| Clone Name | baet22f03 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY205563.1| Chlamydomonas reinhardtii genomic sequence Length = 7479 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Plus Query: 227 tgcggcggcggcggcagcagcagcc 251 ||||||||||||||||||||||||| Sbjct: 1165 tgcggcggcggcggcagcagcagcc 1189 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagc 247 |||||||||||||||||||| Sbjct: 3374 gcggcggcggcggcagcagc 3355
>dbj|AP000721.5| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-91L24, complete sequence Length = 124636 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Plus Query: 169 ctagccagccatgatggcatgtgcc 193 ||||||||||||||||||||||||| Sbjct: 9680 ctagccagccatgatggcatgtgcc 9704
>ref|NM_196459.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0015J03.15), mRNA Length = 663 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 596 gcggcggcggcggcagcagcagcc 619
>ref|NM_196635.1| Oryza sativa (japonica cultivar-group) hypothetical protein (OSJNBa0019M20.7), mRNA Length = 813 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 630 gcggcggcggcggcagcagcagcc 607
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 227 tgcggcggcggcggcagcagcagc 250 |||||||||||||||||||||||| Sbjct: 445275 tgcggcggcggcggcagcagcagc 445298
>ref|XM_590712.2| PREDICTED: Bos taurus similar to BTB (POZ) domain containing 11 isoform 3, transcript variant 1 (LOC539986), mRNA Length = 4269 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 227 tgcggcggcggcggcagcagcagc 250 |||||||||||||||||||||||| Sbjct: 981 tgcggcggcggcggcagcagcagc 958
>ref|XM_425050.1| PREDICTED: Gallus gallus similar to hyperpolarization-activated, cyclic nucleotide-gated K+ 4; hyperpolarization-activated, cyclic nucleotide-gated potassium channel 4 (HCN4); hyperpolarization-activated cyclic nucleotide-gated potassium channel 4 (HCN4) (LOC427478), mRNA Length = 6312 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 4820 gcggcggcggcggcagcagcagcc 4797
>ref|XM_324048.1| Neurospora crassa OR74A predicted protein (NCU04692.1) partial mRNA Length = 5781 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 229 cggcggcggcggcagcagcagcca 252 |||||||||||||||||||||||| Sbjct: 3882 cggcggcggcggcagcagcagcca 3905
>ref|XM_322144.1| Neurospora crassa OR74A hypothetical protein (NCU00059.1) partial mRNA Length = 2490 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 2075 gcggcggcggcggcagcagcagcc 2052
>ref|XM_950709.1| Neurospora crassa OR74A hypothetical protein (NCU00059.1) partial mRNA Length = 2490 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 2075 gcggcggcggcggcagcagcagcc 2052
>ref|XM_955037.1| Neurospora crassa OR74A hypothetical protein (NCU04692.1) partial mRNA Length = 5781 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 229 cggcggcggcggcagcagcagcca 252 |||||||||||||||||||||||| Sbjct: 3882 cggcggcggcggcagcagcagcca 3905
>gb|AY554034.1| Oryza sativa (indica cultivar-group) clone OG05G01 Hox12 (hox12) mRNA, partial cds Length = 1002 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 474 gcggcggcggcggcagcagcagcc 497
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 5149498 gcggcggcggcggcagcagcagcc 5149475 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 36086506 gcggcggcggcggcagcagcagc 36086528 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcag 249 |||||||||||||||||||||| Sbjct: 8716192 gcggcggcggcggcagcagcag 8716171 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 217 cctcgcgcggtgcggcggcggcggc 241 |||||||||| |||||||||||||| Sbjct: 34107462 cctcgcgcggagcggcggcggcggc 34107438 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagca 248 ||||||||||||||||||||| Sbjct: 17098188 gcggcggcggcggcagcagca 17098168 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagca 248 ||||||||||||||||||||| Sbjct: 9571364 gcggcggcggcggcagcagca 9571384 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 226 gtgcggcggcggcggcagcagcagc 250 |||| |||||||||||||||||||| Sbjct: 7438257 gtgcagcggcggcggcagcagcagc 7438233 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgcgcggtgcggcggcggcg 239 |||||||||||||||||||| Sbjct: 25150692 cgcgcggtgcggcggcggcg 25150711 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagc 247 |||||||||||||||||||| Sbjct: 14390670 gcggcggcggcggcagcagc 14390689 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gcggcggcggcagcagcagc 250 |||||||||||||||||||| Sbjct: 6404351 gcggcggcggcagcagcagc 6404370
>ref|XM_754334.1| Ustilago maydis 521 hypothetical protein (UM03280.1) partial mRNA Length = 2196 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 227 tgcggcggcggcggcagcagcagc 250 |||||||||||||||||||||||| Sbjct: 135 tgcggcggcggcggcagcagcagc 112
>emb|AL691514.5| Human DNA sequence from clone RP11-105M16 on chromosome 10, complete sequence Length = 154348 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 170 tagccagccatgatggcatgtgcc 193 |||||||||||||||||||||||| Sbjct: 147599 tagccagccatgatggcatgtgcc 147622
>ref|XM_776653.1| PREDICTED: Strongylocentrotus purpuratus similar to castor homolog 1, zinc finger (LOC576335), mRNA Length = 2862 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 227 tgcggcggcggcggcagcagcagc 250 |||||||||||||||||||||||| Sbjct: 1113 tgcggcggcggcggcagcagcagc 1090
>gb|AF124792.1| Sporothrix schenckii protein kinase C (PCKSs-2) gene, complete cds Length = 4986 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 2881 gcggcggcggcggcagcagcagcc 2858
>dbj|AK075118.1| Homo sapiens cDNA FLJ90637 fis, clone PLACE1003772, weakly similar to EXTENSIN PRECURSOR Length = 2273 Score = 48.1 bits (24), Expect = 0.020 Identities = 27/28 (96%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagccagag 255 ||||||||||||||||| |||||||||| Sbjct: 739 gcggcggcggcggcagcggcagccagag 712
>gb|AC090436.37| Chlamydomonas reinhardtii clone cr-3h1, complete sequence Length = 102653 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 227 tgcggcggcggcggcagcagcagc 250 |||||||||||||||||||||||| Sbjct: 97839 tgcggcggcggcggcagcagcagc 97816 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 231 gcggcggcggcagcagcagc 250 |||||||||||||||||||| Sbjct: 97901 gcggcggcggcagcagcagc 97882
>gb|AC087545.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0019M20, complete sequence Length = 139421 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 76302 gcggcggcggcggcagcagcagcc 76325
>gb|AC116426.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0058P18, from chromosome 3, complete sequence Length = 155037 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 20207 gcggcggcggcggcagcagcagcc 20230
>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0091J11, from chromosome 3, complete sequence Length = 181163 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 107020 gcggcggcggcggcagcagcagcc 107043
>gb|AC096948.2| Homo sapiens chromosome 1 clone RP4-809J13, complete sequence Length = 115596 Score = 48.1 bits (24), Expect = 0.020 Identities = 27/28 (96%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagccagag 255 ||||||||||||||||| |||||||||| Sbjct: 23362 gcggcggcggcggcagcggcagccagag 23389
