ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet32f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 44 0.38
2dbj|D87924.1| Actinomadura hibisca polyketide synthase genes for... 42 1.5
3gb|AY554266.1| Populus tremula var. glandulosa 26S ribosomal RNA... 40 6.0
4gb|AY554270.1| Populus tremula var. davidiana 26S ribosomal RNA ... 40 6.0
5gb|AY554269.1| Populus tomentosa 26S ribosomal RNA gene, partial... 40 6.0
6gb|AY554268.1| Populus alba x Populus tremula var. glandulosa 26... 40 6.0
7gb|AY554267.1| Populus alba 26S ribosomal RNA gene, partial sequ... 40 6.0
8gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 40 6.0
9gb|AF492457.1| Azospirillum brasilense D-alanine:D-alanine ligas... 40 6.0
10dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 6.0
11gb|AC154317.2| Mus musculus BAC clone RP23-346H4 from chromosome... 40 6.0
12emb|BX511097.21| Zebrafish DNA sequence from clone DKEYP-93C5 in... 40 6.0

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 375     ggccgcacaccagtaaacagat 396
               ||||||||||||||||||||||
Sbjct: 2388757 ggccgcacaccagtaaacagat 2388778



to top

>dbj|D87924.1| Actinomadura hibisca polyketide synthase genes for pradimicin,
            complete cds
          Length = 8168

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 212  ggcggcagcgcaccgtcgccg 232
            |||||||||||||||||||||
Sbjct: 4707 ggcggcagcgcaccgtcgccg 4727



to top

>gb|AY554266.1| Populus tremula var. glandulosa 26S ribosomal RNA gene, partial
           sequence; 26S-18S intergenic spacer, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 2909

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  cgcttcccgatcccatcccatccc 82
           |||| |||||||||||||||||||
Sbjct: 138 cgctgcccgatcccatcccatccc 115



to top

>gb|AY554270.1| Populus tremula var. davidiana 26S ribosomal RNA gene, partial
           sequence; 26S-18S intergenic spacer, complete sequence;
           and 18S ribosomal RNA gene, partial sequence
          Length = 2909

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  cgcttcccgatcccatcccatccc 82
           |||| |||||||||||||||||||
Sbjct: 138 cgctgcccgatcccatcccatccc 115



to top

>gb|AY554269.1| Populus tomentosa 26S ribosomal RNA gene, partial sequence; 26S-18S
           intergenic spacer, complete sequence; and 18S ribosomal
           RNA gene, partial sequence
          Length = 2909

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  cgcttcccgatcccatcccatccc 82
           |||| |||||||||||||||||||
Sbjct: 138 cgctgcccgatcccatcccatccc 115



to top

>gb|AY554268.1| Populus alba x Populus tremula var. glandulosa 26S ribosomal RNA
           gene, partial sequence; 26S-18S intergenic spacer,
           complete sequence; and 18S ribosomal RNA gene, partial
           sequence
          Length = 2909

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  cgcttcccgatcccatcccatccc 82
           |||| |||||||||||||||||||
Sbjct: 138 cgctgcccgatcccatcccatccc 115



to top

>gb|AY554267.1| Populus alba 26S ribosomal RNA gene, partial sequence; 26S-18S
           intergenic spacer, complete sequence; and 18S ribosomal
           RNA gene, partial sequence
          Length = 2911

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 59  cgcttcccgatcccatcccatccc 82
           |||| |||||||||||||||||||
Sbjct: 138 cgctgcccgatcccatcccatccc 115



to top

>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 372     gatggccgcacaccagtaaa 391
               ||||||||||||||||||||
Sbjct: 1116058 gatggccgcacaccagtaaa 1116077



to top

>gb|AF492457.1| Azospirillum brasilense D-alanine:D-alanine ligase (ddlB), partial
            cds; and cell division fts gene cluster, partial sequence
          Length = 3824

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 184  cgcggcggacgtcgctctcc 203
            ||||||||||||||||||||
Sbjct: 2013 cgcggcggacgtcgctctcc 1994



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 179     ctcgacgcggcggacgtcgc 198
               ||||||||||||||||||||
Sbjct: 6076816 ctcgacgcggcggacgtcgc 6076797



to top

>gb|AC154317.2| Mus musculus BAC clone RP23-346H4 from chromosome 13, complete sequence
          Length = 205164

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   aagtccactgagaaagatga 315
             ||||||||||||||||||||
Sbjct: 88903 aagtccactgagaaagatga 88922



to top

>emb|BX511097.21| Zebrafish DNA sequence from clone DKEYP-93C5 in linkage group 2,
             complete sequence
          Length = 134883

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 139   ccccaggagggccagggagcaatcctcc 166
             |||| ||||| |||||||||||||||||
Sbjct: 95616 cccctggaggaccagggagcaatcctcc 95643


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,989,800
Number of Sequences: 3902068
Number of extensions: 2989800
Number of successful extensions: 65383
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65214
Number of HSP's gapped (non-prelim): 169
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top