ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet21d01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|M31545.1|BLYGSA Barley glutamate 1-semialdehyde aminotransfer... 753 0.0
2gb|BT008916.1| Triticum aestivum clone wpa1c.pk004.m14:fis, full... 444 e-121
3ref|XM_483492.1| Oryza sativa (japonica cultivar-group), mRNA 311 1e-81
4ref|XM_507303.1| PREDICTED Oryza sativa (japonica cultivar-group... 311 1e-81
5dbj|AK104694.1| Oryza sativa (japonica cultivar-group) cDNA clon... 311 1e-81
6dbj|AK064826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 3e-79
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 238 1e-59
8dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic D... 238 1e-59
9gb|L12453.1|SOYGSA Soybean glutamate 1-semialdehyde aminotransfe... 111 2e-21
10gb|U20260.1|GMU20260 Glycine max glutamate 1-semialdehyde aminot... 107 3e-20
11emb|X65973.1|NTGSAMR1 N.tabacum mRNA for glutamate-1-semialdehyd... 80 7e-12
12ref|XM_483493.1| Oryza sativa (japonica cultivar-group), mRNA 72 2e-09
13gb|BT013916.1| Lycopersicon esculentum clone 132913F, mRNA sequence 72 2e-09
14dbj|AK062854.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
15gb|L39279.1|TOMGSAAM Lycopersicon esculentum (clone GFPGSAAM) gl... 72 2e-09
16ref|NM_114732.3| Arabidopsis thaliana glutamate-1-semialdehyde 2... 66 1e-07
17gb|BT025324.1| Arabidopsis thaliana At3g48730 mRNA, complete cds 66 1e-07
18emb|AL133315.1|ATT8P19 Arabidopsis thaliana DNA chromosome 3, BA... 66 1e-07
19emb|BX842127.1|CNS09YB6 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
20gb|U10278.1|ATU10278 Arabidopsis thaliana Columbia glutamate-1-s... 66 1e-07
21emb|X65974.1|NTGSAMR2 N.tabacum mRNA for glutamate-1-semialdehyd... 64 4e-07
22gb|AF411807.1| Lycopersicon esculentum BAC clone Clemson_Id 127E... 64 4e-07
23emb|BX824602.1|CNS0A5PJ Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
24dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone... 64 4e-07
25ref|NM_125752.2| Arabidopsis thaliana GSA1 (GLUTAMATE-1-SEMIALDE... 60 6e-06
26gb|AY139804.1| Arabidopsis thaliana At5g63570/MBK5_3 mRNA, compl... 60 6e-06
27gb|AY102109.1| Arabidopsis thaliana AT5g63570/MBK5_3 mRNA, compl... 60 6e-06
28emb|BX830757.1|CNS0A1LT Arabidopsis thaliana Full-length cDNA Co... 60 6e-06
29dbj|AB005234.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 60 6e-06
30gb|U03773.1|ATU03773 Arabidopsis thaliana Columbia glutamate-1-s... 60 6e-06
31gb|AF366293.1| Brassica napus glutamate 1-semialdehyde aminotran... 54 4e-04
32gb|AE009409.1| Agrobacterium tumefaciens str. C58 linear chromos... 52 0.002
33gb|AE008205.1| Agrobacterium tumefaciens str. C58 linear chromos... 52 0.002
34emb|AL596169.1| Listeria innocua Clip11262 complete genome, segm... 52 0.002
35dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete... 50 0.006
36gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 50 0.006
37gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 50 0.006
38gb|AF279106.2| Uncultured marine gamma proteobacterium EBAC31A08... 46 0.097
39emb|CR719807.3|CNS0GICL Tetraodon nigroviridis full-length cDNA 46 0.097
40gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 46 0.097
41dbj|AB050120.1| Amaranthus tricolor GSA-AT mRNA for glutamate-1-... 46 0.097
42gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 44 0.38
43ref|XM_613401.2| PREDICTED: Bos taurus similar to phosphatidylin... 44 0.38
44gb|AF269487.1|AF269487 Staphylococcus epidermidis strain SR1 clo... 44 0.38
45gb|AF269358.1|AF269358 Staphylococcus epidermidis strain SR1 clo... 44 0.38
46gb|AF269933.1|AF269933 Staphylococcus epidermidis strain SR1 clo... 44 0.38
47gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome 44 0.38
48gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 44 0.38
49gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete g... 44 0.38
50gb|BC081472.1| Danio rerio purine-rich element binding protein A... 42 1.5
51gb|AC108840.13| Mus musculus chromosome 1, clone RP23-348P7, com... 42 1.5
52gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome 42 1.5
53emb|AL591979.1| Listeria monocytogenes strain EGD, complete geno... 42 1.5
54dbj|AK034323.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 1.5
55dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 42 1.5
56gb|AF184956.1|AF184956 Bacillus subtilis mycosubtilin operon, co... 42 1.5
57gb|AY152854.1| Polytomella sp. Pringsheim 198.80 glutamate 1-sem... 42 1.5
58dbj|AP007296.1| Lotus japonicus genomic DNA, clone:LjT02J24, TM0... 42 1.5
59gb|AC100269.7| Mus musculus chromosome 5, clone RP23-67B9, compl... 40 6.0
60ref|XM_476075.1| Oryza sativa (japonica cultivar-group), predic... 40 6.0
61ref|XM_530694.1| PREDICTED: Pan troglodytes LOC461057 (LOC461057... 40 6.0
62ref|XM_473522.1| Oryza sativa (japonica cultivar-group), predic... 40 6.0
63ref|XM_473518.1| Oryza sativa (japonica cultivar-group), predic... 40 6.0
64gb|BT017974.1| Zea mays clone EL01N0524E05.c mRNA sequence 40 6.0
65gb|AC004636.1| Homo sapiens chromosome 5, P1 clone 1268h6 (LBNL ... 40 6.0
66gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Ph... 40 6.0
67gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosom... 40 6.0
68gb|AC138287.10| Mus musculus chromosome 1, clone RP24-361E12, co... 40 6.0
69gb|AC112682.12| Mus musculus chromosome 6, clone RP23-332K10, co... 40 6.0
70gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome... 40 6.0
71gb|AC132957.3| Mus musculus BAC clone RP23-149E9 from chromosome... 40 6.0
72gb|AC132451.3| Mus musculus BAC clone RP23-194C20 from chromosom... 40 6.0
73gb|AC125330.5| Mus musculus BAC clone RP23-217A6 from chromosome... 40 6.0
74emb|AJ248286.2|CNSPAX04 Pyrococcus abyssi complete genome; segme... 40 6.0
75gb|AC108820.13| Mus musculus chromosome 8, clone RP23-10I8, comp... 40 6.0
76gb|AC163394.4| Mus musculus chromosome 15, clone RP24-241D13, co... 40 6.0
77gb|AC102847.3| Mus musculus, clone RP24-406I1, complete sequence 40 6.0
78emb|AL008723.8|HS90G24 Human DNA sequence from clone RP1-90G24 o... 40 6.0
79emb|CR628337.1| Legionella pneumophila str. Lens complete genome 40 6.0
80emb|CR628336.1| Legionella pneumophila str. Paris complete genome 40 6.0
81emb|CR543861.1| Acinetobacter sp. ADP1 complete genome 40 6.0
82emb|AL627265.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 6.0
83gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, comple... 40 6.0
84gb|AC158628.7| Mus musculus 6 BAC RP23-147K11 (Roswell Park Canc... 40 6.0
85dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
86dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
87gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 40 6.0
88gb|AC019103.8| Homo sapiens BAC clone RP11-460I19 from 4, comple... 40 6.0
89gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 6.0
90gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 ... 40 6.0
91dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge... 40 6.0
92gb|AC113286.11| Mus musculus chromosome 1, clone RP23-411P10, co... 40 6.0
93dbj|AK111866.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.0
94gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 6.0
95gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete seq... 40 6.0
96gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 6.0
97gb|AC118544.7| Mus musculus strain C57BL/6J chromosome 5 clone r... 40 6.0
98gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 6.0
99emb|AL606628.3|OSJN00055 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
100gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosom... 40 6.0
101gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 40 6.0
102gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0 
>gb|M31545.1|BLYGSA Barley glutamate 1-semialdehyde aminotransferase (GSA) mRNA,
           complete cds
          Length = 1620