>ref|NM_001039463.1| Homo sapiens chromosome 1 open reading frame 118 (C1orf118), mRNA Length = 2273 Score = 48.1 bits (24), Expect = 0.020 Identities = 27/28 (96%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagccagag 255 ||||||||||||||||| |||||||||| Sbjct: 739 gcggcggcggcggcagcggcagccagag 712
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 14896524 gcggcggcggcggcagcagcagcc 14896547 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 13774070 gcggcggcggcggcagcagcagcc 13774047 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 815767 gcggcggcggcggcagcagcagc 815789 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 230 ggcggcggcggcagcagcagc 250 ||||||||||||||||||||| Sbjct: 19776174 ggcggcggcggcagcagcagc 19776194 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 231 gcggcggcggcagcagcagcc 251 ||||||||||||||||||||| Sbjct: 4169236 gcggcggcggcagcagcagcc 4169216 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagc 247 |||||||||||||||||||| Sbjct: 17959927 gcggcggcggcggcagcagc 17959946 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||| ||||||||||||||||||| Sbjct: 15527145 gcggtggcggcggcagcagcagcc 15527168
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 5148715 gcggcggcggcggcagcagcagcc 5148692 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 36176580 gcggcggcggcggcagcagcagc 36176602 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcag 249 |||||||||||||||||||||| Sbjct: 8714027 gcggcggcggcggcagcagcag 8714006 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 217 cctcgcgcggtgcggcggcggcggc 241 |||||||||| |||||||||||||| Sbjct: 34197934 cctcgcgcggagcggcggcggcggc 34197910 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagca 248 ||||||||||||||||||||| Sbjct: 17091757 gcggcggcggcggcagcagca 17091737 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagca 248 ||||||||||||||||||||| Sbjct: 9569485 gcggcggcggcggcagcagca 9569505 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 226 gtgcggcggcggcggcagcagcagc 250 |||| |||||||||||||||||||| Sbjct: 7436092 gtgcagcggcggcggcagcagcagc 7436068 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 cgcgcggtgcggcggcggcg 239 |||||||||||||||||||| Sbjct: 25242001 cgcgcggtgcggcggcggcg 25242020 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagc 247 |||||||||||||||||||| Sbjct: 14385645 gcggcggcggcggcagcagc 14385664 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gcggcggcggcagcagcagc 250 |||||||||||||||||||| Sbjct: 6403564 gcggcggcggcagcagcagc 6403583
>gb|AC138392.2| Homo sapiens chromosome 1 clone RP11-181C21, complete sequence Length = 161502 Score = 48.1 bits (24), Expect = 0.020 Identities = 27/28 (96%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagccagag 255 ||||||||||||||||| |||||||||| Sbjct: 109956 gcggcggcggcggcagcggcagccagag 109983
>gb|AC027659.1| Oryza sativa (japonica cultivar-group) BAC nbxb0015J03 chromosome 10, complete sequence Length = 172742 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 100599 gcggcggcggcggcagcagcagcc 100576
>dbj|AK073446.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043C24, full insert sequence Length = 1170 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 730 gcggcggcggcggcagcagcagcc 753
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 14904765 gcggcggcggcggcagcagcagcc 14904788 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 13781412 gcggcggcggcggcagcagcagcc 13781389 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 815764 gcggcggcggcggcagcagcagc 815786 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 230 ggcggcggcggcagcagcagc 250 ||||||||||||||||||||| Sbjct: 19787450 ggcggcggcggcagcagcagc 19787470 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 231 gcggcggcggcagcagcagcc 251 ||||||||||||||||||||| Sbjct: 4170057 gcggcggcggcagcagcagcc 4170037 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagc 247 |||||||||||||||||||| Sbjct: 17969180 gcggcggcggcggcagcagc 17969199 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||| ||||||||||||||||||| Sbjct: 15535386 gcggtggcggcggcagcagcagcc 15535409
>gb|AC127270.4| Mus musculus BAC clone RP23-453E16 from 12, complete sequence Length = 181004 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagcc 251 |||||||||||||||||||||||| Sbjct: 129147 gcggcggcggcggcagcagcagcc 129170
>gb|BC052963.2| Homo sapiens Snf2-related CBP activator protein, mRNA (cDNA clone IMAGE:5785548), complete cds Length = 4805 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 2989 ggtgcggcggcggcggcagcagc 3011
>gb|AY845638.1| Homo sapiens DRIL3 mRNA, complete cds Length = 2825 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1947 gcggcggcggcggcagcagcagc 1969
>gb|AY308823.1| Canis familiaris TWIST gene, partial sequence Length = 435 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 284 gcggcggcggcggcagcagcagc 306
>gb|BC056323.1| Danio rerio zgc:65870, mRNA (cDNA clone MGC:65870 IMAGE:6800379), complete cds Length = 4150 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1464 gcggcggcggcggcagcagcagc 1442
>ref|XM_514808.1| PREDICTED: Pan troglodytes similar to Rnpc2 protein (LOC458443), mRNA Length = 1560 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 232 gcggcggcggcggcagcagcagc 254
>gb|AC165274.2| Mus musculus BAC clone RP24-97D3 from chromosome 16, complete sequence Length = 175488 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 84982 gcggcggcggcggcagcagcagc 85004
>ref|XM_481795.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1550 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 342 gcggcggcggcggcagcagcagc 320 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagcc 251 ||||||||||| |||||||||||| Sbjct: 339 gcggcggcggcagcagcagcagcc 316
>ref|XM_509852.1| PREDICTED: Pan troglodytes similar to Polyadenylate-binding protein 2 (Poly(A)-binding protein 2) (PolyA binding protein II) (PABII) (Polyadenylate-binding nuclear protein 1) (Nuclear poly(A)-binding protein 1) (LOC452797), mRNA Length = 856 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 16 gcggcggcggcggcagcagcagc 38
>ref|NM_194578.1| Oryza sativa (japonica cultivar-group) putative LeOPT1 - oligopeptide transporter (OSJNBb0012A20.15), mRNA Length = 1671 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 7 gcggcggcggcggcagcagcagc 29
>ref|XM_467209.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1672 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 155 gcggcggcggcggcagcagcagc 133
>ref|XM_450685.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1125 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 177 gcggcggcggcggcagcagcagc 199
>ref|NM_190125.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 930 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 541 gcggcggcggcggcagcagcagc 563
>ref|NM_174569.2| Bos taurus poly(A) binding protein, nuclear 1 (PABPN1), mRNA Length = 3918 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 2105 gcggcggcggcggcagcagcagc 2127
>ref|XM_470520.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1200 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1010 gcggcggcggcggcagcagcagc 988
>ref|XM_479416.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2010 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 338 gcggcggcggcggcagcagcagc 360
