldehyde-3-phosphate dehydrogenase (GapC1) mRNA, complete
           cds
          Length = 1177

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 164 gatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatg 223
           ||||| || ||||| || || ||||| || ||||||||||| || ||||||||||| |||
Sbjct: 132 gatgttgaactcgttgcagttaacgatcctttcatcaccactgattacatgacgtatatg 191

                                            
Query: 224 ttcaagtacgacacagttcacggccattggaag 256
           || ||||||||||  |||||||| || ||||||
Sbjct: 192 tttaagtacgacagtgttcacggacagtggaag 224



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 293 ctcttcggcgagaagccagttactgtctttggcgtcaggaaccctgaggagatccc 348
           ||||||||  |||||||||||||||||||||    ||||||||| || ||||||||
Sbjct: 261 ctcttcggtcagaagccagttactgtctttgcacacaggaacccagaagagatccc 316



 Score = 46.1 bits (23), Expect = 0.089
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 91  caagattaagaccggaatcaacggtttcggaaggatcgg 129
           |||||| |||| |||||||||||| |||||||| |||||
Sbjct: 59  caagatcaagatcggaatcaacggattcggaagaatcgg 97



to top

>emb|AJ938036.1| Lupinus albus mRNA for glyceraldehyde-3-phosphate-dehydrogenase
           (gapdh gene)
          Length = 1233

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 176 gtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgac 235
           ||||| || ||||| || |||||||| || || |||||||| ||||||||||||||||||
Sbjct: 5   gtcgctgttaacgatcctttcatcacaactgattacatgacctacatgttcaagtacgac 64

                               
Query: 236 acagttcacggccattggaa 255
           |  |||||||| || |||||
Sbjct: 65  agtgttcacggacactggaa 84



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 375 ttgtggagtccaccggtgtcttcactgacaaggaca 410
           |||| |||||||||||||| ||||| || |||||||
Sbjct: 204 ttgtcgagtccaccggtgttttcaccgataaggaca 239



to top

>dbj|AB164360.1| Periploca sepium PsGAPDH gene for D-glyceraldehyde-3-phosphate
           dehydrogenase, partial cds
          Length = 1225

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
           |||||||||||||||||||| || |||||||| || ||||| | |||||| ||||| || 
Sbjct: 196 aggaaccctgaggagatcccatggggtgaggctggagctgacttcgttgttgagtctact 255

                               
Query: 389 ggtgtcttcactgacaagga 408
           ||||| || ||||| |||||
Sbjct: 256 ggtgtttttactgataagga 275



to top

>ref|XR_003569.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC386426), mRNA
          Length = 1008

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 262 ggtgaggccggtgctgagtatgttgtggagtctactggtgtcttcac 308



to top

>gb|AY292378.1| Phytophthora palmivora glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) gene, partial cds
          Length = 955

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 174 tcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacg 233
           |||| |||||||||| ||| |||||| ||||| ||||||||   |||||| |||| ||||
Sbjct: 80  tcgtggccgtcaacggcccgttcatcgccaccaagtacatggaatacatgctcaaatacg 139

                          
Query: 234 acacagttcacggcc 248
           ||||||| |||||||
Sbjct: 140 acacagtgcacggcc 154



to top

>gb|AC161826.5| Mus musculus 6 BAC RP23-411G8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 183238

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 54712 ggtgaggccggtgctgagtatgttgtggagtctactggtgtcttcac 54758



to top

>gb|AY364464.1| Phaeosphaeria nodorum isolate S-82-13 glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



to top

>gb|AY364463.1| Phaeosphaeria avenaria f. sp. triticae isolate Sat24-1
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|AY364462.1| Phaeosphaeria nodorum isolate 9074 glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364461.1| Phaeosphaeria nodorum isolate S74-20A glyceraldehyde 3-phosphate
           dehydrogenase gene, complete cds
          Length = 1253

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364459.1| Phaeosphaeria avenaria f. sp. avenaria strain ATCC 12277
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|AY364458.1| Stagonospora sp. Sn48-1 glyceraldehyde 3-phosphate dehydrogenase
           gene, complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 468 tacgtcgttgagtccaccggtgtcttcac 496



to top

>gb|AY364456.1| Phaeosphaeria avenaria f. sp. triticae isolate S81-W10
           glyceraldehyde 3-phosphate dehydrogenase gene, complete
           cds
          Length = 1251