 Score =  753 bits (380), Expect = 0.0
 Identities = 380/380 (100%)
 Strand = Plus / Plus

                                                                       
Query: 65  gagaaggaaggcagcatcatggccggagcagcagccgccgtggcctccggcatatcgatc 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   gagaaggaaggcagcatcatggccggagcagcagccgccgtggcctccggcatatcgatc 60

                                                                       
Query: 125 aggcctgtagccgcgcctaagatctcgcgcgcgccccgctctcggtcggtggtgagggcg 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  aggcctgtagccgcgcctaagatctcgcgcgcgccccgctctcggtcggtggtgagggcg 120

                                                                       
Query: 185 gccgtctccatagacgagaaggcttacacggttcagaaatccgaggagatcttcaacgcc 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gccgtctccatagacgagaaggcttacacggttcagaaatccgaggagatcttcaacgcc 180

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 240

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 300

                                                                       
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatgacaag 424
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatgacaag 360

                               
Query: 425 gtgaatgctgcacttattga 444
           ||||||||||||||||||||
Sbjct: 361 gtgaatgctgcacttattga 380
to top
>gb|BT008916.1| Triticum aestivum clone wpa1c.pk004.m14:fis, full insert mRNA
           sequence
          Length = 1487

 Score =  444 bits (224), Expect = e-121
 Identities = 230/232 (99%)
 Strand = Plus / Plus

                                                                       
Query: 213 cggttcagaaatccgaggagatcttcaacgccgccaaggaattgatgcctggtggtgtta 272
           ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 1   cggttcagaaatctgaggagatcttcaacgccgccaaggaattgatgcctggaggtgtta 60

                                                                       
Query: 273 attcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtttttgattctgtga 332
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  attcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtttttgattctgtga 120

                                                                       
Query: 333 agggctctcatatgtgggatgtcgatggaaatgaatatattgattatgttggttcctggg 392
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 agggctctcatatgtgggatgtcgatggaaatgaatatattgattatgttggttcctggg 180

                                                               
Query: 393 gtcctgcaatcattggtcatgcagatgacaaggtgaatgctgcacttattga 444
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gtcctgcaatcattggtcatgcagatgacaaggtgaatgctgcacttattga 232
to top
>ref|XM_483492.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1575

 Score =  311 bits (157), Expect = 1e-81
 Identities = 214/233 (91%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaaggaattgatg 259
           |||||||| ||||||||  |||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 170 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaaggagttgatg 229

                                                                       
Query: 260 cctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtt 319
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 230 cctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggcagcccattgtg 289

                                                                       
Query: 320 tttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattat 379
           ||||||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||
Sbjct: 290 tttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaatatatcgattat 349

                                                                
Query: 380 gttggttcctggggtcctgcaatcattggtcatgcagatgacaaggtgaatgc 432
           |||||||||||||||||||| ||||| |||||||||||||| | |||||||||
Sbjct: 350 gttggttcctggggtcctgcgatcatcggtcatgcagatgatacggtgaatgc 402



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 25  catggccggagcagcagccgcc 46
to top
>ref|XM_507303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0702E04.16 mRNA
          Length = 1719

 Score =  311 bits (157), Expect = 1e-81
 Identities = 214/233 (91%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaaggaattgatg 259
           |||||||| ||||||||  |||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 227 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaaggagttgatg 286

                                                                       
Query: 260 cctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtt 319
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 287 cctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggcagcccattgtg 346

                                                                       
Query: 320 tttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattat 379
           ||||||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||
Sbjct: 347 tttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaatatatcgattat 406

                                                                
Query: 380 gttggttcctggggtcctgcaatcattggtcatgcagatgacaaggtgaatgc 432
           |||||||||||||||||||| ||||| |||||||||||||| | |||||||||
Sbjct: 407 gttggttcctggggtcctgcgatcatcggtcatgcagatgatacggtgaatgc 459



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 82  catggccggagcagcagccgcc 103
to top
>dbj|AK104694.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-H12, full
           insert sequence
          Length = 1575