>ref|NM_175772.1| Bos taurus elastin (ELN), mRNA Length = 3242 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 972 gcggcggcggcggcagcagcagc 950
>ref|NM_005224.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like) (ARID3A), mRNA Length = 2725 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1855 gcggcggcggcggcagcagcagc 1877
>gb|BC082806.1| Mus musculus hyaluronic acid binding protein 4, mRNA (cDNA clone MGC:90660 IMAGE:30361937), complete cds Length = 4884 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 22 gcggcggcggcggcagcagcagc 44
>ref|NM_004670.3| Homo sapiens 3'-phosphoadenosine 5'-phosphosulfate synthase 2 (PAPSS2), transcript variant 1, mRNA Length = 3859 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 201 gcggcggcggcggcagcagcagc 179
>ref|NM_001015880.1| Homo sapiens 3'-phosphoadenosine 5'-phosphosulfate synthase 2 (PAPSS2), transcript variant 2, mRNA Length = 3874 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 201 gcggcggcggcggcagcagcagc 179
>ref|NM_008748.1| Mus musculus dual specificity phosphatase 8 (Dusp8), mRNA Length = 2453 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1812 gcggcggcggcggcagcagcagc 1834
>gb|BC083139.1| Mus musculus twist gene homolog 1 (Drosophila), mRNA (cDNA clone MGC:103391 IMAGE:6516673), complete cds Length = 1665 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 582 gcggcggcggcggcagcagcagc 604
>gb|DQ205647.1| Eimeria tenella calmodulin-like domain protein kinase isoform 2 mRNA, complete cds Length = 2187 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 362 gcggcggcggcggcagcagcagc 340
>ref|NM_213117.1| Danio rerio zgc:65870 (zgc:65870), mRNA Length = 4150 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1464 gcggcggcggcggcagcagcagc 1442
>gb|U92992.1|HSU92992 Homo sapiens clone DT1P1A11 mRNA, CAG repeat region Length = 1225 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 35 gcggcggcggcggcagcagcagc 57
>gb|U92990.1|HSU92990 Homo sapiens clone DT1P1F10 mRNA, CAG repeat region Length = 425 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 161 gcggcggcggcggcagcagcagc 183
>gb|U92984.1|HSU92984 Homo sapiens clone DT1P1B12 mRNA, CAG repeat region Length = 922 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 19 gcggcggcggcggcagcagcagc 41
>gb|AF442707.1| Salix burjatica clone SB203 microsatellite sequence Length = 238 Score = 46.1 bits (23), Expect = 0.079 Identities = 26/27 (96%) Strand = Plus / Plus Query: 223 gcggtgcggcggcggcggcagcagcag 249 |||| |||||||||||||||||||||| Sbjct: 47 gcggcgcggcggcggcggcagcagcag 73
>gb|AC161215.6| Mus musculus chromosome 7, clone RP24-185E6, complete sequence Length = 165330 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 25025 gcggcggcggcggcagcagcagc 25003
>gb|BC092223.1| Mus musculus cDNA sequence BC036313, mRNA (cDNA clone IMAGE:6854578), with apparent retained intron Length = 4877 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 46 gcggcggcggcggcagcagcagc 68
>gb|AC079685.2| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0012A20, complete sequence Length = 131599 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 96624 gcggcggcggcggcagcagcagc 96646
>gb|AC158990.2| Mus musculus BAC clone RP23-416E18 from chromosome 13, complete sequence Length = 191036 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 79742 gcggcggcggcggcagcagcagc 79720
>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence Length = 256158 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 21534 gcggcggcggcggcagcagcagc 21556
>gb|AY376492.1| Cercopithecus aethiops mitochondrial DNA polymerase (POLG) gene, partial cds Length = 84 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 12 gcggcggcggcggcagcagcagc 34
>gb|AY376480.1| Pan troglodytes mitochondrial DNA polymerase (POLG) gene, POLG-U allele, partial cds Length = 108 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15 gcggcggcggcggcagcagcagc 37
>gb|AY376479.1| Gorilla gorilla mitochondrial DNA polymerase (POLG) gene, POLG-C allele, partial cds Length = 105 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15 gcggcggcggcggcagcagcagc 37
>gb|AY376478.1| Gorilla gorilla mitochondrial DNA polymerase (POLG) gene, POLG-B allele, partial cds Length = 117 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15 gcggcggcggcggcagcagcagc 37
>gb|AC007890.6| Drosophila melanogaster clone BACR02G21, complete sequence Length = 171563 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 100919 gcggcggcggcggcagcagcagc 100897
>ref|XM_608490.2| PREDICTED: Bos taurus similar to mannosidase, alpha, class 1A, member 1 (LOC530027), partial mRNA Length = 1530 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 554 gcggcggcggcggcagcagcagc 576
>gb|BC079869.1| Mus musculus cDNA clone IMAGE:6822296 Length = 3340 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1890 gcggcggcggcggcagcagcagc 1868
>gb|AC108321.5| Rattus norvegicus BAC CH230-261E4 (Children's Hospital Oakland Research Institute) complete sequence Length = 196424 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 3307 gcggcggcggcggcagcagcagc 3285
>gb|AY532724.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiB) gene, complete cds Length = 1138 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 219 gcggcggcggcggcagcagcagc 241
>ref|XM_596209.2| PREDICTED: Bos taurus similar to Zinc finger protein 183 (RING finger protein 113) (LOC518027), mRNA Length = 1263 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 341 gcggcggcggcggcagcagcagc 363
>ref|XM_869383.1| PREDICTED: Bos taurus similar to TSPY-like 2 (LOC617179), mRNA Length = 3452 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 874 gcggcggcggcggcagcagcagc 852
>ref|XM_367053.1| Magnaporthe grisea 70-15 chromosome V predicted protein (MG10683.4) partial mRNA Length = 1968 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 914 gcggcggcggcggcagcagcagc 892
>ref|XM_367087.1| Magnaporthe grisea 70-15 hypothetical protein (MG10717.4) partial mRNA Length = 1953 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1694 gcggcggcggcggcagcagcagc 1672
>gb|AC140426.3| Mus musculus BAC clone RP24-98A17 from chromosome 14, complete sequence Length = 189282 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 104550 gcggcggcggcggcagcagcagc 104528
>ref|NM_019402.1| Mus musculus poly(A) binding protein, nuclear 1 (Pabpn1), mRNA Length = 909 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 10 gcggcggcggcggcagcagcagc 32
>ref|NM_011658.2| Mus musculus twist gene homolog 1 (Drosophila) (Twist1), mRNA Length = 1665 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 582 gcggcggcggcggcagcagcagc 604
>gb|BC055866.1| Mus musculus poly(A) binding protein, nuclear 1, mRNA (cDNA clone MGC:68006 IMAGE:4218469), complete cds Length = 1002 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 12 gcggcggcggcggcagcagcagc 34
>gb|BC052705.1| Mus musculus dual specificity phosphatase 8, mRNA (cDNA clone MGC:64619 IMAGE:5697787), complete cds Length = 2600 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1927 gcggcggcggcggcagcagcagc 1949