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 185 acgacgtcgagatcgtcgccgtcaacgaccccttcatc 222



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 467 tacgtcgttgagtccaccggtgtcttcac 495



to top

>gb|AY345228.1| Panax ginseng glyceraldehyde-3-phosphate dehydrogenase mRNA,
           complete cds
          Length = 1182

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 159/202 (78%)
 Strand = Plus / Plus

                                                                       
Query: 209 tacatgacgtacatgttcaagtacgacacagttcacggccattggaagcacagtgacatc 268
           |||||||| || ||||||||||| ||||| ||||| || || ||||||||   |||  | 
Sbjct: 9   tacatgacatatatgttcaagtatgacactgttcatggacaatggaagcatcatgagctt 68

                                                                       
Query: 269 aagctcaaagacgacaagacgctgctcttcggcgagaagccagttactgtctttggcgtc 328
           ||| | || ||| | || || || ||||| || |||||||||||||  || |||||  ||
Sbjct: 69  aaggttaaggacaataacacccttctctttggtgagaagccagttaaggtttttggaatc 128

                                                                       
Query: 329 aggaaccctgaggagatcccgtgaggtgaggccggtgctgattacgttgtggagtccacc 388
            | |||||||| |||||||| || ||||| || || ||||| |  || |||||||| || 
Sbjct: 129 ggaaaccctgaagagatcccatggggtgaagctggagctgactttgtggtggagtctact 188

                                 
Query: 389 ggtgtcttcactgacaaggaca 410
           || |||||||||||||||||||
Sbjct: 189 ggagtcttcactgacaaggaca 210



to top

>emb|X72381.1|PPGAPC1 P.patens gapC1 mRNA
          Length = 1343

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 365 gctgattacgttgtggagtccaccggtgtcttcactgacaaggaca 410
           ||||||| ||||||||||||||| || |||||||| ||||||||||
Sbjct: 342 gctgatttcgttgtggagtccactggcgtcttcaccgacaaggaca 387



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 183 tcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacgaca 236
           |||||||||| || || ||  |||| |||||||| |||||||||||||| ||||
Sbjct: 160 tcaacgacccttttattactcccgaatacatgacttacatgttcaagtatgaca 213



to top

>gb|DQ383974.1| Ascochyta sp. Georgia16 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383972.1| Ascochyta sp. Georgia3 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383971.1| Ascochyta sp. Georgia2 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383970.1| Ascochyta fabae f. sp. viciae strain AV11
           glyceraldehyde-3-phosphate dehydrogenase (G3PD) gene,
           partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383969.1| Ascochyta sp. AV8 glyceraldehyde-3-phosphate dehydrogenase (G3PD)
           gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383968.1| Ascochyta sp. AV1 glyceraldehyde-3-phosphate dehydrogenase (G3PD)
           gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383967.1| Ascochyta sp. Georgia12 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383966.1| Ascochyta sp. Georgia6 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383965.1| Ascochyta pisi strain AP5 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383964.1| Ascochyta pisi strain AP4 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383963.1| Ascochyta pisi strain AP1 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383962.1| Didymella lentis strain AL11 glyceraldehyde-3-phosphate
           dehydrogenase (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383961.1| Didymella lentis strain AL1 glyceraldehyde-3-phosphate
           dehydrogenase (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383960.1| Didymella fabae strain AF8 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>gb|DQ383959.1| Didymella fabae strain AF1 glyceraldehyde-3-phosphate dehydrogenase
           (G3PD) gene, partial cds
          Length = 519

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| |||||| ||||||||||||||||||||||||||
Sbjct: 86  acgacgtcgagatcgtcgccgtcaacgaccccttcatc 123



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           ||||| || ||||||||||||||||||||
Sbjct: 378 tacgtcgtcgagtccaccggtgtcttcac 406



to top

>dbj|AK103261.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033124D08, full
           insert sequence
          Length = 2161