 Score =  311 bits (157), Expect = 1e-81
 Identities = 214/233 (91%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaaggaattgatg 259
           |||||||| ||||||||  |||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 170 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaaggagttgatg 229

                                                                       
Query: 260 cctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtt 319
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 230 cctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggcagcccattgtg 289

                                                                       
Query: 320 tttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattat 379
           ||||||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||
Sbjct: 290 tttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaatatatcgattat 349

                                                                
Query: 380 gttggttcctggggtcctgcaatcattggtcatgcagatgacaaggtgaatgc 432
           |||||||||||||||||||| ||||| |||||||||||||| | |||||||||
Sbjct: 350 gttggttcctggggtcctgcgatcatcggtcatgcagatgatacggtgaatgc 402



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 25  catggccggagcagcagccgcc 46
to top
>dbj|AK064826.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000F06, full
           insert sequence
          Length = 1719

 Score =  303 bits (153), Expect = 3e-79
 Identities = 213/233 (91%)
 Strand = Plus / Plus

                                                                       
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaaggaattgatg 259
           |||||||| ||||||||  |||| |||||||||||||||||||| |||||||| ||||||
Sbjct: 227 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgcagccaaggagttgatg 286

                                                                       
Query: 260 cctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagcccatagtt 319
           ||||| ||||||||||||||||| ||||||||||||||||| || ||||||||||| || 
Sbjct: 287 cctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggcagcccattgtg 346

                                                                       
Query: 320 tttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattat 379
           ||||||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||
Sbjct: 347 tttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaatatatcgattat 406

                                                                
Query: 380 gttggttcctggggtcctgcaatcattggtcatgcagatgacaaggtgaatgc 432
           |||||||||||||||||||| ||||| |||||||||||||| | |||||||||
Sbjct: 407 gttggttcctggggtcctgcgatcatcggtcatgcagatgatacggtgaatgc 459



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 82  catggccggagcagcagccgcc 103
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  238 bits (120), Expect = 1e-59
 Identities = 159/172 (92%)
 Strand = Plus / Minus

                                                                            
Query: 249      aggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggc 308
                |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 26525741 aggagttgatgcctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggc 26525682

                                                                            
Query: 309      agcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaat 368
                ||||||| || ||||||||||||||||| |||| |||||||||||| |||||||||||||
Sbjct: 26525681 agcccattgtgtttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaat 26525622

                                                                    
Query: 369      atattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
                |||| |||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 26525621 atatcgattatgttggttcctggggtcctgcgatcatcggtcatgcagatga 26525570



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                    
Query: 200      gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaagg 251
                |||||||| ||||||||  |||| ||||||||||||||||||||||||||||
Sbjct: 26526607 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaagg 26526556



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 82       catggccggagcagcagccgcc 103
                ||||||||||||||||||||||
Sbjct: 26526752 catggccggagcagcagccgcc 26526731
to top
>dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0702E04
          Length = 190948

 Score =  238 bits (120), Expect = 1e-59
 Identities = 159/172 (92%)
 Strand = Plus / Minus

                                                                         
Query: 249   aggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggc 308
             |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 74608 aggagttgatgcctgggggtgttaattcaccagttcgtgccttcaaatcagttggtgggc 74549

                                                                         
Query: 309   agcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaat 368
             ||||||| || ||||||||||||||||| |||| |||||||||||| |||||||||||||
Sbjct: 74548 agcccattgtgtttgattctgtgaagggttctcgtatgtgggatgtggatggaaatgaat 74489

                                                                 
Query: 369   atattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
             |||| |||||||||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 74488 atatcgattatgttggttcctggggtcctgcgatcatcggtcatgcagatga 74437



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                 
Query: 200   gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaagg 251
             |||||||| ||||||||  |||| ||||||||||||||||||||||||||||
Sbjct: 75474 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaagg 75423



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 82    catggccggagcagcagccgcc 103
             ||||||||||||||||||||||
Sbjct: 75619 catggccggagcagcagccgcc 75598
to top
>gb|L12453.1|SOYGSA Soybean glutamate 1-semialdehyde aminotransferase mRNA, complete
           cds
          Length = 1822

 Score =  111 bits (56), Expect = 2e-21
 Identities = 146/176 (82%)
 Strand = Plus / Plus

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           ||||||||  |||||||||| || || || || ||||| |||||||||||||| || || 
Sbjct: 219 gccaaggagctgatgcctggaggcgtgaactccccagttcgtgccttcaaatccgtgggt 278

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           || || || || ||  ||||||| || || || |||| |||||||||| ||||||| |||
Sbjct: 279 ggtcaaccaattgtgattgattcagtcaaagggtctcgtatgtgggatatcgatggcaat 338

                                                                   
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           || || ||||| || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 339 gagtacattgactacgttggttcctggggtcctgcaatcattggtcacgctgatga 394
to top
>gb|U20260.1|GMU20260 Glycine max glutamate 1-semialdehyde aminotransferase (Gsa1) gene,
           complete cds
          Length = 1974

 Score =  107 bits (54), Expect = 3e-20
 Identities = 138/166 (83%)
 Strand = Plus / Plus

                                                                       
Query: 255 tgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagccca 314
           |||||||||| || || || || ||||| |||||||||||||| || || || || || |
Sbjct: 452 tgatgcctggaggcgtgaactccccagttcgtgccttcaaatccgtgggtggtcaaccaa 511

                                                                       
Query: 315 tagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattg 374
           | ||  ||||||| || || || |||| |||||||||| ||||||| ||||| || ||||
Sbjct: 512 ttgtgattgattcagtcaaagggtctcgtatgtgggatatcgatggcaatgagtacattg 571

                                                         
Query: 375 attatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           | || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 572 actacgttggttcctggggtcctgcaatcattggtcacgctgatga 617
to top
>emb|X65973.1|NTGSAMR1 N.tabacum mRNA for glutamate-1-semialdehyde aminotransferase
          Length = 1733

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 142/176 (80%)
 Strand = Plus / Plus

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           |||||||| |||||||| || ||||| ||||| ||||| ||||| ||||| ||||| |||
Sbjct: 300 gccaaggagttgatgccaggaggtgtaaattccccagttcgtgctttcaagtcagttggc 359