>ref|XM_613349.2| PREDICTED: Bos taurus similar to Multiple EGF-like-domain protein 5 precursor (Multiple epidermal growth factor-like domains 9) (LOC533820), mRNA Length = 1911 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 626 gcggcggcggcggcagcagcagc 648
>gb|BC033434.1| Mus musculus twist gene homolog 1 (Drosophila), mRNA (cDNA clone MGC:36030 IMAGE:4935230), complete cds Length = 1467 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 408 gcggcggcggcggcagcagcagc 430
>gb|BC010939.1| Homo sapiens poly(A) binding protein, nuclear 1, mRNA (cDNA clone MGC:13564 IMAGE:4333442), complete cds Length = 1007 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 18 gcggcggcggcggcagcagcagc 40
>ref|XM_955886.1| Neurospora crassa OR74A hypothetical protein (NCU08849.1) partial mRNA Length = 801 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 281 gcggcggcggcggcagcagcagc 259
>ref|XM_331240.1| Neurospora crassa OR74A hypothetical protein (NCU08849.1) partial mRNA Length = 801 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 281 gcggcggcggcggcagcagcagc 259
>gb|AY377897.1| Homo sapiens mitochondrial DNA polymerase gamma (POLG) gene, POLG-4R allele, exon 2 and partial cds; nuclear gene for mitochondrial product Length = 114 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15 gcggcggcggcggcagcagcagc 37
>ref|NM_053530.2| Rattus norvegicus twist gene homolog 1 (Drosophila) (Twist1), mRNA Length = 1513 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 444 gcggcggcggcggcagcagcagc 466
>gb|AC149132.1| Pan troglodytes chromosome X clone PTB-099J01 map human ortholog p22.12 complete sequence Length = 215862 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 198114 gcggcggcggcggcagcagcagc 198136
>ref|NM_001031848.1| Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3, mRNA Length = 1409 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 109 gcggcggcggcggcagcagcagc 131
>ref|NM_198833.1| Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 2, mRNA Length = 3407 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 109 gcggcggcggcggcagcagcagc 131
>ref|NM_002640.3| Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 1, mRNA Length = 3390 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 109 gcggcggcggcggcagcagcagc 131
>ref|NM_018107.3| Homo sapiens RNA binding motif protein 23 (RBM23), mRNA Length = 2433 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1310 gcggcggcggcggcagcagcagc 1288
>gb|BC026979.1| Mus musculus neurocalcin delta, mRNA (cDNA clone MGC:36496 IMAGE:5365560), complete cds Length = 3307 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 36 gcggcggcggcggcagcagcagc 14
>gb|BC011162.1| Mus musculus neurocalcin delta, mRNA (cDNA clone MGC:18666 IMAGE:4191195), complete cds Length = 3355 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 77 gcggcggcggcggcagcagcagc 55
>gb|BC017754.1| Homo sapiens transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha), transcript variant 2, mRNA (cDNA clone MGC:22117 IMAGE:4432023), complete cds Length = 2576 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 2206 gcggcggcggcggcagcagcagc 2184
>gb|BC034528.1| Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8, transcript variant 3, mRNA (cDNA clone MGC:24899 IMAGE:4780455), complete cds Length = 1319 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 19 gcggcggcggcggcagcagcagc 41
>gb|AC162897.4| Mus musculus chromosome 7, clone RP23-371C4, complete sequence Length = 187677 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 65804 gcggcggcggcggcagcagcagc 65782
>gb|AC159002.2| Mus musculus BAC clone RP23-203D7 from chromosome 14, complete sequence Length = 181842 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 66827 gcggcggcggcggcagcagcagc 66805
>gb|AC116591.4| Mus musculus BAC clone RP24-90K1 from chromosome 14, complete sequence Length = 237561 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 8938 gcggcggcggcggcagcagcagc 8916
>ref|XM_888675.2| PREDICTED: Mus musculus AT rich interactive domain 1B (Swi1 like), transcript variant 2 (Arid1b), mRNA Length = 11205 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 898 gcggcggcggcggcagcagcagc 920
>ref|XM_139711.8| PREDICTED: Mus musculus AT rich interactive domain 1B (Swi1 like), transcript variant 1 (Arid1b), mRNA Length = 11325 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 898 gcggcggcggcggcagcagcagc 920
>gb|AC157088.2| Pan troglodytes BAC clone CH251-497H13 from chromosome unknown, complete sequence Length = 220527 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 182131 gcggcggcggcggcagcagcagc 182153 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 tagccagccatgatggcatgtgcc 193 ||||||| |||||||||||||||| Sbjct: 23054 tagccaggcatgatggcatgtgcc 23077
>ref|XM_973595.1| PREDICTED: Mus musculus AT rich interactive domain 1B (Swi1 like) (Arid1b), mRNA Length = 11836 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1369 gcggcggcggcggcagcagcagc 1391
>ref|XM_983766.1| PREDICTED: Mus musculus AT rich interactive domain 1B (Swi1 like) (Arid1b), mRNA Length = 11501 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1035 gcggcggcggcggcagcagcagc 1057
>ref|XM_980821.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 2 (LOC669978), mRNA Length = 1925 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_980791.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 1 (LOC669978), mRNA Length = 2465 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_980854.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 3 (LOC669978), mRNA Length = 2336 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_980893.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 4 (LOC669978), mRNA Length = 4974 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_980926.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 5 (LOC669978), mRNA Length = 13757 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_982563.1| PREDICTED: Mus musculus neurocalcin delta, transcript variant 3 (Ncald), mRNA Length = 1102 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 73 gcggcggcggcggcagcagcagc 51
>ref|XM_982831.1| PREDICTED: Mus musculus neurocalcin delta, transcript variant 7 (Ncald), mRNA Length = 2703 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 82 gcggcggcggcggcagcagcagc 60
>ref|XM_982680.1| PREDICTED: Mus musculus neurocalcin delta, transcript variant 9 (Ncald), mRNA Length = 2733 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 60 gcggcggcggcggcagcagcagc 38