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 155 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||| || ||||||||| | |||||| |||||||| ||||||||||| | |||||||||
Sbjct: 609 cagagtgaggatgtcgagttggtcgccatcaacgactccttcatcaccgctgagtacatg 668

             
Query: 215 ac 216
           ||
Sbjct: 669 ac 670



to top

>dbj|AK069457.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019M11, full
           insert sequence
          Length = 1508

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 155 cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||| || ||||||||| | |||||| |||||||| ||||||||||| | |||||||||
Sbjct: 610 cagagtgaggatgtcgagttggtcgccatcaacgactccttcatcaccgctgagtacatg 669

             
Query: 215 ac 216
           ||
Sbjct: 670 ac 671



to top

>gb|AY066007.1| Meriones unguiculatus glyceraldehyde-3-phosphate dehydrogenase
           mRNA, complete cds
          Length = 1265

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 359 gccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           |||||||| || || ||||||||||||||||||||||||||
Sbjct: 333 gccggtgccgagtatgttgtggagtccaccggtgtcttcac 373



to top

>gb|M81724.1|SCOGLYC Schizophyllum commune glyceraldehyde-3-phosphate dehydrogenase
           (GPD) gene, complete cds
          Length = 1014

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 168 tcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttca 227
           ||||| |||||||| |||||||||| |||||| ||   || ||||||   ||||||||||
Sbjct: 80  tcgaggtcgtcgccatcaacgacccgttcatcgcccttgactacatggtctacatgttca 139

                                
Query: 228 agtacgacacagttcacggcc 248
           |||||||||| || |||||||
Sbjct: 140 agtacgacaccgtccacggcc 160



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 380 gagtccaccggtgtcttcac 399
           ||||||||||||||||||||
Sbjct: 286 gagtccaccggtgtcttcac 305



to top

>gb|M81754.1|PHAGLYC Phanerochaete chrysosporium glyceraldehyde-3-phosphate
           dehydrogenase (GPD) gene, complete cds
          Length = 1014

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 174 tcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacg 233
           ||||||| |||||||||||||||||   |  ||||||||||   ||||||||||||||||
Sbjct: 86  tcgtcgcggtcaacgaccccttcattgacctcgagtacatggtctacatgttcaagtacg 145

                        
Query: 234 acacagttcacgg 246
           || | ||||||||
Sbjct: 146 actccgttcacgg 158



to top

>dbj|AB070217.1| Meriones unguiculatus GAPD mRNA for Glyceraldehyde-3-phosphate
           dehydrogenase, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 359 gccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           |||||||| || || ||||||||||||||||||||||||||
Sbjct: 333 gccggtgccgagtatgttgtggagtccaccggtgtcttcac 373



to top

>gb|AF081393.1|AF081393 Curvularia gudauskasii DAOM 165085 glyceraldehyde-3-phosphate
           dehydrogenase (gpd) gene, partial cds
          Length = 504

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 162 acgatgtcgagctcgtcgccgtcaacgaccccttcat 198
           ||||||||||| | |||||||||||||||||||||||
Sbjct: 87  acgatgtcgagattgtcgccgtcaacgaccccttcat 123



to top

>dbj|AB040445.1| Meriones unguiculatus GAPDH mRNA for glyceraldehyde-3-phosphate
           dehydrogenase, partial cds
          Length = 414

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 359 gccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           |||||||| || || ||||||||||||||||||||||||||
Sbjct: 205 gccggtgccgagtatgttgtggagtccaccggtgtcttcac 245



to top

>dbj|D14518.1|TRRGLYDE1 Trichoderma koningii mRNA for glyceraldehydephosphate
           dehydrogenase, complete cds, clone:pT49
          Length = 1159

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 163 cgatgtcgagctcgtcgccgtcaacgaccccttcatc 199
           |||| ||||| ||||||||||||||||||||||||||
Sbjct: 132 cgatatcgaggtcgtcgccgtcaacgaccccttcatc 168



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 371 tacgttgtggagtccaccggtgtcttcac 399
           |||||||| ||||||||||||||||||||
Sbjct: 334 tacgttgtcgagtccaccggtgtcttcac 362



to top

>ref|XM_676218.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8041.2), mRNA
          Length = 720

