| Clone Name | baet21g12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_818153.1| Trypanosoma brucei TREU927 EP2 procyclin (Tb10.6k15.0030) partial mRNA Length = 390 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 11 ctggaccttggttcccttctc 31 ||||||||||||||||||||| Sbjct: 153 ctggaccttggttcccttctc 133
>emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chromosome 9, complete sequence Length = 197074 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 232 ttggtccaaggcagcctttgcctc 255 ||||||||||||||| |||||||| Sbjct: 139246 ttggtccaaggcagcttttgcctc 139269
>emb|AL138753.8| Human DNA sequence from clone RP11-3L8 on chromosome 9 Contains the TYRP1 gene for tyrosinase-related protein 1, the 3' end of a novel gene and the 5' end of a novel gene (FLJ38505 FLJ90271), complete sequence Length = 162151 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 267 agaaggcaagtcttgaattt 286 |||||||||||||||||||| Sbjct: 16646 agaaggcaagtcttgaattt 16665
>emb|AL031732.8|HS410I8 Human DNA sequence from clone RP3-410I8 on chromosome 1p35.1-36.23 Contains a tubulin-specific chaperone a (TBCA) pseudogene, complete sequence Length = 69017 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 9 cactggaccttggttcccttctct 32 |||||||||||| ||||||||||| Sbjct: 15482 cactggaccttgattcccttctct 15505
>emb|AL008716.1|HS206C7 Human DNA sequence from clone CTA-206C7 on chromosome 22q12.3-13.2, complete sequence Length = 47877 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 agagcctggggttttgggag 110 |||||||||||||||||||| Sbjct: 17814 agagcctggggttttgggag 17795
>emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II BAC clone B14H13 Length = 67890 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 accttggttcccttctcttttctt 38 ||||||||||| |||||||||||| Sbjct: 25505 accttggttcctttctcttttctt 25528
>gb|AC159887.2| Mus musculus BAC clone RP24-249O13 from chromosome 9, complete sequence Length = 160241 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 232 ttggtccaaggcagcctttgcctc 255 ||||||||||||||| |||||||| Sbjct: 114722 ttggtccaaggcagcttttgcctc 114699
>gb|AC151971.3| Mus musculus BAC clone RP24-282C4 from 9, complete sequence Length = 179607 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 tcccttctcttttcttggct 42 |||||||||||||||||||| Sbjct: 105878 tcccttctcttttcttggct 105859
>emb|AL596446.11| Mouse DNA sequence from clone RP23-386E10 on chromosome 11, complete sequence Length = 191735 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 aggaatcaagagaagcaacc 331 |||||||||||||||||||| Sbjct: 90191 aggaatcaagagaagcaacc 90172 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,179,306 Number of Sequences: 3902068 Number of extensions: 3179306 Number of successful extensions: 68094 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 68079 Number of HSP's gapped (non-prelim): 15 length of query: 366 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 344 effective length of database: 17,147,199,772 effective search space: 5898636721568 effective search space used: 5898636721568 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)