>ref|XM_981678.1| PREDICTED: Mus musculus vacuolar protein sorting 13B (yeast), transcript variant 2 (Vps13b), mRNA Length = 1925 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_981641.1| PREDICTED: Mus musculus vacuolar protein sorting 13B (yeast), transcript variant 1 (Vps13b), mRNA Length = 2465 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_981705.1| PREDICTED: Mus musculus vacuolar protein sorting 13B (yeast), transcript variant 3 (Vps13b), mRNA Length = 2336 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_981739.1| PREDICTED: Mus musculus vacuolar protein sorting 13B (yeast), transcript variant 4 (Vps13b), mRNA Length = 4974 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_981774.1| PREDICTED: Mus musculus vacuolar protein sorting 13B (yeast), transcript variant 5 (Vps13b), mRNA Length = 13757 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_986423.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 2 (LOC666173), mRNA Length = 1925 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_986391.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 1 (LOC666173), mRNA Length = 2465 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_986454.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 3 (LOC666173), mRNA Length = 2336 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_986486.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 4 (LOC666173), mRNA Length = 4974 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>ref|XM_986525.1| PREDICTED: Mus musculus similar to vacuolar protein sorting 13B isoform 4, transcript variant 5 (LOC666173), mRNA Length = 13757 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 435 ggtgcggcggcggcggcagcagc 457
>gb|BC033163.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like), mRNA (cDNA clone IMAGE:4543089), partial cds Length = 1489 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1202 gcggcggcggcggcagcagcagc 1224
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 90631 gcggcggcggcggcagcagcagc 90609
>ref|XM_985819.1| PREDICTED: Mus musculus similar to neuregulin 1 isoform GGF2 (LOC675891), mRNA Length = 1200 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 115 gcggcggcggcggcagcagcagc 93
>ref|XM_975684.1| PREDICTED: Mus musculus hypothetical protein LOC669545 (LOC669545), mRNA Length = 654 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 209 gcggcggcggcggcagcagcagc 231
>ref|XR_002529.1| PREDICTED: Mus musculus similar to AT rich interactive domain 1A isoform a (LOC669477), mRNA Length = 7992 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 364 gcggcggcggcggcagcagcagc 386
>ref|XM_992330.1| PREDICTED: Mus musculus AT rich interactive domain 1A (Swi1 like), transcript variant 2 (Arid1a), mRNA Length = 7524 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 365 gcggcggcggcggcagcagcagc 387
>ref|XM_992362.1| PREDICTED: Mus musculus AT rich interactive domain 1A (Swi1 like), transcript variant 3 (Arid1a), mRNA Length = 8175 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 365 gcggcggcggcggcagcagcagc 387
>ref|XM_748838.1| Aspergillus fumigatus Af293 cyclin Ccl1 (Afu5g07030) partial mRNA Length = 1302 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1133 gcggcggcggcggcagcagcagc 1111
>ref|XM_751354.1| Ustilago maydis 521 hypothetical protein (UM00300.1) partial mRNA Length = 3360 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 353 gcggcggcggcggcagcagcagc 331
>ref|XM_752018.1| Ustilago maydis 521 hypothetical protein (UM00964.1) partial mRNA Length = 2211 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1985 gcggcggcggcggcagcagcagc 1963
>ref|XM_858562.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 8 (LOC485382), mRNA Length = 3451 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_542500.2| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 1 (LOC485382), mRNA Length = 3406 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858522.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 7 (LOC485382), mRNA Length = 3427 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858496.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 6 (LOC485382), mRNA Length = 3028 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858473.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 5 (LOC485382), mRNA Length = 3496 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858451.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 4 (LOC485382), mRNA Length = 3418 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858427.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 3 (LOC485382), mRNA Length = 3406 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_858409.1| PREDICTED: Canis familiaris similar to CEGP1 protein, transcript variant 2 (LOC485382), mRNA Length = 3325 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 131 gcggcggcggcggcagcagcagc 109
>ref|XM_845879.1| PREDICTED: Canis familiaris similar to twist gene homolog 1, transcript variant 2 (LOC609156), mRNA Length = 1254 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 203 gcggcggcggcggcagcagcagc 225
>ref|XM_857736.1| PREDICTED: Canis familiaris similar to twist gene homolog 1, transcript variant 4 (LOC609156), mRNA Length = 1660 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 609 gcggcggcggcggcagcagcagc 631
>gb|AC007610.10| Homo sapiens chromosome 16 clone RP11-429P3, complete sequence Length = 214786 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 55286 gcggcggcggcggcagcagcagc 55264
>ref|XM_800810.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053503895.10) partial mRNA Length = 744 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 568 gcggcggcggcggcagcagcagc 590
>gb|AC122241.4| Mus musculus BAC clone RP23-146M20 from chromosome 15, complete sequence Length = 195429 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 19300 ggtgcggcggcggcggcagcagc 19322
>gb|AC122334.4| Mus musculus BAC clone RP23-349H2 from chromosome 12, complete sequence Length = 212370 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 183453 gcggcggcggcggcagcagcagc 183475
>gb|AC135963.3| Mus musculus BAC clone RP23-346N11 from chromosome 7, complete sequence Length = 202404 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 171052 gcggcggcggcggcagcagcagc 171074
>gb|AC002044.1|HUAC002044 Human Chromosome 16 BAC clone CIT987SK-A-418G10, complete sequence Length = 218074 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 24506 gcggcggcggcggcagcagcagc 24528
>gb|BC049869.1| Mus musculus poly(A) binding protein, nuclear 1, mRNA (cDNA clone IMAGE:5097084), with apparent retained intron Length = 951 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 8 gcggcggcggcggcagcagcagc 30
>gb|BC008204.1| Homo sapiens RNA-binding region (RNP1, RRM) containing 2, mRNA (cDNA clone IMAGE:3867490), with apparent retained intron Length = 949 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 150 gcggcggcggcggcagcagcagc 172
>gb|AC113554.9| Homo sapiens chromosome 17, clone CTD-2501B8, complete sequence Length = 179509 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 230 ggcggcggcggcagcagcagcca 252 ||||||||||||||||||||||| Sbjct: 10099 ggcggcggcggcagcagcagcca 10077
>gb|AC126929.3| Mus musculus BAC clone RP24-465A20 from chromosome 17, complete sequence Length = 168712 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 28538 gcggcggcggcggcagcagcagc 28560
>gb|AC121814.3| Mus musculus BAC clone RP23-457H19 from chromosome 15, complete sequence Length = 188928 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 17549 gcggcggcggcggcagcagcagc 17527