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 361 cggtgctgattacgttgtggagtccaccggtgtcttcact 400
           ||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 267 cggtgctgaatacattgtcgagtccaccggtgtcttcact 306



to top

>emb|X59517.1|AMGADPH A.majus GADPH mRNA for glycolytic glyceraldehyde-3-phosphate
           dehydrogenase
          Length = 1301

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 375 ttgtggagtccaccggtgtcttcactgacaaggaca 410
           ||||||||||||| ||||| ||||||||||||||||
Sbjct: 341 ttgtggagtccactggtgtgttcactgacaaggaca 376



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 118/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 98  aagaccggaatcaacggtttcggaaggatcgggaggctcgtcgccagggtcgcactccag 157
           |||| |||||||||||||||||||||||| ||  |  | || || || || || || |||
Sbjct: 64  aagatcggaatcaacggtttcggaaggattggtcgattagttgctagagttgctctgcag 123

                                                                       
Query: 158 agcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacg 217
           || || ||||| ||||| || || || ||||| || || ||| | || || |||||||| 
Sbjct: 124 agagatgatgttgagcttgttgctgttaacgatccatttatctcaactgattacatgaca 183

                                        
Query: 218 tacatgttcaagtacgacacagttcacgg 246
           |||||||||||||| ||||  ||||||||
Sbjct: 184 tacatgttcaagtatgacagtgttcacgg 212



to top

>emb|AL607000.3|OSJN00132 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0089B03,
             complete sequence
          Length = 130910

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 155   cagagcgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
             ||||| || ||||||||| | |||||| |||||||| ||||||||||| | |||||||||
Sbjct: 73603 cagagtgaggatgtcgagttggtcgccatcaacgactccttcatcaccgctgagtacatg 73544



to top

>dbj|AB237762.1| Microdochium nivale GPD gene for glyceraldehyde 3-phosphate
           dehydrogenase, complete cds
          Length = 1906

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 168 tcgagctcgtcgccgtcaacgaccccttcatc 199
           ||||| ||||||||||||||||||||||||||
Sbjct: 760 tcgagatcgtcgccgtcaacgaccccttcatc 791



to top

>gb|AY654895.1| Spermophilus citellus glyceraldehyde-3-phosphate dehydrogenase
           (GAPDH) mRNA, complete cds
          Length = 1123

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 400
           ||||| || |||||||| || |||||||||||||| ||||||||||||
Sbjct: 264 ggtgatgctggtgctgaatatgttgtggagtccactggtgtcttcact 311



to top

>gb|AF232729.2|AF232729 Marmota monax glyceraldehyde 3-phosphate dehydrogenase GAPDH mRNA,
           partial cds
          Length = 535

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcact 400
           ||||| || |||||||| || |||||||||||||| ||||||||||||
Sbjct: 24  ggtgatgctggtgctgaatatgttgtggagtccactggtgtcttcact 71



to top

>gb|AY562407.1| Alternaria tagetica strain BMP 0179 glyceraldehyde 3-phosphate
           dehydrogenase (gpd) gene, partial cds
          Length = 577

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 360 ccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           |||||||| ||||||| || ||||||||||||||||||||
Sbjct: 394 ccggtgcttattacgtcgttgagtccaccggtgtcttcac 433



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 176 gtcgccgtcaacgaccccttcatc 199
           |||||||| |||||||||||||||
Sbjct: 103 gtcgccgtaaacgaccccttcatc 126



to top

>gb|M33539.1|EMEGPDAA A.nidulans glyceraldehyde-3-phosphate dehydrogenase (gpdA) mRNA,
            exons 1-7
          Length = 3193

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                    
Query: 361  cggtgctgattacgttgtggagtccaccggtgtcttcact 400
            ||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 1873 cggtgctgaatacattgtcgagtccaccggtgtcttcact 1912



to top

>gb|M19694.1|EMEGPDA A.nidulans gpdA gene encoding glyceraldehyde-3-phosphate
            dehydrogenase, complete cds
          Length = 2758