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           || || || ||  || |||| || ||||||||||||| |||| ||||  | ||||| || 
Sbjct: 360 ggacaacctatcattattgactccgtgaagggctctcgtatgcgggacatagatggtaac 419

                                                                   
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           || || ||||| ||||| || || |||||||| || || || ||||||||||||||
Sbjct: 420 gagtacattgactatgtcggatcatggggtccagctataatcggtcatgcagatga 475
to top
>ref|XM_483493.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 888

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaagg 251
           |||||||| ||||||||  |||| ||||||||||||||||||||||||||||
Sbjct: 226 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaagg 277



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 81  catggccggagcagcagccgcc 102
to top
>gb|BT013916.1| Lycopersicon esculentum clone 132913F, mRNA sequence
          Length = 1637

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 141/176 (80%)
 Strand = Plus / Plus

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           |||||||| |||||||| || ||||| ||||| || |||||||| ||||| ||||| |||
Sbjct: 283 gccaaggagttgatgccaggaggtgtaaattcccctgtccgtgctttcaagtcagttggc 342

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           || || || ||  || |||| || ||||||||||||| |||| ||||  | ||||| || 
Sbjct: 343 ggacaacctatcattattgactccgtgaagggctctcgtatgcgggacatagatggtaac 402

                                                                   
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           || || ||||| ||||| || || ||||| || || || ||||||||||| |||||
Sbjct: 403 gagtacattgactatgtcggatcatggggaccagctataattggtcatgcggatga 458
to top
>dbj|AK062854.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-A07, full
           insert sequence
          Length = 888

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Plus

                                                               
Query: 200 gagaaggcttacacggttcagaaatccgaggagatcttcaacgccgccaagg 251
           |||||||| ||||||||  |||| ||||||||||||||||||||||||||||
Sbjct: 226 gagaaggcgtacacggtggagaagtccgaggagatcttcaacgccgccaagg 277



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  catggccggagcagcagccgcc 103
           ||||||||||||||||||||||
Sbjct: 81  catggccggagcagcagccgcc 102
to top
>gb|L39279.1|TOMGSAAM Lycopersicon esculentum (clone GFPGSAAM) glutamate 1-semialdehyde
           2,1-aminomutase mRNA, complete cds
          Length = 1664

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 141/176 (80%)
 Strand = Plus / Plus

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           |||||||| |||||||| || ||||| ||||| || |||||||| ||||| ||||| |||
Sbjct: 223 gccaaggagttgatgccaggaggtgtaaattcccctgtccgtgctttcaagtcagttggc 282

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           || || || ||  || |||| || ||||||||||||| |||| ||||  | ||||| || 
Sbjct: 283 ggacaacctatcattattgactccgtgaagggctctcgtatgcgggacatagatggtaac 342

                                                                   
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           || || ||||| ||||| || || ||||| || || || ||||||||||| |||||
Sbjct: 343 gagtacattgactatgtcggatcatggggaccagctataattggtcatgcggatga 398
to top
>ref|NM_114732.3| Arabidopsis thaliana glutamate-1-semialdehyde 2,1-aminomutase/
           pyridoxal phosphate binding / transaminase AT3G48730
           mRNA, complete cds
          Length = 1645

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 356 gatggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgca 415
           |||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| 
Sbjct: 357 gatggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgct 416

                
Query: 416 gatga 420
           |||||
Sbjct: 417 gatga 421
to top
>gb|BT025324.1| Arabidopsis thaliana At3g48730 mRNA, complete cds
          Length = 1419

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 356 gatggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgca 415
           |||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| 
Sbjct: 283 gatggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgct 342

                
Query: 416 gatga 420
           |||||
Sbjct: 343 gatga 347
to top
>emb|AL133315.1|ATT8P19 Arabidopsis thaliana DNA chromosome 3, BAC clone T8P19
          Length = 96679

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                         
Query: 356   gatggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgca 415
             |||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| 
Sbjct: 85792 gatggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgct 85851

                  
Query: 416   gatga 420
             |||||
Sbjct: 85852 gatga 85856
to top
>emb|BX842127.1|CNS09YB6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS33ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1514

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 356 gatggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgca 415
           |||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| 
Sbjct: 261 gatggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgct 320

                
Query: 416 gatga 420
           |||||
Sbjct: 321 gatga 325
to top
>gb|U10278.1|ATU10278 Arabidopsis thaliana Columbia glutamate-1-semialdehyde
            aminotransferase (gsa2) gene, complete cds
          Length = 2416

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 356  gatggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgca 415
            |||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| 
Sbjct: 946  gatggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgct 1005

                 
Query: 416  gatga 420
            |||||
Sbjct: 1006 gatga 1010
to top
>emb|X65974.1|NTGSAMR2 N.tabacum mRNA for glutamate-1-semialdehyde aminotransferase
          Length = 1715

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 140/176 (79%)
 Strand = Plus / Plus

                                                                       
Query: 245 gccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggc 304
           |||||||| |||||||| || ||||| ||||| || || || || ||||| ||||| |||
Sbjct: 294 gccaaggagttgatgccaggaggtgtaaattcccctgttcgcgctttcaagtcagttggc 353

                                                                       
Query: 305 gggcagcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaat 364
           || || || ||  || |||| || ||||||||||||| |||| ||||  | ||||| || 
Sbjct: 354 ggacaacctatcattattgactccgtgaagggctctcgtatgcgggacatagatggtaac 413

                                                                   
Query: 365 gaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
           || || ||||| ||||| || || |||||||| || || || ||||||||||||||
Sbjct: 414 gactacattgactatgtcggatcatggggtccagctataatcggtcatgcagatga 469
to top
>gb|AF411807.1| Lycopersicon esculentum BAC clone Clemson_Id 127E11, complete sequence
          Length = 95845

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 137/172 (79%)
 Strand = Plus / Minus

                                                                         
Query: 249   aggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggc 308
             |||| |||||||| || ||||| ||||| || |||||||| ||||| ||||| ||||| |
Sbjct: 89209 aggagttgatgccaggaggtgtaaattcccctgtccgtgctttcaagtcagttggcggac 89150