>emb|AL031635.1|CEY47D3B Caenorhabditis elegans YAC Y47D3B, complete sequence Length = 95968 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 227 tgcggcggcggcggcagcagcag 249 ||||||||||||||||||||||| Sbjct: 90739 tgcggcggcggcggcagcagcag 90761
>gb|AC023484.5| Homo sapiens chromosome 3 clone RP11-454F24 map 3p, complete sequence Length = 192875 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 129679 gcggcggcggcggcagcagcagc 129657
>gb|AC024167.6| Homo sapiens chromosome 3 clone RP11-453F3 map 3p, complete sequence Length = 188719 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 61911 gcggcggcggcggcagcagcagc 61889
>gb|AC011352.6| Homo sapiens chromosome 5 clone CTC-327F10, complete sequence Length = 166644 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 148562 gcggcggcggcggcagcagcagc 148540
>ref|XM_537373.2| PREDICTED: Canis familiaris BCL2-like 2, transcript variant 1 (BCL2L2), mRNA Length = 1985 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 185 gcggcggcggcggcagcagcagc 207
>ref|XM_844377.1| PREDICTED: Canis familiaris BCL2-like 2, transcript variant 2 (BCL2L2), mRNA Length = 1212 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 185 gcggcggcggcggcagcagcagc 207
>gb|AC122898.4| Mus musculus BAC clone RP23-71K9 from 1, complete sequence Length = 230945 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 33928 gcggcggcggcggcagcagcagc 33950
>gb|AC115631.4| Mus musculus BAC clone RP24-128K6 from 18, complete sequence Length = 179355 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 28104 gcggcggcggcggcagcagcagc 28126
>gb|AC003986.2| Homo sapiens BAC clone CTA-370M10 from 7, complete sequence Length = 188205 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 136715 gcggcggcggcggcagcagcagc 136737
>ref|XM_862173.1| PREDICTED: Canis familiaris similar to SRY (sex determining region Y)-box 30 isoform b, transcript variant 3 (LOC479316), mRNA Length = 1877 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 382 gcggcggcggcggcagcagcagc 360
>ref|XM_536454.2| PREDICTED: Canis familiaris similar to SRY (sex determining region Y)-box 30 isoform b, transcript variant 1 (LOC479316), mRNA Length = 2370 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 382 gcggcggcggcggcagcagcagc 360
>gb|BC059250.1| Mus musculus cDNA clone IMAGE:6405349, partial cds Length = 5100 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1725 gcggcggcggcggcagcagcagc 1703
>gb|AC093686.6| Homo sapiens BAC clone RP11-713A20 from 7, complete sequence Length = 189854 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 21756 gcggcggcggcggcagcagcagc 21734
>gb|AC093627.4| Homo sapiens BAC clone RP11-90P13 from 7, complete sequence Length = 179269 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 11176 gcggcggcggcggcagcagcagc 11154
>gb|AC093666.4| Homo sapiens BAC clone RP11-482G13 from 7, complete sequence Length = 157816 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 24101 gcggcggcggcggcagcagcagc 24079
>ref|XM_851175.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 4 (LOC487158), mRNA Length = 2765 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 149 gcggcggcggcggcagcagcagc 171
>ref|XM_544286.2| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 1 (LOC487158), mRNA Length = 2747 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 149 gcggcggcggcggcagcagcagc 171
>ref|XM_843380.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 2 (LOC487158), mRNA Length = 2789 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 149 gcggcggcggcggcagcagcagc 171
>ref|XM_851046.1| PREDICTED: Canis familiaris similar to Pro-neuregulin-2 precursor (Pro-NRG2), transcript variant 3 (LOC487158), mRNA Length = 2771 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 149 gcggcggcggcggcagcagcagc 171
>gb|AC152410.6| Mus musculus BAC clone RP24-290C21 from chromosome 10, complete sequence Length = 175812 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 102397 gcggcggcggcggcagcagcagc 102375
>gb|AF415155.1| Gorilla gorilla mitochondrial DNA polymerase (POLG) gene, POLG-A allele, partial cds; nuclear gene for mitochondrial product Length = 90 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 21 gcggcggcggcggcagcagcagc 43
>ref|NM_019903.3| Homo sapiens adducin 3 (gamma) (ADD3), transcript variant 2, mRNA Length = 4195 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 51 gcggcggcggcggcagcagcagc 29
>gb|BC106012.1| Homo sapiens RNA binding motif protein 23, mRNA (cDNA clone IMAGE:6013771) Length = 2313 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1054 gcggcggcggcggcagcagcagc 1032
>gb|BC107886.1| Homo sapiens RNA-binding region (RNP1, RRM) containing 2, mRNA (cDNA clone IMAGE:6668060) Length = 2770 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 29 gcggcggcggcggcagcagcagc 51
>gb|BC071713.1| Homo sapiens transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha), mRNA (cDNA clone IMAGE:5105859), containing frame-shift errors Length = 1894 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1523 gcggcggcggcggcagcagcagc 1501
>ref|XM_502798.1| Yarrowia lipolytica CLIB122, YALI0D13684g predicted mRNA Length = 3129 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 2578 gcggcggcggcggcagcagcagc 2600
>emb|AL390056.7| Human DNA sequence from clone RP3-493I16 on chromosome 6 Contains the 5' end of the RAB3IP2 gene for RAB3 interacting protein 2 and a CpG island, complete sequence Length = 62390 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 25839 gcggcggcggcggcagcagcagc 25817
>ref|NM_004643.1| Homo sapiens poly(A) binding protein, nuclear 1 (PABPN1), mRNA Length = 3107 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1292 gcggcggcggcggcagcagcagc 1314
>gb|BT010034.1| Drosophila melanogaster LP08695 full insert cDNA Length = 4456 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 3234 gcggcggcggcggcagcagcagc 3256 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 tgcggcggcggcggcagcagcagc 250 ||||||||||||||| |||||||| Sbjct: 3230 tgcggcggcggcggcggcagcagc 3253
>emb|AL357374.11| Human DNA sequence from clone RP11-353C18 on chromosome 20 Contains the 5' end of the NFS1 gene for nitrogen fixation 1 (S. cerevisiae), the C20orf52 gene, the RNPC2 gene for RNA-binding region (RNP1, RRM) containing 2, a BXDC1 pseudogene, the 5' end of the C20orf104 gene and three CpG islands, complete sequence Length = 80565 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 49075 gcggcggcggcggcagcagcagc 49053
>emb|AL162613.22| Human DNA sequence from clone RP11-182C2 on chromosome 10 Contains the 5' end of the ADD3 gene for adducin 3 (gamma) and a CpG island, complete sequence Length = 79949 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15349 gcggcggcggcggcagcagcagc 15327
>emb|AL354831.18| Human DNA sequence from clone RP11-188A23 on chromosome 13 Contains a novel gene and a CpG island, complete sequence Length = 144586 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 17092 gcggcggcggcggcagcagcagc 17070
>gb|AF087905.1| Homo sapiens splicing factor SF2 mRNA, complete cds Length = 2424 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1286 gcggcggcggcggcagcagcagc 1264