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                    
Query: 361  cggtgctgattacgttgtggagtccaccggtgtcttcact 400
            ||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 1438 cggtgctgaatacattgtcgagtccaccggtgtcttcact 1477



to top

>gb|AC116758.11| Mus musculus chromosome 8, clone RP23-383A10, complete sequence
          Length = 190294

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 120868 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 120822



to top

>gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, complete sequence
          Length = 169136

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 152426 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 152380



to top

>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence
          Length = 192819

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 69808 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 69762



to top

>ref|XM_529173.1| PREDICTED: Pan troglodytes similar to Glyceraldehyde-3-phosphate
           dehydrogenase, liver (GAPDH) (LOC473800), mRNA
          Length = 957

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 367 tgattacgttgtggagtccaccggtgtcttcactg 401
           |||||| |||||||||||||| |||||||||||||
Sbjct: 291 tgattatgttgtggagtccactggtgtcttcactg 325



to top

>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence
          Length = 181038

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 136525 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 136479



to top

>gb|BC085275.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:103193 IMAGE:30444086), complete
           cds
          Length = 1264

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 323 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 369



to top

>gb|BC085274.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:103192 IMAGE:6530979), complete cds
          Length = 1257

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 314 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 360



to top

>gb|BC085315.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102545 IMAGE:30440429), complete
           cds
          Length = 1249

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 308 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 354



to top

>gb|BC083080.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:103191 IMAGE:6494145), complete cds
          Length = 1252

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 313 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 359



to top

>gb|BC083149.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:102546 IMAGE:30459585), complete cds
          Length = 1271

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 292 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 338



to top

>gb|BC083079.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:102544 IMAGE:6493407), complete cds
          Length = 1249

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 311 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 357



to top

>gb|BC083065.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:103190 IMAGE:5371133), complete cds
          Length = 1292

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 305 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 351



to top

>gb|AF297874.1| Coriolopsis gallica glyceraldehyde-3-phosphate dehydrogenase (gpd1)
           mRNA, partial cds
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 63/75 (84%)
 Strand = Plus / Plus

                                                                       
Query: 174 tcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaagtacg 233
           |||||||||| |||||||||||||| |||   || ||||||   ||||||||||||||||
Sbjct: 67  tcgtcgccgtgaacgaccccttcattacccttgactacatggtctacatgttcaagtacg 126

                          
Query: 234 acacagttcacggcc 248
           || | || |||||||
Sbjct: 127 actccgtccacggcc 141



to top

>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence
          Length = 212447

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                         
Query: 357    aggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||| || ||||||||||| || |||||||||||
Sbjct: 139893 aggccggtgctgagtatgttgtggagtctactggtgtcttcac 139851



to top

>gb|AC163335.6| Mus musculus chromosome 7, clone RP24-149G13, complete sequence
          Length = 164660

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 39699 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 39653



to top

>gb|BC082592.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:105239 IMAGE:30634381), complete
           cds
          Length = 1254

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 306 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 352



to top

>gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, complete sequence
          Length = 166532

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 135543 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 135589



to top

>gb|AY551074.1| Drosophila buzzatii glyceraldehyde-3-phosphate dehydrogenase
           (Gapdh) gene, partial cds
          Length = 1017

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 365 gctgattacgttgtggagtccaccggtgtcttcac 399
           ||||| |||||||| ||||||||||||||||||||
Sbjct: 321 gctgagtacgttgttgagtccaccggtgtcttcac 355



to top

>ref|NG_005470.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC654475) on chromosome 4
          Length = 1433

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 406 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 452



to top

>ref|NG_005467.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC433845) on chromosome 5
          Length = 1406

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 384 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 430



to top

>ref|NG_005469.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC654474) on chromosome X
          Length = 1434

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 406 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 452



to top

>ref|NG_005233.2| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene
           (LOC433921) on chromosome 5
          Length = 1441

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 417 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 463



to top

>gb|AC124377.4| Mus musculus BAC clone RP24-396N12 from chromosome 5, complete sequence
          Length = 170401

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 101849 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 101895



to top

>ref|NM_008084.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase
           (LOC14433), mRNA
          Length = 1228

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 302 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 348



to top

>gb|AC124113.9| Mus musculus chromosome 5, clone RP24-354P12, complete sequence
          Length = 156826

