ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet17h10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY586531.1| Secale cereale cell wall beta-glucosidase mRNA, c... 224 1e-55
2gb|U46003.1|HVU46003 Hordeum vulgare beta-D-glucan exohydrolase,... 155 8e-35
3gb|AY091513.1| Triticum aestivum beta-D-glucan exohydrolase mRNA... 98 2e-17
4gb|AC105218.4| Homo sapiens chromosome 8, clone RP11-410F13, com... 42 0.85
5gb|AC021500.6| Homo sapiens chromosome 8, clone RP11-135K1, comp... 42 0.85
6gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com... 40 3.4
7gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, co... 40 3.4
8gb|AC121836.2| Mus musculus BAC clone RP24-73L11 from 8, complet... 40 3.4
9emb|AL645949.16| Human DNA sequence from clone RP11-357G3 on chr... 40 3.4
10gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121... 40 3.4
11emb|AL606482.14| Mouse DNA sequence from clone RP23-360H16 on ch... 40 3.4
12emb|BX322538.9| Zebrafish DNA sequence from clone CH211-245G11 i... 40 3.4
13dbj|AB103230.1| Ketupa blakistoni DNA, centromere repeat region,... 40 3.4
14emb|BX569780.6| Zebrafish DNA sequence from clone CH211-134A17 i... 40 3.4
15dbj|AB103285.1| Pulsatrix perspicillata DNA, centromere repeat r... 40 3.4
16dbj|AB103284.1| Pulsatrix perspicillata DNA, centromere repeat r... 40 3.4
17dbj|AB103283.1| Pulsatrix perspicillata DNA, centromere repeat r... 40 3.4
18dbj|AB103252.1| Ketupa blakistoni DNA, centromere repeat region,... 40 3.4
19dbj|AB103251.1| Ketupa blakistoni DNA, centromere repeat region,... 40 3.4
20dbj|AB103240.1| Ketupa blakistoni DNA, centromere repeat region,... 40 3.4
21emb|Z54246.1|HSL219B8 Human DNA sequence from clone LA04NC01-219... 40 3.4

>gb|AY586531.1| Secale cereale cell wall beta-glucosidase mRNA, complete cds
          Length = 2215

 Score =  224 bits (113), Expect = 1e-55
 Identities = 153/165 (92%), Gaps = 1/165 (0%)
 Strand = Plus / Plus

                                                                       
Query: 95  cctgagttcgtgtttcgtgcgcatgcggcggattgcttgctgccccttttgaggtctata 154
           |||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 84  cctgagttcgtgtt-cgtgcgcatgcggcggattgctagctgctccttttgaggtctata 142

                                                                       
Query: 155 tatacagtcggtggtgatcggtaccagacacagtgccaagatggggagcttccacaagac 214
            ||| | |||||||||||||  |||||||| ||||||||||||||||| || ||||||||
Sbjct: 143 catatactcggtggtgatcgacaccagacagagtgccaagatggggagtttgcacaagac 202

                                                        
Query: 215 cacctttgttctcctcatgttctgcttggtggcgttgggaagcgc 259
           ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 203 cacctttgttctcctcatgttctgcttggcggcgttgggaagcgc 247



 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 47/50 (94%), Gaps = 2/50 (4%)
 Strand = Plus / Plus

                                                            
Query: 27 aggcagcaacacgctagacatctttttgccggtttcatcttgctcttgcc 76
          |||||||||| |||||||||| ||||||||| ||||||||||||||||||
Sbjct: 37 aggcagcaac-cgctagacat-tttttgccgatttcatcttgctcttgcc 84



to top

>gb|U46003.1|HVU46003 Hordeum vulgare beta-D-glucan exohydrolase, isoenzyme ExoII, mRNA,
           complete cds
          Length = 2105

 Score =  155 bits (78), Expect = 8e-35
 Identities = 87/90 (96%)
 Strand = Plus / Plus

                                                                       
Query: 170 gatcggtaccagacacagtgccaagatggggagcttccacaagaccacctttgttctcct 229
           |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||
Sbjct: 1   gatcggtaccagacacagtgccaagatggggaacttgcacaagaccacctttgttctcct 60

                                         
Query: 230 catgttctgcttggtggcgttgggaagcgc 259
           |||||||||||||| |||||||||||||||
Sbjct: 61  catgttctgcttggcggcgttgggaagcgc 90



to top

>gb|AY091513.1| Triticum aestivum beta-D-glucan exohydrolase mRNA, complete cds
          Length = 2116

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                                
Query: 207 cacaagaccacctttgttctcctcatgttctgcttggtggcgttgggaagcgc 259
           ||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 13  cacaagaccacctttgttctcctcatgttctgcttggcggcgttgggaagcgc 65



to top

>gb|AC105218.4| Homo sapiens chromosome 8, clone RP11-410F13, complete sequence
          Length = 138416

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 239  cttggtggcgttgggaagcgc 259
            |||||||||||||||||||||
Sbjct: 8176 cttggtggcgttgggaagcgc 8156



to top

>gb|AC021500.6| Homo sapiens chromosome 8, clone RP11-135K1, complete sequence
          Length = 160348