                                                                         
Query: 309   agcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaat 368
             | || ||  || |||| || ||||||||||||| |||| ||||  | ||||| || || |
Sbjct: 89149 aacctatcattattgactccgtgaagggctctcgtatgcgggacatagatggtaacgagt 89090

                                                                 
Query: 369   atattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
             | ||||| ||||| || || ||||| || || || ||||||||||| |||||
Sbjct: 89089 acattgactatgtcggatcatggggaccagctataattggtcatgcggatga 89038
to top
>emb|BX824602.1|CNS0A5PJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH59ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1512

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                       
Query: 357 atggaaatgaatatattgattatgttggttcctggggtcctgcaatcattggtcatgcag 416
           ||||||||||||| ||||| |||||||| || ||||| ||||| || ||||||||||| |
Sbjct: 321 atggaaatgaatacattgactatgttggatcttggggacctgctataattggtcatgctg 380

               
Query: 417 atga 420
           ||||
Sbjct: 381 atga 384
to top
>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017,
             complete sequence
          Length = 121127

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 137/172 (79%)
 Strand = Plus / Plus

                                                                         
Query: 249   aggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggc 308
             ||||||||||||| || ||||| || ||||| || |||||||||||||| || || || |
Sbjct: 78278 aggaattgatgcccggaggtgtcaactcacctgttcgtgccttcaaatctgtgggtggac 78337

                                                                         
Query: 309   agcccatagtttttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaat 368
             |||| ||  || |||| || || || || | ||  ||||||||  | ||||| ||||| |
Sbjct: 78338 agccaattcttattgactcagtcaaaggatgtcgcatgtgggacattgatggcaatgagt 78397

                                                                 
Query: 369   atattgattatgttggttcctggggtcctgcaatcattggtcatgcagatga 420
             | ||||| || |||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 78398 acattgactacgttggttcttgggggcctgcaattattggtcacgctgatga 78449
to top
>ref|NM_125752.2| Arabidopsis thaliana GSA1
           (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE);
           glutamate-1-semialdehyde 2,1-aminomutase AT5G63570
           (GSA1) mRNA, complete cds
          Length = 1726

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 321 ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
           |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 334 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 393

                                                         
Query: 381 ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
           |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 394 ttggctcttggggacctgctattattggccatgctgatgacgaggt 439
to top
>gb|AY139804.1| Arabidopsis thaliana At5g63570/MBK5_3 mRNA, complete cds
          Length = 1425

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 321 ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
           |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 254 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 313

                                                         
Query: 381 ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
           |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 314 ttggctcttggggacctgctattattggccatgctgatgacgaggt 359
to top
>gb|AY102109.1| Arabidopsis thaliana AT5g63570/MBK5_3 mRNA, complete cds
          Length = 1726

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 321 ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
           |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 334 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 393

                                                         
Query: 381 ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
           |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 394 ttggctcttggggacctgctattattggccatgctgatgacgaggt 439
to top
>emb|BX830757.1|CNS0A1LT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZB04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1677

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 321 ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
           |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 288 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 347

                                                         
Query: 381 ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
           |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 348 ttggctcttggggacctgctattattggccatgctgatgacgaggt 393
to top
>dbj|AB005234.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBK5
          Length = 89779

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                        
Query: 321  ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
            |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 5490 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 5549

                                                          
Query: 381  ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
            |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 5550 ttggctcttggggacctgctattattggccatgctgatgacgaggt 5595
to top
>gb|U03773.1|ATU03773 Arabidopsis thaliana Columbia
            glutamate-1-semialdehyde-2,1-aminomutase (gsa1) gene
          Length = 3204

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                        
Query: 321  ttgattctgtgaagggctctcatatgtgggatgtcgatggaaatgaatatattgattatg 380
            |||||||||| || |||||  | ||||||||  | ||||||||||| |||||||| || |
Sbjct: 1572 ttgattctgttaaaggctcaaaaatgtgggacattgatggaaatgagtatattgactacg 1631

                                                          
Query: 381  ttggttcctggggtcctgcaatcattggtcatgcagatgacaaggt 426
            |||| || ||||| ||||| || ||||| ||||| |||||| ||||
Sbjct: 1632 ttggctcttggggacctgctattattggccatgctgatgacgaggt 1677
to top
>gb|AF366293.1| Brassica napus glutamate 1-semialdehyde aminotransferase (Gsa)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 1651

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 236 ttcaacgccgccaaggaattgatgcctggtggtgttaattcaccagtccgtgccttcaaa 295
           |||||||| ||||||||  |||||||||| ||||| || || || ||||| |||||||||
Sbjct: 217 ttcaacgcagccaaggatctgatgcctggaggtgtgaactcccctgtccgagccttcaaa 276

                      
Query: 296 tcagtcggcgg 306
           || || |||||
Sbjct: 277 tccgttggcgg 287
to top
>gb|AE009409.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 179 of
            187 of the complete sequence
          Length = 12457

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 347  tgggatgtcgatggaaatgaatatat 372
            ||||||||||||||||||||||||||
Sbjct: 1337 tgggatgtcgatggaaatgaatatat 1312
to top
>gb|AE008205.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 9 of
            187 of the complete sequence
          Length = 12850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 347  tgggatgtcgatggaaatgaatatat 372
            ||||||||||||||||||||||||||
Sbjct: 8335 tgggatgtcgatggaaatgaatatat 8360
to top
>emb|AL596169.1| Listeria innocua Clip11262 complete genome, segment 7/12
          Length = 239050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 353   gtcgatggaaatgaatatattgatta 378
             ||||||||||||||||||||||||||
Sbjct: 43790 gtcgatggaaatgaatatattgatta 43765
to top
>dbj|BA000039.2| Thermosynechococcus elongatus BP-1 DNA, complete genome
          Length = 2593857

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                          
Query: 257    atgcctggtggtgttaattcaccagtccgtgccttcaaatcagtcggcgggcagcccata 316
              ||||| ||||| || | |||||| || ||||||||||| || |||||||| |||||||| 
Sbjct: 474723 atgcccggtggcgtcagttcacccgtgcgtgccttcaagtccgtcggcggccagcccatt 474782

                       
Query: 317    gtttttgat 325
              || ||||||
Sbjct: 474783 gtctttgat 474791
to top
>gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequence
          Length = 2906179