>emb|AL138885.21| Human DNA sequence from clone RP1-290I10 on chromosome 6 Contains a ribosomal protein L7 (RPL7) pseudogene, the TFAP2A gene for transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha), four novel genes, a mitochondrial ribosomal protein L47 (MRPL47) pseudogene and 11 CpG islands, complete sequence Length = 180133 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 89302 gcggcggcggcggcagcagcagc 89324
>emb|AL139239.18| Human DNA sequence from clone RP11-19C6 on chromosome 10 Contains the 5' end of the CRTAC1 gene for cartilage acidic protein 1 and two CpG islands, complete sequence Length = 161235 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 158968 gcggcggcggcggcagcagcagc 158990
>emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chromosome 13 Contains the 5' end of a novel gene, the gene for suppressor of G2 allele of SKP1, S. cerevisiae, the 5' end of a gene similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) , a pseudogene similar to part of regulator of G-protein signalling 17 (RGS17), the WBP4 gene for WW domain binding protein 4 (formin binding protein 21) and 4 CpG islands, complete sequence Length = 198567 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 165631 gcggcggcggcggcagcagcagc 165609
>emb|AL138767.15| Human DNA sequence from clone RP11-57C13 on chromosome 10 Contains the 3' end of the MINPP gene for multiple inositol polyphosphate histidine phosphatase 1, three novel genes, a ribosomal protein S26 (RPS26) pseudogene, the 5' end of the PAPSS2 gene for 3'-phosphoadenosine 5'-phosphosulfate synthase 2 and a CpG island, complete sequence Length = 111645 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 110014 gcggcggcggcggcagcagcagc 109992
>gb|AC046185.14| Homo sapiens chromosome 17, clone RP11-51F16, complete sequence Length = 173637 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 230 ggcggcggcggcagcagcagcca 252 ||||||||||||||||||||||| Sbjct: 133975 ggcggcggcggcagcagcagcca 133953
>gb|AC027740.11| Mus musculus, clone RP23-57M1, complete sequence Length = 261093 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 17503 gcggcggcggcggcagcagcagc 17525
>emb|AL133327.10| Human DNA sequence from clone RP11-77F13 on chromosome 10 Contains the 3' end of the PAPSS2 gene for 3'-phosphoadenosine 5'-phosphosulfate synthase 2, the 3' end of a novel gene (FLJ90742) and a CpG island, complete sequence Length = 124628 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 385 gcggcggcggcggcagcagcagc 363
>emb|AL022395.2|HS273N12 Human DNA sequence from clone RP1-273N12 on chromosome 6q16.1-16.3 Contains the FBXL4 gene for F-box and leucine-rich repeat protein 4 and the POU3F2 gene for POU domain class 3 transcription factor 2 and a CpG island, complete sequence Length = 126882 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 123466 gcggcggcggcggcagcagcagc 123444
>emb|AL022336.1|HS78F24 Human DNA sequence from clone RP1-78F24 on chromosome 22q12.1-12.3, complete sequence Length = 145414 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 49484 gcggcggcggcggcagcagcagc 49462
>emb|BX058756.1|CNS09HI0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 78 gcggcggcggcggcagcagcagc 56
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 815767 gcggcggcggcggcagcagcagc 815789
>emb|Z19580.1|MMSIAH1B M.musculus siah-1B protein mRNA Length = 1713 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 265 gcggcggcggcggcagcagcagc 287
>emb|Y10871.1|HSTWISTGE H.sapiens twist gene Length = 16702 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 13070 gcggcggcggcggcagcagcagc 13048
>emb|X99268.1|HSBHLH H.sapiens mRNA for B-HLH DNA binding protein Length = 1457 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 385 gcggcggcggcggcagcagcagc 407
>emb|X95518.1|MMNTTP1GN M.musculus mRNA for tyrosine/threonine phosphatase 1 Length = 2453 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1812 gcggcggcggcggcagcagcagc 1834
>emb|X91662.1|HSTWISTGN H.sapiens twist gene Length = 2870 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1400 gcggcggcggcggcagcagcagc 1422
>emb|CR936630.1| Homo sapiens mRNA; cDNA DKFZp686A0568 (from clone DKFZp686A0568) Length = 1020 Score = 46.1 bits (23), Expect = 0.079 Identities = 26/27 (96%) Strand = Plus / Plus Query: 229 cggcggcggcggcagcagcagccagag 255 |||||||||||||||| |||||||||| Sbjct: 1 cggcggcggcggcagcggcagccagag 27
>emb|CR858400.1| Pongo pygmaeus mRNA; cDNA DKFZp459F148 (from clone DKFZp459F148) Length = 2838 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 220 gcggcggcggcggcagcagcagc 242
>emb|BX640812.1|HSM806920 Homo sapiens mRNA; cDNA DKFZp686C17209 (from clone DKFZp686C17209) Length = 2956 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 229 gcggcggcggcggcagcagcagc 251
>emb|BX640798.1|HSM806897 Homo sapiens mRNA; cDNA DKFZp686H0575 (from clone DKFZp686H0575); complete cds Length = 3070 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 15 gcggcggcggcggcagcagcagc 37
>emb|BX640714.1|HSM806784 Homo sapiens mRNA; cDNA DKFZp686A11192 (from clone DKFZp686A11192) Length = 2177 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 226 gcggcggcggcggcagcagcagc 248
>gb|AC166356.1| Mus musculus BAC clone RP23-410F8 from chromosome 15, complete sequence Length = 165082 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 225 ggtgcggcggcggcggcagcagc 247 ||||||||||||||||||||||| Sbjct: 58449 ggtgcggcggcggcggcagcagc 58471
>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete sequence Length = 164179 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 148017 gcggcggcggcggcagcagcagc 148039
>emb|BX571754.1|HSM806633 Homo sapiens mRNA; cDNA DKFZp686O02190 (from clone DKFZp686O02190) Length = 3307 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 17 gcggcggcggcggcagcagcagc 39
>emb|BX537770.1|HSM805856 Homo sapiens mRNA; cDNA DKFZp781I1140 (from clone DKFZp781I1140); complete cds Length = 2166 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 234 gcggcggcggcggcagcagcagc 256
>gb|BC060828.1| Homo sapiens AT rich interactive domain 3A (BRIGHT- like), mRNA (cDNA clone MGC:71697 IMAGE:30342057), complete cds Length = 2825 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1942 gcggcggcggcggcagcagcagc 1964
>emb|AL834198.1|HSM805556 Homo sapiens mRNA; cDNA DKFZp547I166 (from clone DKFZp547I166) Length = 4303 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 3156 gcggcggcggcggcagcagcagc 3134
>gb|AC144521.9| Homo sapiens 3 BAC RP11-158G18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172814 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 113140 gcggcggcggcggcagcagcagc 113118
>emb|AL669842.11| Mouse DNA sequence from clone RP23-25D18 on chromosome 11 Contains three novel genes, the 3' end of the Ntn1 gene for netrin 1 and the 3' end of the Stx8 gene for syntaxin 8, complete sequence Length = 121134 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 27553 gcggcggcggcggcagcagcagc 27531
>emb|AL670004.1|NC5E6 Neurospora crassa DNA linkage group V Cosmid contig 5E6 Length = 119882 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 107767 gcggcggcggcggcagcagcagc 107789
