ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet21b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 92 2e-16
2emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 80 8e-13
3gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 78 3e-12
4gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosom... 40 0.68
5gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, com... 40 0.68
6gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, com... 40 0.68
7gb|AC132609.3| Mus musculus BAC clone RP23-351O8 from 12, comple... 40 0.68
8emb|AL355887.4|CNS05TCY Human chromosome 14 DNA sequence BAC R-1... 40 0.68
9gb|AC092214.3| Homo sapiens BAC clone RP11-811J9 from 7, complet... 38 2.7
10emb|BX842628.1| Neurospora crassa DNA linkage group I BAC clone ... 38 2.7
11emb|BX679665.3| Mouse DNA sequence from clone RP23-247J17 on chr... 38 2.7

>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
          carboxylase/oxygenase, small subunit
          Length = 837

 Score = 91.7 bits (46), Expect = 2e-16
 Identities = 52/54 (96%)
 Strand = Plus / Plus

                                                                
Query: 16 ctccttctagcaagctatatacctacatagtacagccatggcccccaccgtgat 69
          ||||| |||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 10 ctcctcctagcatgctatatacctacatagtacagccatggcccccaccgtgat 63



to top

>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score = 79.8 bits (40), Expect = 8e-13
 Identities = 52/56 (92%)
 Strand = Plus / Plus

                                                                   
Query: 14  gcctccttctagcaagctatatacctacatagtacagccatggcccccaccgtgat 69
           ||||||| |||||||||||||||||||| ||||||||| |||||||| ||||||||
Sbjct: 48  gcctcctcctagcaagctatatacctacttagtacagcgatggcccctaccgtgat 103



to top

>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small
          subunit mRNA, complete cds
          Length = 816

 Score = 77.8 bits (39), Expect = 3e-12
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                 
Query: 31 tatatacctacatagtacagccatggcccccaccgtgat 69
          |||||||||||||||||||||||||||||||||||||||
Sbjct: 2  tatatacctacatagtacagccatggcccccaccgtgat 40



to top

>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete sequence
          Length = 206281

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 29     gctatatacctacatagtacagcc 52
              ||||||||| ||||||||||||||
Sbjct: 177775 gctatatacatacatagtacagcc 177798



to top

>gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, complete sequence
          Length = 171020

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     gcctccttctagcaagctat 33
              ||||||||||||||||||||
Sbjct: 119152 gcctccttctagcaagctat 119171



to top

>gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, complete sequence
          Length = 153684

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    gcctccttctagcaagctat 33
             ||||||||||||||||||||
Sbjct: 59535 gcctccttctagcaagctat 59554



to top

>gb|AC132609.3| Mus musculus BAC clone RP23-351O8 from 12, complete sequence
          Length = 200045

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 29    gctatatacctacatagtacagcc 52
             ||||||||| ||||||||||||||
Sbjct: 31856 gctatatacatacatagtacagcc 31879



to top

>emb|AL355887.4|CNS05TCY Human chromosome 14 DNA sequence BAC R-179O11 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 159183

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aagccagagtgcctccttct 23
             ||||||||||||||||||||
Sbjct: 86737 aagccagagtgcctccttct 86718



to top

>gb|AC092214.3| Homo sapiens BAC clone RP11-811J9 from 7, complete sequence
          Length = 72045

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 47   acagccatggcccccaccgtgat 69
            |||||| ||||||||||||||||
Sbjct: 7766 acagccctggcccccaccgtgat 7744



to top

>emb|BX842628.1| Neurospora crassa DNA linkage group I BAC clone B23L4
          Length = 61971

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    atacctacatagtacagcc 52
             |||||||||||||||||||
Sbjct: 39574 atacctacatagtacagcc 39592



to top

>emb|BX679665.3| Mouse DNA sequence from clone RP23-247J17 on chromosome 2, complete
             sequence
          Length = 34061

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 24    agcaagctatatacctacatagt 46
             |||||| ||||||||||||||||
Sbjct: 29292 agcaagatatatacctacatagt 29314


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 430,983
Number of Sequences: 3902068
Number of extensions: 430983
Number of successful extensions: 28526
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28514
Number of HSP's gapped (non-prelim): 12
length of query: 69
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 48
effective length of database: 17,151,101,840
effective search space: 823252888320
effective search space used: 823252888320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top