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 368     tatattgattatgttggttcctggggtcc 396
               |||||||||||||||||||| ||||||||
Sbjct: 2389027 tatattgattatgttggttcttggggtcc 2389055
to top
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 260     cctggtggtgttaattcaccagtccgtgc 288
               |||||||| ||||||||||||||||||||
Sbjct: 1561862 cctggtggcgttaattcaccagtccgtgc 1561890
to top
>gb|AF279106.2| Uncultured marine gamma proteobacterium EBAC31A08 BAC sequence
          Length = 128758

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 362   aatgaatatattgattatgttggttcctggggtcc 396
             |||||||||||||||||| |||| || ||||||||
Sbjct: 25929 aatgaatatattgattatattgggtcttggggtcc 25895
to top
>emb|CR719807.3|CNS0GICL Tetraodon nigroviridis full-length cDNA
          Length = 549

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 84  tggccggagcagcagccgccgtggcct 110
           ||||| |||||||||||||||||||||
Sbjct: 333 tggcctgagcagcagccgccgtggcct 307
to top
>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 362     aatgaatatattgattatgttggttcctggggtcc 396
               |||||||||||||||||| || |||| ||||||||
Sbjct: 1193879 aatgaatatattgattatatttgttcatggggtcc 1193845
to top
>dbj|AB050120.1| Amaranthus tricolor GSA-AT mRNA for glutamate-1-semialdehyde
           aminotransferase, partial cds
          Length = 930

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 368 tatattgattatgttggttcctggggtcctgcaatcattggtcatgc 414
           ||||||||||||||||| || ||||| || || || |||||||||||
Sbjct: 7   tatattgattatgttggctcatggggacccgctattattggtcatgc 53
to top
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 368     tatattgattatgttggttcctgggg 393
               ||||| ||||||||||||||||||||
Sbjct: 3773041 tatatagattatgttggttcctgggg 3773066
to top
>ref|XM_613401.2| PREDICTED: Bos taurus similar to phosphatidylinositol transfer
            protein, membrane-associated (LOC533859), mRNA
          Length = 4181

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 86   gccggagcagcagccgccgtgg 107
            ||||||||||||||||||||||
Sbjct: 1961 gccggagcagcagccgccgtgg 1982
to top
>gb|AF269487.1|AF269487 Staphylococcus epidermidis strain SR1 clone step.1005g04 genomic
            sequence
          Length = 3456

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 356  gatggaaatgaatatattgattatgt 381
            |||||||||||||| |||||||||||
Sbjct: 1613 gatggaaatgaatacattgattatgt 1588
to top
>gb|AF269358.1|AF269358 Staphylococcus epidermidis strain SR1 clone step.1002e10 genomic
            sequence
          Length = 4012

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 356  gatggaaatgaatatattgattatgt 381
            |||||||||||||| |||||||||||
Sbjct: 3679 gatggaaatgaatacattgattatgt 3654
to top
>gb|AF269933.1|AF269933 Staphylococcus epidermidis strain SR1 clone step.1033a07 genomic
           sequence
          Length = 3059

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 356 gatggaaatgaatatattgattatgt 381
           |||||||||||||| |||||||||||
Sbjct: 411 gatggaaatgaatacattgattatgt 386
to top
>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome
          Length = 2616530

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 356     gatggaaatgaatatattgattatgt 381
               |||||||||||||| |||||||||||
Sbjct: 1267432 gatggaaatgaatacattgattatgt 1267407
to top
>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 350     gatgtcgatggaaatgaatatattgattat 379
               ||||| ||||||||||||||||| ||||||
Sbjct: 1350419 gatgttgatggaaatgaatatatagattat 1350448
to top
>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome
          Length = 2499279

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 356     gatggaaatgaatatattgattatgt 381
               |||||||||||||| |||||||||||
Sbjct: 1372795 gatggaaatgaatacattgattatgt 1372770
to top
>gb|BC081472.1| Danio rerio purine-rich element binding protein A, mRNA (cDNA clone
           MGC:103411 IMAGE:7232829), complete cds
          Length = 1116

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 63  gggagaaggaaggcagcatcatggc 87
           ||||||||| |||||||||||||||
Sbjct: 197 gggagaaggcaggcagcatcatggc 221
to top
>gb|AC108840.13| Mus musculus chromosome 1, clone RP23-348P7, complete sequence
          Length = 209336

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     tcccaccaaaccccttctctt 23
             |||||||||||||||||||||
Sbjct: 51306 tcccaccaaaccccttctctt 51286
to top
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 368    tatattgattatgttggttcctggggtcc 396
              ||||||||||||||||| || ||||||||
Sbjct: 201079 tatattgattatgttggctcttggggtcc 201107
to top
>emb|AL591979.1| Listeria monocytogenes strain EGD, complete genome, segment 7/12
          Length = 240050

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 350    gatgtcgatggaaatgaatatattgatta 378
              ||||| ||||| |||||||||||||||||
Sbjct: 180320 gatgttgatggtaatgaatatattgatta 180292
to top
>dbj|AK034323.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330177I17 product:hypothetical
           SAM domain (Sterile alpha motif) containing protein,
           full insert sequence
          Length = 2857

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 88  cggagcagcagccgccgtggcctcc 112
           |||||| ||||||||||||||||||
Sbjct: 158 cggagccgcagccgccgtggcctcc 134
to top
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 345     tgtgggatgtcgatggaaatgaata 369
               ||||||||||||||||||| |||||
Sbjct: 3155784 tgtgggatgtcgatggaaacgaata 3155760
to top
>gb|AF184956.1|AF184956 Bacillus subtilis mycosubtilin operon, complete sequence
          Length = 46860

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 344  atgtgggatgtcgatggaaatgaatatat 372
            ||||||||| | |||||||||||||||||
Sbjct: 7775 atgtgggatattgatggaaatgaatatat 7803
to top
>gb|AY152854.1| Polytomella sp. Pringsheim 198.80 glutamate 1-semialdehyde
           aminotransferase (gsa) mRNA, complete cds
          Length = 1756