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 239   cttggtggcgttgggaagcgc 259
             |||||||||||||||||||||
Sbjct: 58905 cttggtggcgttgggaagcgc 58925



to top

>gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, complete sequence
          Length = 574126

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 188    tgccaagatggggagcttccacaagacc 215
              ||||||||||| ||||||| ||||||||
Sbjct: 107580 tgccaagatggagagcttctacaagacc 107553



to top

>gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, complete sequence
          Length = 293104

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    acctttgttctcctcatgtt 235
              ||||||||||||||||||||
Sbjct: 172503 acctttgttctcctcatgtt 172522



to top

>gb|AC121836.2| Mus musculus BAC clone RP24-73L11 from 8, complete sequence
          Length = 195192

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 216   acctttgttctcctcatgtt 235
             ||||||||||||||||||||
Sbjct: 74590 acctttgttctcctcatgtt 74609



to top

>emb|AL645949.16| Human DNA sequence from clone RP11-357G3 on chromosome 4, complete
              sequence
          Length = 145151

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     ccttcccaggcaaggcagca 34
              ||||||||||||||||||||
Sbjct: 120506 ccttcccaggcaaggcagca 120487



to top

>gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121i21 map 11, complete
              sequence
          Length = 168186

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      acttctccttcccaggcaag 28
              ||||||||||||||||||||
Sbjct: 158359 acttctccttcccaggcaag 158378



to top

>emb|AL606482.14| Mouse DNA sequence from clone RP23-360H16 on chromosome 11 Contains the
              genes for olfactory receptors MOR135-7, -8, -10 and -28,
              three olfactory receptor MOR135 pseudogenes, and the gene
              for olfactory receptor MOR157-1, complete sequence
          Length = 199115

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      acttctccttcccaggcaag 28
              ||||||||||||||||||||
Sbjct: 144630 acttctccttcccaggcaag 144611



to top

>emb|BX322538.9| Zebrafish DNA sequence from clone CH211-245G11 in linkage group 15,
             complete sequence
          Length = 159879

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ccacaagaccacctttgttc 225
             ||||||||||||||||||||
Sbjct: 87632 ccacaagaccacctttgttc 87613



to top

>dbj|AB103230.1| Ketupa blakistoni DNA, centromere repeat region, clone:
           KBL-EcoRI_M22
          Length = 366

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   acacttctccttcccaggca 26
           ||||||||||||||||||||
Sbjct: 225 acacttctccttcccaggca 206



 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 7  acacttctccttcccaggca 26
          ||||||||||||||||||||
Sbjct: 45 acacttctccttcccaggca 26



to top

>emb|BX569780.6| Zebrafish DNA sequence from clone CH211-134A17 in linkage group 10,
             complete sequence
          Length = 187807

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   ctcatgttctgcttggtggc 247
             ||||||||||||||||||||
Sbjct: 31199 ctcatgttctgcttggtggc 31218



to top

>dbj|AB103285.1| Pulsatrix perspicillata DNA, centromere repeat region, clone:
           PPE-HaeIII_14
          Length = 187

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   acacttctccttcccaggca 26
           ||||||||||||||||||||
Sbjct: 148 acacttctccttcccaggca 129



to top

>dbj|AB103284.1| Pulsatrix perspicillata DNA, centromere repeat region, clone:
           PPE-HaeIII_9
          Length = 183

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   acacttctccttcccaggca 26
           ||||||||||||||||||||
Sbjct: 148 acacttctccttcccaggca 129



to top

>dbj|AB103283.1| Pulsatrix perspicillata DNA, centromere repeat region, clone:
           PPE-HaeIII_2
          Length = 183

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 7   acacttctccttcccaggca 26
           ||||||||||||||||||||
Sbjct: 148 acacttctccttcccaggca 129



to top

>dbj|AB103252.1| Ketupa blakistoni DNA, centromere repeat region, clone:
          KBL-EcoRI_S24
          Length = 180

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 7  acacttctccttcccaggca 26
          ||||||||||||||||||||
Sbjct: 45 acacttctccttcccaggca 26



to top

>dbj|AB103251.1| Ketupa blakistoni DNA, centromere repeat region, clone:
          KBL-EcoRI_S18
          Length = 186

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 7  acacttctccttcccaggca 26
          ||||||||||||||||||||
Sbjct: 45 acacttctccttcccaggca 26



to top

>dbj|AB103240.1| Ketupa blakistoni DNA, centromere repeat region, clone:
          KBL-EcoRI_S1
          Length = 186

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 7  acacttctccttcccaggca 26
          ||||||||||||||||||||
Sbjct: 45 acacttctccttcccaggca 26



to top

>emb|Z54246.1|HSL219B8 Human DNA sequence from clone LA04NC01-219B8 on chromosome 4,
            complete sequence
          Length = 36171

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 15   ccttcccaggcaaggcagca 34
            ||||||||||||||||||||
Sbjct: 2304 ccttcccaggcaaggcagca 2285


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,042,519
Number of Sequences: 3902068
Number of extensions: 2042519
Number of successful extensions: 36043
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36013
Number of HSP's gapped (non-prelim): 29
length of query: 259
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 237
effective length of database: 17,147,199,772
effective search space: 4063886345964
effective search space used: 4063886345964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top