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 102279 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 102325



to top

>gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216676

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 201189 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 201143



to top

>gb|AC164428.4| Mus musculus BAC clone RP24-150D18 from chromosome 1, complete sequence
          Length = 170692

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 158280 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 158234



to top

>gb|AC121279.7| Mus musculus chromosome 3, clone RP23-4F17, complete sequence
          Length = 207763

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 131120 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 131166



to top

>ref|XR_003802.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC672308), mRNA
          Length = 1079

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 262 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>ref|XM_484732.3| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC433184), mRNA
          Length = 1008

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 262 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>ref|XM_973383.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC630967), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XM_982955.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC670723), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_003790.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC672277), mRNA
          Length = 1396

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 246 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XM_484436.4| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC432919), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XM_904634.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC630967), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_004746.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC675187), mRNA
          Length = 1396

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 246 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XR_002153.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC668177), mRNA
          Length = 1396

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 246 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 292



to top

>ref|XM_987944.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC667048), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_003390.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
            dehydrogenase (GAPDH) (LOC671350), mRNA
          Length = 1926

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 353  ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
            ||||||| ||||||||| || ||||||||||| || |||||||||||
Sbjct: 1180 ggtgaggtcggtgctgagtatgttgtggagtctactggtgtcttcac 1226



to top

>ref|XR_001931.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
            dehydrogenase (GAPDH) (LOC666859), mRNA
          Length = 2628

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 353  ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
            ||||||| ||||||||| || ||||||||||| || |||||||||||
Sbjct: 1882 ggtgaggtcggtgctgagtatgttgtggagtctactggtgtcttcac 1928



to top

>gb|AC102352.9| Mus musculus chromosome 14, clone RP23-30H7, complete sequence
          Length = 248441

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 124476 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 124522



to top

>ref|XM_620532.3| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC545984), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>ref|XR_002367.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC669004), mRNA
          Length = 1007

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||| ||||||| || ||||||||||| || |||||||||||
Sbjct: 262 ggtgaggcccgtgctgagtatgttgtggagtctactggtgtcttcac 308



to top

>gb|L26924.1|GBIGLYADEH Ginkgo biloba glyceraldehyde-phosphate dehydrogenase mRNA, complete
           cds
          Length = 1192

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 170 gagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatgttcaag 229
           |||||||| ||||| ||||| ||||||||| | || || |||||||| || |||||||||
Sbjct: 117 gagctcgttgccgttaacgatcccttcatctctacggattacatgacctatatgttcaag 176

                  
Query: 230 tacgaca 236
           || ||||
Sbjct: 177 tatgaca 183



to top

>ref|XM_906931.2| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC632720), mRNA
          Length = 1002

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 256 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 302



to top

>gb|AC147142.2| Mus musculus BAC clone RP24-391G7 from chromosome Y, complete sequence
          Length = 162132

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 42352 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 42398



to top

>ref|XR_003202.1| PREDICTED: Mus musculus similar to Glyceraldehyde-3-phosphate
           dehydrogenase (GAPDH) (LOC546736), mRNA
          Length = 996

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 262 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 308



to top

>gb|AC146611.2| Mus musculus BAC clone RP23-57A17 from chromosome 5, complete sequence
          Length = 194487

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 175520 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 175474



to top

>gb|AY363102.1|AY363102S1 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 1
             and 2
          Length = 309506

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 24209 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 24255



to top

>gb|AC115124.6| Mus musculus BAC clone RP24-349M22 from chromosome 18, complete
             sequence
          Length = 137371

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 45024 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 44978



to top

>gb|AC130841.4| Mus musculus BAC clone RP24-445L16 from chromosome 8, complete sequence
          Length = 174384

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 20629 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 20583



to top

>gb|AC132391.3| Mus musculus BAC clone RP23-454N21 from chromosome 12, complete sequence
          Length = 178291

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 122316 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 122362



to top

>gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome 13, complete sequence
          Length = 205173

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 157139 ggtgaggccggtgctgagtatgtggtggagtctactggtgtcttcac 157185



to top

>gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosome 3, complete sequence
          Length = 187416