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 260 cctggtggtgttaattcaccagtccgtgccttc 292
           ||||||||||| || || |||||||||||||||
Sbjct: 192 cctggtggtgtgaactctccagtccgtgccttc 224
to top
>dbj|AP007296.1| Lotus japonicus genomic DNA, clone:LjT02J24, TM0401, complete sequence
          Length = 71160

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 216   ttcagaaatccgaggagatcttcaa 240
             |||||| ||||||||||||||||||
Sbjct: 28626 ttcagagatccgaggagatcttcaa 28650
to top
>gb|AC100269.7| Mus musculus chromosome 5, clone RP23-67B9, complete sequence
          Length = 237273

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    cctggtggtgttaattcacc 279
              ||||||||||||||||||||
Sbjct: 105911 cctggtggtgttaattcacc 105930
to top
>ref|XM_476075.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1494

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 86  gccggagcagcagccgccgtggcctccg 113
           |||| |||||||||||||| ||||||||
Sbjct: 149 gccgcagcagcagccgccgcggcctccg 122
to top
>ref|XM_530694.1| PREDICTED: Pan troglodytes LOC461057 (LOC461057), mRNA
          Length = 724

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 381 ttggttcctggggtcctgca 400
           ||||||||||||||||||||
Sbjct: 260 ttggttcctggggtcctgca 241
to top
>ref|XM_473522.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1395

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 150 cgcgcgcgccccgctctcgg 169
           ||||||||||||||||||||
Sbjct: 321 cgcgcgcgccccgctctcgg 340
to top
>ref|XM_473518.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1395

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 150 cgcgcgcgccccgctctcgg 169
           ||||||||||||||||||||
Sbjct: 321 cgcgcgcgccccgctctcgg 340
to top
>gb|BT017974.1| Zea mays clone EL01N0524E05.c mRNA sequence
          Length = 1117

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 144 agatctcgcgcgcgccccgc 163
           ||||||||||||||||||||
Sbjct: 116 agatctcgcgcgcgccccgc 97
to top
>gb|AC004636.1| Homo sapiens chromosome 5, P1 clone 1268h6 (LBNL H50), complete
            sequence
          Length = 78293

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 361  aaatgaatatattgattatg 380
            ||||||||||||||||||||
Sbjct: 5073 aaatgaatatattgattatg 5092
to top
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 366     aatatattgattatgttggttcctgggg 393
               ||||||||||||||||||| || |||||
Sbjct: 1700794 aatatattgattatgttggatcatgggg 1700767
to top
>gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosome 19, complete sequence
          Length = 188848

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tcccaccaaaccccttctct 22
              ||||||||||||||||||||
Sbjct: 120990 tcccaccaaaccccttctct 121009
to top
>gb|AC138287.10| Mus musculus chromosome 1, clone RP24-361E12, complete sequence
          Length = 150190

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 260    cctggtggtgttaattcacc 279
              ||||||||||||||||||||
Sbjct: 145428 cctggtggtgttaattcacc 145409
to top
>gb|AC112682.12| Mus musculus chromosome 6, clone RP23-332K10, complete sequence
          Length = 206903

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   aaatgaatatattgattatg 380
             ||||||||||||||||||||
Sbjct: 51195 aaatgaatatattgattatg 51214
to top
>gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome 19, complete sequence
          Length = 247655

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tcccaccaaaccccttctct 22
              ||||||||||||||||||||
Sbjct: 179749 tcccaccaaaccccttctct 179768
to top
>gb|AC132957.3| Mus musculus BAC clone RP23-149E9 from chromosome 19, complete sequence
          Length = 246177

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      tcccaccaaaccccttctct 22
              ||||||||||||||||||||
Sbjct: 239989 tcccaccaaaccccttctct 240008
to top
>gb|AC132451.3| Mus musculus BAC clone RP23-194C20 from chromosome 8, complete sequence
          Length = 188539

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 356   gatggaaatgaatatattga 375
             ||||||||||||||||||||
Sbjct: 16858 gatggaaatgaatatattga 16877
to top
>gb|AC125330.5| Mus musculus BAC clone RP23-217A6 from chromosome 6, complete sequence
          Length = 182355

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 260    cctggtggtgttaattcacc 279
              ||||||||||||||||||||
Sbjct: 108725 cctggtggtgttaattcacc 108706
to top
>emb|AJ248286.2|CNSPAX04 Pyrococcus abyssi complete genome; segment 4/6
          Length = 287130

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    gagatcttcaacgccgccaa 249
              ||||||||||||||||||||
Sbjct: 209872 gagatcttcaacgccgccaa 209891
to top
>gb|AC108820.13| Mus musculus chromosome 8, clone RP23-10I8, complete sequence
          Length = 227289

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 356    gatggaaatgaatatattga 375
              ||||||||||||||||||||
Sbjct: 211243 gatggaaatgaatatattga 211262
to top
>gb|AC163394.4| Mus musculus chromosome 15, clone RP24-241D13, complete sequence
          Length = 154751

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     ccttctcttatcccctcctc 34
              ||||||||||||||||||||
Sbjct: 137148 ccttctcttatcccctcctc 137167
to top
>gb|AC102847.3| Mus musculus, clone RP24-406I1, complete sequence
          Length = 146259

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    ccttctcttatcccctcctc 34
             ||||||||||||||||||||
Sbjct: 69557 ccttctcttatcccctcctc 69576
to top
>emb|AL008723.8|HS90G24 Human DNA sequence from clone RP1-90G24 on chromosome 22 Contains the 5'
              end of a novel gene, the RFPL2 gene for ret finger
              protein-like 2, a Immunoglobulin Lambda Light Chain C
              region (IGLC) pseudogene (IGLCOR22-1), the SLC5A4 gene for
              solute carrier family 5 (low affinity glucose
              cotransporter), member 4 and a pseudogene similar to part
              of cleavage and polyadenylation specific factor 1, 160kDa
              (CPSF1), complete sequence
          Length = 154414

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 312    ccatagtttttgattctgtg 331
              ||||||||||||||||||||
Sbjct: 149822 ccatagtttttgattctgtg 149841
to top
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 366     aatatattgattatgttggttcctgggg 393
               ||||||||||||||||||| || |||||
Sbjct: 1659378 aatatattgattatgttggatcttgggg 1659405
to top
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 366     aatatattgattatgttggttcctgggg 393
               ||||||||||||||||||| || |||||
Sbjct: 1666755 aatatattgattatgttggatcatgggg 1666728
to top
>emb|CR543861.1| Acinetobacter sp. ADP1 complete genome
          Length = 3598621