>gb|BC036704.2| Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila), mRNA (cDNA clone MGC:12800 IMAGE:4125830), complete cds Length = 1517 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 614 gcggcggcggcggcagcagcagc 636
>emb|AJ488164.1|SOE488164 Saguinus oedipus TWIST gene for twist transcription factor Length = 612 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 266 gcggcggcggcggcagcagcagc 288
>emb|AJ488163.1|CCA488163 Cebus capucinus TWIST gene for twist transcription factor Length = 624 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 278 gcggcggcggcggcagcagcagc 300
>emb|AJ488160.1|HCO488160 Hylobates concolor TWIST gene for twist transcription factor Length = 615 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 269 gcggcggcggcggcagcagcagc 291
>emb|AJ131845.1|RNO131845 Rattus norvegicus twist gene Length = 1901 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 500 gcggcggcggcggcagcagcagc 522
>emb|AJ010387.1|DME010387 Drosophila melanogaster mRNA for beadex/dLMO protein Length = 2001 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1180 gcggcggcggcggcagcagcagc 1158
>gb|BC065955.1| Danio rerio zgc:65870, mRNA (cDNA clone MGC:77347 IMAGE:6968104), complete cds Length = 4127 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1480 gcggcggcggcggcagcagcagc 1458
>emb|CR925752.5| Mouse DNA sequence from clone RP24-106O24 on chromosome 4, complete sequence Length = 103739 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 31754 gcggcggcggcggcagcagcagc 31732
>emb|CR857615.1| Pongo pygmaeus mRNA; cDNA DKFZp459E0630 (from clone DKFZp459E0630) Length = 4201 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 59 gcggcggcggcggcagcagcagc 37
>emb|X89969.1|BTPOLAPII B.taurus mRNA for polyA binding protein II Length = 3918 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 2105 gcggcggcggcggcagcagcagc 2127
>gb|AC115458.5| Rattus norvegicus 13 BAC CH230-190J23 (Children's Hospital Oakland Research Institute) complete sequence Length = 69404 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 51499 gcggcggcggcggcagcagcagc 51521
>gb|AC023702.4| Drosophila melanogaster X BAC RP98-24L2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 159970 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 14177 gcggcggcggcggcagcagcagc 14199
>dbj|AK127242.1| Homo sapiens cDNA FLJ45309 fis, clone BRHIP3004725, highly similar to DNA-binding protein SATB1 Length = 5259 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 181 gcggcggcggcggcagcagcagc 203
>ref|NM_000474.3| Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila) (TWIST1), mRNA Length = 1669 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 614 gcggcggcggcggcagcagcagc 636
>emb|CR619156.1| full-length cDNA clone CL0BB003ZB09 of Neuroblastoma of Homo sapiens (human) Length = 1616 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 564 gcggcggcggcggcagcagcagc 586
>emb|CR619114.1| full-length cDNA clone CS0DI077YH07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1965 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 203 gcggcggcggcggcagcagcagc 225
>emb|CR618592.1| full-length cDNA clone CS0DE011YF11 of Placenta of Homo sapiens (human) Length = 1561 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 12 gcggcggcggcggcagcagcagc 34
>emb|CR601719.1| full-length cDNA clone CS0DK004YN07 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 2055 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1698 gcggcggcggcggcagcagcagc 1676
>emb|CR598405.1| full-length cDNA clone CS0DD001YA09 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 2002 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1181 gcggcggcggcggcagcagcagc 1203
>gb|AC098694.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OJ1014H12, complete sequence Length = 129420 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 120415 gcggcggcggcggcagcagcagc 120393
>emb|CR595340.1| full-length cDNA clone CS0DJ011YM09 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1583 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 560 gcggcggcggcggcagcagcagc 582
>dbj|AK001344.1| Homo sapiens cDNA FLJ10482 fis, clone NT2RP2000153, weakly similar to GAR2 PROTEIN Length = 2339 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1228 gcggcggcggcggcagcagcagc 1206
>ref|NM_206516.1| Drosophila melanogaster fruitless CG14307-RI, transcript variant I (fru), mRNA Length = 2865 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 671 gcggcggcggcggcagcagcagc 693
>ref|NM_206515.1| Drosophila melanogaster fruitless CG14307-RJ, transcript variant J (fru), mRNA Length = 3017 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 823 gcggcggcggcggcagcagcagc 845
>ref|NM_206514.1| Drosophila melanogaster fruitless CG14307-RK, transcript variant K (fru), mRNA Length = 2455 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 947 gcggcggcggcggcagcagcagc 969
>ref|NM_206513.1| Drosophila melanogaster fruitless CG14307-RL, transcript variant L (fru), mRNA Length = 3425 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1231 gcggcggcggcggcagcagcagc 1253
>ref|NM_206512.1| Drosophila melanogaster fruitless CG14307-RM, transcript variant M (fru), mRNA Length = 2868 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 674 gcggcggcggcggcagcagcagc 696
>ref|NM_176758.1| Drosophila melanogaster Beadex CG6500-RC, transcript variant C (Bx), mRNA Length = 2318 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1501 gcggcggcggcggcagcagcagc 1479
>ref|NM_176210.1| Drosophila melanogaster muscleblind CG33197-RD, transcript variant D (mbl), mRNA Length = 3958 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 2107 gcggcggcggcggcagcagcagc 2129
>dbj|AB158483.1| Cyanidioschyzon merolae genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, complete sequence, clone:BAC clone H1D17 Length = 98410 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 1017 gcggcggcggcggcagcagcagc 1039
>ref|NM_169822.1| Drosophila melanogaster fruitless CG14307-RD, transcript variant D (fru), mRNA Length = 2241 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 603 gcggcggcggcggcagcagcagc 625
>ref|NM_169821.1| Drosophila melanogaster fruitless CG14307-RA, transcript variant A (fru), mRNA Length = 1690 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 228 gcggcggcggcggcagcagcagc 250 ||||||||||||||||||||||| Sbjct: 603 gcggcggcggcggcagcagcagc 625 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,554,660 Number of Sequences: 3902068 Number of extensions: 3554660 Number of successful extensions: 240731 Number of sequences better than 10.0: 1829 Number of HSP's better than 10.0 without gapping: 1877 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 207780 Number of HSP's gapped (non-prelim): 32464 length of query: 365 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 343 effective length of database: 17,147,199,772 effective search space: 5881489521796 effective search space used: 5881489521796 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)