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 140887 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 140933



to top

>gb|AC122039.4| Mus musculus BAC clone RP24-432H3 from chromosome 6, complete sequence
          Length = 169274

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 21873 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 21919



to top

>gb|AC125177.4| Mus musculus BAC clone RP23-315H8 from chromosome 8, complete sequence
          Length = 217567

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 214259 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 214305



to top

>gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complete sequence
          Length = 216860

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 195926 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 195880



to top

>gb|AC114004.5| Mus musculus BAC clone RP23-174P2 from 7, complete sequence
          Length = 187196

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 17158 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 17204



to top

>gb|AC118474.10| Mus musculus chromosome 8, clone RP23-288O12, complete sequence
          Length = 191490

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 99940 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 99894



to top

>gb|AC102494.6| Mus musculus chromosome 7, clone RP24-565J5, complete sequence
          Length = 161721

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 75842 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 75888



to top

>gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosome 6, complete sequence
          Length = 208350

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 106874 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 106828



to top

>emb|AL732579.5| Human DNA sequence from clone RP11-274K13 on chromosome X Contains the
              5'end of a novel gene (LOC93380), a novel gene, the SLC9A6
              gene for solute carrier family 9 (sodium/hydrogen
              exchanger, isoform 6), a glyceraldehyde-3-phosphate
              dehydrogenase (GAPD) pseudogene (LOC139543), an E2F
              transcription factor 6 (E2F6) pseudogene (LOC139542) and
              two CpG islands, complete sequence
          Length = 151432

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                                 
Query: 367    tgattacgttgtggagtccaccggtgtcttcactg 401
              |||||| |||||||||||||| |||||||||||||
Sbjct: 115071 tgattatgttgtggagtccactggtgtcttcactg 115105



to top

>gb|BC098095.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase pseudogene,
           mRNA (cDNA clone MGC:106682 IMAGE:30551357), complete
           cds
          Length = 1742

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 675 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 721



to top

>gb|AC160632.5| Mus musculus chromosome 8, clone RP24-319F9, complete sequence
          Length = 163311

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 39828 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 39874



to top

>ref|XM_969088.1| PREDICTED: Tribolium castaneum similar to
           Glyceraldehyde-3-phosphate dehydrogenase II (GAPDH II)
           (LOC663023), mRNA
          Length = 1291

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 365 gctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||| || ||||||||||||||||||||
Sbjct: 304 gctgattacgtggtcgagtccaccggtgtcttcac 338



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 179 gccgtcaacgaccccttcatc 199
           |||||||||||||||||||||
Sbjct: 124 gccgtcaacgaccccttcatc 144



to top

>gb|AC163619.2| Mus musculus BAC clone RP24-164P4 from chromosome 9, complete sequence
          Length = 161793

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 353    ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
              ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 125198 ggtgaggccggtgctgagtatgtagtggagtctactggtgtcttcac 125152



to top

>emb|AJ512345.1|ODA512345 Ochromonas danica partial gapC gene for cytosolic
           glyceraldehyde-3-phosphate dehydrogenase, exons 1 and 2
          Length = 1016

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 54/63 (85%)
 Strand = Plus / Plus

                                                                       
Query: 164 gatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtacatgacgtacatg 223
           |||||| || |||||||| ||||||||||||||||| ||   || ||||||| |||||||
Sbjct: 55  gatgtccaggtcgtcgccatcaacgaccccttcatccccgtagattacatgaagtacatg 114

              
Query: 224 ttc 226
           |||
Sbjct: 115 ttc 117



to top

>emb|AL607064.16| Mouse DNA sequence from clone RP23-314K19 on chromosome 11 Contains a
             glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, complete sequence
          Length = 57166

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 30016 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 29970



to top

>emb|AL935328.14| Mouse DNA sequence from clone RP23-227C11 on chromosome 11 Contains a
             peptidylprolyl isomerase A (Ppia) pseudogene, a
             glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, a ribosomal protein L17 (Rpl17) pseudogene and
             an uridine monophosphate synthetase (Umps) pseudogene,
             complete sequence
          Length = 182970