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 374     gattatgttggttcctgggg 393
               ||||||||||||||||||||
Sbjct: 1201739 gattatgttggttcctgggg 1201758
to top
>emb|AL627265.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 1/20
          Length = 251050

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 350    gatgtcgatggaaatgaatatattgattatgttggttcctgggg 393
              ||||||||||| || | |||||| || ||||| |||||||||||
Sbjct: 235364 gatgtcgatggcaaagcatatatcgactatgtcggttcctgggg 235321
to top
>gb|AC026689.6| Homo sapiens chromosome 5 clone CTB-55A14, complete sequence
          Length = 215150

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    tggggtcctgcaatcattgg 408
              ||||||||||||||||||||
Sbjct: 104294 tggggtcctgcaatcattgg 104313
to top
>gb|AC158628.7| Mus musculus 6 BAC RP23-147K11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 188746

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   aaatgaatatattgattatg 380
             ||||||||||||||||||||
Sbjct: 46566 aaatgaatatattgattatg 46547
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 150      cgcgcgcgccccgctctcgg 169
                ||||||||||||||||||||
Sbjct: 28310270 cgcgcgcgccccgctctcgg 28310289



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 150      cgcgcgcgccccgctctcgg 169
                ||||||||||||||||||||
Sbjct: 28288727 cgcgcgcgccccgctctcgg 28288746
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 86      gccggagcagcagccgccgtggcctccg 113
               |||| |||||||||||||| ||||||||
Sbjct: 5308883 gccgcagcagcagccgccgcggcctccg 5308856
to top
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 41      tcgccgcacccgacgacatc 60
               ||||||||||||||||||||
Sbjct: 2178848 tcgccgcacccgacgacatc 2178867
to top
>gb|AC019103.8| Homo sapiens BAC clone RP11-460I19 from 4, complete sequence
          Length = 177950

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 381   ttggttcctggggtcctgca 400
             ||||||||||||||||||||
Sbjct: 82194 ttggttcctggggtcctgca 82175
to top
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 350    gatgtcgatggaaatgaatatattgattatgttggttcctgggg 393
              ||||||||||| || | |||||| || ||||| |||||||||||
Sbjct: 242628 gatgtcgatggcaaagcatatatcgactatgtcggttcctgggg 242585
to top
>gb|AC007583.2|F24B9 Arabidopsis thaliana chromosome 1 BAC F24B9 sequence, complete sequence
          Length = 107234

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 354   tcgatggaaatgaatatatt 373
             ||||||||||||||||||||
Sbjct: 57045 tcgatggaaatgaatatatt 57064
to top
>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 362     aatgaatatattgattatgt 381
               ||||||||||||||||||||
Sbjct: 2093321 aatgaatatattgattatgt 2093302
to top
>gb|AC113286.11| Mus musculus chromosome 1, clone RP23-411P10, complete sequence
          Length = 204629

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 260   cctggtggtgttaattcacc 279
             ||||||||||||||||||||
Sbjct: 59125 cctggtggtgttaattcacc 59106
to top
>dbj|AK111866.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040N14, full
           insert sequence
          Length = 1753

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 150 cgcgcgcgccccgctctcgg 169
           ||||||||||||||||||||
Sbjct: 389 cgcgcgcgccccgctctcgg 408
to top
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 350    gatgtcgatggaaatgaatatattgattatgttggttcctgggg 393
              ||||||||||| || | |||||| || ||||| |||||||||||
Sbjct: 235355 gatgtcgatggcaaagcatatatcgactatgtcggttcctgggg 235312
to top
>gb|CP000021.1| Vibrio fischeri ES114 chromosome II, complete sequence
          Length = 1332022

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 360    gaaatgaatatattgattat 379
              ||||||||||||||||||||
Sbjct: 287968 gaaatgaatatattgattat 287987
to top
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
              complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 350    gatgtcgatggaaatgaatatattgattatgttggttcctgggg 393
              ||||||||||| || | |||||| || ||||| |||||||||||
Sbjct: 234469 gatgtcgatggcaaagcatatatcgactatgtcggttcctgggg 234426
to top
>gb|AC118544.7| Mus musculus strain C57BL/6J chromosome 5 clone rp23-287c8, complete
              sequence
          Length = 205079

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    cctggtggtgttaattcacc 279
              ||||||||||||||||||||
Sbjct: 124410 cctggtggtgttaattcacc 124429
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 33      tcatcttctcgccgcacccg 52
               ||||||||||||||||||||
Sbjct: 1191390 tcatcttctcgccgcacccg 1191409
to top
>emb|AL606628.3|OSJN00055 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0017B10,
              complete sequence
          Length = 150957

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    cgcgcgcgccccgctctcgg 169
              ||||||||||||||||||||
Sbjct: 102578 cgcgcgcgccccgctctcgg 102597



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   cgcgcgcgccccgctctcgg 169
             ||||||||||||||||||||
Sbjct: 81035 cgcgcgcgccccgctctcgg 81054
to top
>gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosome 19, complete
             sequence
          Length = 148454

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     tcccaccaaaccccttctct 22
             ||||||||||||||||||||
Sbjct: 58751 tcccaccaaaccccttctct 58770
to top
>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 350     gatgtcgatggaaatgaatatattgattatgt 381
               ||||| ||||| || |||||||||||||||||
Sbjct: 1570028 gatgttgatggtaacgaatatattgattatgt 1569997
to top
>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12,
             complete sequence
          Length = 88725

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 86    gccggagcagcagccgccgtggcctccg 113
             |||| |||||||||||||| ||||||||
Sbjct: 45584 gccgcagcagcagccgccgcggcctccg 45557


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,679,322
Number of Sequences: 3902068
Number of extensions: 3679322
Number of successful extensions: 70063
Number of sequences better than 10.0: 102
Number of HSP's better than 10.0 without gapping: 102
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69536
Number of HSP's gapped (non-prelim): 525
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top