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 94337 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 94383



to top

>emb|AL662926.19| Mouse DNA sequence from clone RP23-403O15 on chromosome 11 Contains the
             5' end of the Rab1 gene for RAB1, member RAS oncogene
             family, a ribosomal protein L12 (Rpl12), the Slc1a4 gene
             for solute carrier family 1 (glutamate/neutral amino acid
             transporter) member 4, the gene for a novel protein
             similar to glyceraldehyde-3-phosphate dehydrogenase Gapd
             and two Cpg islands, complete sequence
          Length = 125596

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 87420 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 87374



to top

>emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chromosome 11 Contains the
             5' end of the Tcn2 gene for transcobalamin 2, two novel
             genes, a glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, the Pes1 gene for BRCT domain containing
             pescadillo homolog 1 (zebrafish), the Gcst gene for
             galactosylceramide sulfotransferase, a
             ubiquitin-conjugating enzyme E2L 3 (Ube2l3) pseuogene, the
             Sec14l4 and Sec14l2 genes for SEC14-like 4 (S. cerevisiae)
             and 2, the ortholog of human and rat SEC14-like 3 (S.
             cerevisiae) SEC14L3, a ribosomal protein L29 (Rpl29)
             pseudogene, a transformer 2 alpha homolog (Drosophila)
             (Tra2a) pseudogene and a CpG island, complete sequence
          Length = 201238

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 22992 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 23038



to top

>gb|BC095932.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase, mRNA (cDNA
           clone MGC:106377 IMAGE:30733532), complete cds
          Length = 1258

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 317 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 363



to top

>gb|AC158345.8| Mus musculus chromosome 7, clone RP23-271M19, complete sequence
          Length = 188354

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 353   ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
             ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 38722 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 38768



to top

>gb|BC092252.1| Mus musculus similar to glyceraldehyde-3-phosphate dehydrogenase,
           mRNA (cDNA clone MGC:102542 IMAGE:5044783), complete cds
          Length = 1255

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 315 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 361



to top

>dbj|AB194120.1| Zelkova serrata DNA, satellite marker: bczs336b
          Length = 634

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 81/99 (81%)
 Strand = Plus / Minus

                                                                       
Query: 116 ttcggaaggatcgggaggctcgtcgccagggtcgcactccagagcgacgatgtcgagctc 175
           |||||||||||||| ||| | ||||| || || ||  | ||||| |||||||| || |||
Sbjct: 205 ttcggaaggatcggtaggttggtcgctagagttgctttgcagagggacgatgttgaactc 146

                                                  
Query: 176 gtcgccgtcaacgaccccttcatcaccaccgagtacatg 214
           ||||| || ||||| ||||||||||| || || ||||||
Sbjct: 145 gtcgctgttaacgatcccttcatcacaactgattacatg 107



to top

>dbj|AK140794.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130021D09
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 329 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK146435.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730090K19
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 329 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>ref|NM_001001303.1| Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh), mRNA
          Length = 1243

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 314 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 360



to top

>dbj|AK147969.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270120O18 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 2176

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 325 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 371



to top

>dbj|AK147891.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270083H09 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 1196

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 329 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK160399.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500001O05
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1253

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 329 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK147738.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270015C01 product:glyceraldehyde-3-phosphate
           dehydrogenase, full insert sequence
          Length = 1221

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 329 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 375



to top

>dbj|AK164415.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length
           enriched library, clone:D230015A01
           product:glyceraldehyde-3-phosphate dehydrogenase, full
           insert sequence
          Length = 1206

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 353 ggtgaggccggtgctgattacgttgtggagtccaccggtgtcttcac 399
           ||||||||||||||||| || || |||||||| || |||||||||||
Sbjct: 327 ggtgaggccggtgctgagtatgtcgtggagtctactggtgtcttcac 373


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,334,623
Number of Sequences: 3902068
Number of extensions: 2334623
Number of successful extensions: 47106
Number of sequences better than 10.0: 1134
Number of HSP's better than 10.0 without gapping: 1132
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 44688
Number of HSP's gapped (non-prelim): 2404
length of query: 410
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 388
effective length of database: 17,147,199,772
effective search space: 6653113511536
effective search space used: 6653113511536
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top