ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet133e12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-22
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-22
3dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-22
4dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic D... 109 7e-22
5dbj|AK105002.2| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
6dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
7dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
8dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
9dbj|AK119873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
10dbj|AK119652.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
11dbj|AK111221.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
12dbj|AK111213.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
13dbj|AK110460.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
14dbj|AK110456.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
15dbj|AK110438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
16dbj|AK110417.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
17dbj|AK110408.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
18dbj|AK110378.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
19dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
20dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
21dbj|AK110295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
22dbj|AK110074.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
23dbj|AK109985.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
24dbj|AK108869.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
25dbj|AK107285.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
26dbj|AK106985.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
27dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
28dbj|AK106431.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
29dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
30dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
31dbj|AK064546.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
32dbj|AK063163.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
33dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
34dbj|AK058406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 109 7e-22
35gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial... 107 3e-21
36dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-21
37dbj|AK107604.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 1e-20
38gb|AY095452.1| Austrobaileya scandens 26S ribosomal RNA gene, pa... 101 2e-19
39gb|AY292886.1| Austrobaileya scandens 26S ribosomal RNA gene, pa... 101 2e-19
40gb|DQ008655.1| Sarcandra chloranthoides 26S ribosomal RNA gene, ... 101 2e-19
41gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, compl... 101 2e-19
42gb|AF479097.1| Tetracera asiatica 26S ribosomal RNA gene, comple... 101 2e-19
43dbj|AK111208.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-19
44dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-19
45gb|M37231.1|RYENORR1 Rye 26S rRNA 3' end and 18S rRNA, 5' end 101 2e-19
46emb|AL663020.4|OSJN00220 Oryza sativa genomic DNA, chromosome 4,... 98 3e-18
47dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-18
48dbj|AK105013.2| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-18
49dbj|AK061005.1| Oryza sativa (japonica cultivar-group) cDNA clon... 98 3e-18
50gb|BT018529.1| Zea mays clone EL01N0433D12.d mRNA sequence 94 4e-17
51gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, part... 94 4e-17
52gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial ... 94 4e-17
53gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial ... 94 4e-17
54gb|AF389245.1| Kingdonia uniflora 26S ribosomal RNA gene, partia... 94 4e-17
55gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partia... 94 4e-17
56gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosom... 94 4e-17
57gb|AY189032.1| Anginon rugosum 26S large subunit ribosomal RNA g... 94 4e-17
58gb|AY428812.1| Quercus suber 26S large subunit ribosomal RNA gen... 94 4e-17
59gb|AY342317.1| Marchantia polymorpha chromosome X 5S ribosomal R... 94 4e-17
60gb|AY095476.1| Larix sp. MJZ-2002 26S ribosomal RNA gene, partia... 94 4e-17
61gb|AY095474.1| Tacca chantieri 26S ribosomal RNA gene, partial s... 94 4e-17
62gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, par... 94 4e-17
63gb|AY095461.1| Hedyosmum bonplandianum 26S ribosomal RNA gene, p... 94 4e-17
64gb|AY095460.1| Gomortega keule 26S ribosomal RNA gene, partial s... 94 4e-17
65gb|AY095458.1| Cinnamodendron sp. MJZ-2002 26S ribosomal RNA gen... 94 4e-17
66gb|AY260031.1| Eucnide urens 26S ribosomal RNA gene, complete se... 94 4e-17
67gb|AY260029.1| Petalonyx parryi 26S ribosomal RNA gene, complete... 94 4e-17
68gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partia... 94 4e-17
69gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, par... 94 4e-17
70gb|AY292889.1| Hedyosmum sp. YLQ-2003 26S ribosomal RNA gene, pa... 94 4e-17
71gb|AY292885.1| Cinnamodendron sp. YLQ-2003 26S ribosomal RNA gen... 94 4e-17
72gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial se... 94 4e-17
73emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-l... 94 4e-17
74gb|AF274672.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 94 4e-17
75gb|AF274660.1| Paeonia tenuifolia 26S ribosomal RNA gene, comple... 94 4e-17
76gb|AF274659.1| Paeonia suffruticosa 26S ribosomal RNA gene, comp... 94 4e-17
77gb|AF274658.1| Paeonia californica 26S ribosomal RNA gene, compl... 94 4e-17
78gb|AF274636.1| Altingia excelsa 26S ribosomal RNA gene, complete... 94 4e-17
79gb|AY920800.1| Blackfordia virginica large subunit 28S ribosomal... 94 4e-17
80gb|AY920799.1| Aequorea victoria large subunit 28S ribosomal RNA... 94 4e-17
81gb|DQ008667.1| Cycas revoluta 26S ribosomal RNA gene, partial se... 94 4e-17
82gb|DQ008664.1| Podocarpus macrophyllus 26S ribosomal RNA gene, p... 94 4e-17
83gb|DQ008649.1| Potamogeton berchtoldii 26S ribosomal RNA gene, p... 94 4e-17
84gb|DQ008648.1| Carludovica palmata 26S ribosomal RNA gene, parti... 94 4e-17
85gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partia... 94 4e-17
86gb|DQ008616.1| Cissampelos pareira 26S ribosomal RNA gene, parti... 94 4e-17
87gb|AF479247.1| Morella cerifera 26S ribosomal RNA gene, complete... 94 4e-17
88gb|AF479227.1| Greyia radlkoferi 26S ribosomal RNA gene, complet... 94 4e-17
89gb|AF479226.1| Hedyosmum arborescens 26S ribosomal RNA gene, com... 94 4e-17
90gb|AF479224.1| Saxifraga mertensiana 26S ribosomal RNA gene, com... 94 4e-17
91gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene... 94 4e-17
92gb|AF479208.1| Altingia excelsa 26S ribosomal RNA gene, complete... 94 4e-17
93gb|AF479207.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 94 4e-17
94gb|AF479204.1| Gunnera hamiltonii 26S ribosomal RNA gene, comple... 94 4e-17
95gb|AF479202.1| Irvingbaileya sp. Plunkett 1510 26S ribosomal RNA... 94 4e-17
96gb|AF479140.1| Capparis sandwichiana 26S ribosomal RNA gene, com... 94 4e-17
97gb|AF479110.1| Corynocarpus laevigatus 26S ribosomal RNA gene, c... 94 4e-17
98gb|AF479109.1| Begonia metallica x Begonia sanguinea 26S ribosom... 94 4e-17
99gb|AF479104.1| Securidaca diversifolia 26S ribosomal RNA gene, p... 94 4e-17
100gb|AF479098.1| Celtis yunnanensis 26S ribosomal RNA gene, comple... 94 4e-17
101gb|AF479096.1| Dillenia retusa 26S ribosomal RNA gene, partial s... 94 4e-17
102gb|AF479083.1| Tamarix pentandra 26S ribosomal RNA gene, complet... 94 4e-17
103dbj|AK062902.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 4e-17
104gb|AF036498.1|AF036498 Saxifraga mertensiana large subunit 26S r... 94 4e-17
105gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA ... 94 4e-17
106gb|AF036488.1|AF036488 Gnetum gnemon large subunit 26S ribosomal... 94 4e-17
107emb|AJ271022.1|BRO271022 Buccegia romanica 25S rRNA gene for 25S... 94 4e-17
108gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene 94 4e-17
109dbj|AB021684.1| Marchantia polymorpha genes for 26S rRNA, 5S rRN... 94 4e-17
110gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA ... 90 6e-16
111gb|AY260028.1| Petalonyx nitidus 26S ribosomal RNA gene, complet... 90 6e-16
112gb|AY095475.1| Ginkgo biloba 26S ribosomal RNA gene, partial seq... 88 2e-15
113gb|AF479241.1| Swietenia macrophylla 26S ribosomal RNA gene, com... 88 2e-15
114gb|AF479230.1| Oxalis dillenii 26S ribosomal RNA gene, complete ... 88 2e-15
115dbj|AK063412.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 2e-15
116dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone... 88 2e-15
117gb|DQ287987.1| Abutilon theophrasti 26S ribosomal RNA gene, part... 86 1e-14
118gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete... 86 1e-14
119gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ... 86 1e-14
120gb|AY563529.1| Camellia sinensis 26S ribosomal RNA gene, partial... 86 1e-14
121gb|AY555065.1| Corchorus olitorius 26S ribosomal RNA gene, parti... 86 1e-14
122gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, parti... 86 1e-14
123gb|AF389275.1| Viscum album 26S ribosomal RNA gene, partial sequ... 86 1e-14
124gb|AF389274.1| Osyris lanceolata 26S ribosomal RNA gene, partial... 86 1e-14
125gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, parti... 86 1e-14
126gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial se... 86 1e-14
127gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, part... 86 1e-14
128gb|AF389269.1| Ranunculus keniensis 26S ribosomal RNA gene, part... 86 1e-14
129gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, parti... 86 1e-14
130gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial s... 86 1e-14
131gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, parti... 86 1e-14
132gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 86 1e-14
133gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial ... 86 1e-14
134gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial s... 86 1e-14
135gb|AF389259.1| Nelumbo lutea 26S ribosomal RNA gene, partial seq... 86 1e-14
136gb|AF389257.1| Menispermum canadense 26S ribosomal RNA gene, par... 86 1e-14
137gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial... 86 1e-14
138gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, ... 86 1e-14
139gb|AF389254.1| Decaisnea fargesii 26S ribosomal RNA gene, partia... 86 1e-14
140gb|AF389253.1| Akebia quinata 26S ribosomal RNA gene, partial se... 86 1e-14
141gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, part... 86 1e-14
142gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 86 1e-14
143gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partia... 86 1e-14
144gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 86 1e-14
145gb|AF389246.1| Circaeaster agrestis 26S ribosomal RNA gene, part... 86 1e-14
146gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 86 1e-14
147gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, p... 86 1e-14
148gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial... 86 1e-14
149gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene... 86 1e-14
150gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, part... 86 1e-14
151gb|AY189150.1| Petroselinum crispum 26S large subunit ribosomal ... 86 1e-14
152gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosom... 86 1e-14
153gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA ... 86 1e-14
154gb|AY189113.1| Torricellia tiliifolia 26S large subunit ribosoma... 86 1e-14
155gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribos... 86 1e-14
156gb|AY189111.1| Tetrapanax papyriferus 26S large subunit ribosoma... 86 1e-14
157gb|AY189110.1| Spananthe paniculata 26S large subunit ribosomal ... 86 1e-14
158gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal... 86 1e-14
159gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosom... 86 1e-14
160gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal ... 86 1e-14
161gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal ... 86 1e-14
162gb|AY189101.1| Platysace lanceolata 26S large subunit ribosomal ... 86 1e-14
163gb|AY189098.1| Panax quinquefolius 26S large subunit ribosomal R... 86 1e-14
164gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosom... 86 1e-14
165gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA g... 86 1e-14
166gb|AY189093.1| Mulinum sp. Hufford s.n. 26S large subunit riboso... 86 1e-14
167gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA ... 86 1e-14
168gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA ... 86 1e-14
169gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal R... 86 1e-14
170gb|AY189089.1| Mulinum albovaginatum 26S large subunit ribosomal... 86 1e-14
171gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribos... 86 1e-14
172gb|AY189086.1| Meryta sinclairii 26S large subunit ribosomal RNA... 86 1e-14
173gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosoma... 86 1e-14
174gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal R... 86 1e-14
175gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA ... 86 1e-14
176gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal R... 86 1e-14
177gb|AY189078.1| Hydrocotyle verticillata 26S large subunit riboso... 86 1e-14
178gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal R... 86 1e-14
179gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit riboso... 86 1e-14
180gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA g... 86 1e-14
181gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene... 86 1e-14
182gb|AY189072.1| Gymnophyton polycephalum 26S large subunit riboso... 86 1e-14
183gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA... 86 1e-14
184gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosoma... 86 1e-14
185gb|AY189069.1| Fatsia japonica 26S large subunit ribosomal RNA g... 86 1e-14
186gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal R... 86 1e-14
187gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal... 86 1e-14
188gb|AY189066.1| Endressia castellana 26S large subunit ribosomal ... 86 1e-14
189gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit rib... 86 1e-14
190gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal... 86 1e-14
191gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribos... 86 1e-14
192gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal ... 86 1e-14
193gb|AY189058.1| Daucus carota 26S large subunit ribosomal RNA gen... 86 1e-14
194gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA ... 86 1e-14
195gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RN... 86 1e-14
196gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosoma... 86 1e-14
197gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RN... 86 1e-14
198gb|AY189052.1| Bowlesia tropaeolifolia 26S large subunit ribosom... 86 1e-14
199gb|AY189051.1| Bowlesia incana 26S large subunit ribosomal RNA g... 86 1e-14
200gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal R... 86 1e-14
201gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA g... 86 1e-14
202gb|AY189045.1| Azorella monantha 26S large subunit ribosomal RNA... 86 1e-14
203gb|AY189044.1| Azorella macquariensis 26S large subunit ribosoma... 86 1e-14
204gb|AY189041.1| Astrotricha pterocarpa 26S large subunit ribosoma... 86 1e-14
205gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA g... 86 1e-14
206gb|AY189039.1| Arthrophyllum mackeei 26S large subunit ribosomal... 86 1e-14
207gb|AY189037.1| Arctopus echinatus 26S large subunit ribosomal RN... 86 1e-14
208gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA ge... 86 1e-14
209gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA ... 86 1e-14
210gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA g... 86 1e-14
211gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal R... 86 1e-14
212gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA g... 86 1e-14
213gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, par... 86 1e-14
214gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial ... 86 1e-14
215gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial ... 86 1e-14
216gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, par... 86 1e-14
217gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, parti... 86 1e-14
218gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partia... 86 1e-14
219gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial... 86 1e-14
220gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, parti... 86 1e-14
221gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, pa... 86 1e-14
222gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, p... 86 1e-14
223gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, part... 86 1e-14
224gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, p... 86 1e-14
225gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, parti... 86 1e-14
226gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA ... 86 1e-14
227gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, par... 86 1e-14
228gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial... 86 1e-14
229gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partia... 86 1e-14
230gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial ... 86 1e-14
231gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, parti... 86 1e-14
232gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partia... 86 1e-14
233gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial ... 86 1e-14
234gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial s... 86 1e-14
235gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial se... 86 1e-14
236gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial... 86 1e-14
237gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial s... 86 1e-14
238gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, part... 86 1e-14
239gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, part... 86 1e-14
240gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, par... 86 1e-14
241gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial se... 86 1e-14
242gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial ... 86 1e-14
243gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, par... 86 1e-14
244gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, par... 86 1e-14
245gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, par... 86 1e-14
246gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, part... 86 1e-14
247gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, parti... 86 1e-14
248gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial ... 86 1e-14
249gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial s... 86 1e-14
250gb|AY727944.1| Cobaea scandens 26S ribosomal RNA gene, partial s... 86 1e-14
251gb|AY727943.1| Cantua buxifolia 26S ribosomal RNA gene, partial ... 86 1e-14
252gb|AY727942.1| Acanthogilia gloriosa 26S ribosomal RNA gene, par... 86 1e-14
253gb|AY727941.1| Polemonium pauciflorum 26S ribosomal RNA gene, pa... 86 1e-14
254gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, pa... 86 1e-14
255gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, par... 86 1e-14
256gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, parti... 86 1e-14
257gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, par... 86 1e-14
258gb|AY727936.1| Impatiens auricoma 26S ribosomal RNA gene, partia... 86 1e-14
259gb|AY727934.1| Tetramerista sp. JS-2005 26S ribosomal RNA gene, ... 86 1e-14
260gb|AY727933.1| Pelliciera rhizophorae 26S ribosomal RNA gene, pa... 86 1e-14
261gb|AY727932.1| Ilex repanda 26S ribosomal RNA gene, partial sequ... 86 1e-14
262gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial se... 86 1e-14
263gb|AY727929.1| Hydrangea sp. JS-2005 26S ribosomal RNA gene, par... 86 1e-14
264gb|AY342318.1| Marchantia polymorpha 5S ribosomal RNA and 18S ri... 86 1e-14
265gb|AF399949.1| Musa acuminata clone Radka1 26S ribosomal RNA, pa... 86 1e-14
266gb|AY095473.1| Spathiphyllum wallisii 26S ribosomal RNA gene, pa... 86 1e-14
267gb|AY095472.1| Pleea tenuifolia 26S ribosomal RNA gene, partial ... 86 1e-14
268gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partia... 86 1e-14
269gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial s... 86 1e-14
270gb|AY095466.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 86 1e-14
271gb|AY095464.1| Liriodendron chinense 26S ribosomal RNA gene, par... 86 1e-14
272gb|AY095462.1| Hernandia nymphaeifolia 26S ribosomal RNA gene, p... 86 1e-14
273gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 86 1e-14
274gb|AY095457.1| Chloranthus multistachys 26S ribosomal RNA gene, ... 86 1e-14
275gb|AY095455.1| Canella winterana 26S ribosomal RNA gene, partial... 86 1e-14
276gb|AY095454.1| Calycanthus occidentalis 26S ribosomal RNA gene, ... 86 1e-14
277gb|AY095453.1| Cabomba sp. MJZ-2002 26S ribosomal RNA gene, part... 86 1e-14
278gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial s... 86 1e-14
279gb|AY095450.1| Aristolochia macrophylla 26S ribosomal RNA gene, ... 86 1e-14
280gb|AY095449.1| Amborella trichopoda 26S ribosomal RNA gene, part... 86 1e-14
281gb|AY260042.1| Jamesia americana 26S ribosomal RNA gene, complet... 86 1e-14
282gb|AY260041.1| Fendlera rupicola 26S ribosomal RNA gene, complet... 86 1e-14
283gb|AY260040.1| Cardiandra alternifolia 26S ribosomal RNA gene, c... 86 1e-14
284gb|AY260037.1| Philadelphus caucasicus 26S ribosomal RNA gene, c... 86 1e-14
285gb|AY260035.1| Fendlerella utahensis 26S ribosomal RNA gene, com... 86 1e-14
286gb|AY260032.1| Hydrangea arborescens 26S ribosomal RNA gene, com... 86 1e-14
287gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, comp... 86 1e-14
288gb|AY260026.1| Hydrostachys angustisecta 26S ribosomal RNA gene,... 86 1e-14
289gb|AY260024.1| Hydrostachys polymorpha 26S ribosomal RNA gene, c... 86 1e-14
290gb|AY260018.1| Nyssa sylvatica 26S ribosomal RNA gene, complete ... 86 1e-14
291gb|AY260017.1| Mastixia eugenioides 26S ribosomal RNA gene, comp... 86 1e-14
292gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, comple... 86 1e-14
293gb|AY260015.1| Mastixia caudatilimba 26S ribosomal RNA gene, com... 86 1e-14
294gb|AY260014.1| Diplopanax stachyanthus 26S ribosomal RNA gene, c... 86 1e-14
295gb|AY260013.1| Davidia involucrata 26S ribosomal RNA gene, compl... 86 1e-14
296gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete... 86 1e-14
297gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet... 86 1e-14
298gb|AY260010.1| Camptotheca acuminata 26S ribosomal RNA gene, com... 86 1e-14
299gb|AY260009.1| Alangium chinense 26S ribosomal RNA gene, complet... 86 1e-14
300gb|AY260008.1| Alangium chinense 26S ribosomal RNA gene, complet... 86 1e-14
301gb|AY260007.1| Alangium kurzii 26S ribosomal RNA gene, complete ... 86 1e-14
302gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, parti... 86 1e-14
303gb|AY292913.1| Spathiphyllum sp. YLQ-2003 26S ribosomal RNA gene... 86 1e-14
304gb|AY292912.1| Pleea tenuifolia 26S ribosomal RNA gene, partial ... 86 1e-14
305gb|AY292910.1| Sabia sp. YLQ-2003 26S ribosomal RNA gene, partia... 86 1e-14
306gb|AY292909.1| Platanus sp. YLQ-2003 26S ribosomal RNA gene, par... 86 1e-14
307gb|AY292908.1| Nelumbo sp. YLQ-2003 26S ribosomal RNA gene, part... 86 1e-14
308gb|AY292907.1| Ranunculus sp. YLQ-2003 26S ribosomal RNA gene, p... 86 1e-14
309gb|AY292906.1| Dicentra sp. YLQ-2003 26S ribosomal RNA gene, par... 86 1e-14
310gb|AY292905.1| Euptelea sp. YLQ-2003 26S ribosomal RNA gene, par... 86 1e-14
311gb|AY292903.1| Cabomba sp. YLQ-2003 26S ribosomal RNA gene, part... 86 1e-14
312gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, parti... 86 1e-14
313gb|AY292899.1| Aristolochia sp. YLQ-2003 26S ribosomal RNA gene,... 86 1e-14
314gb|AY292894.1| Hernandia sp. YLQ-2003 26S ribosomal RNA gene, pa... 86 1e-14
315gb|AY292893.1| Atherosperma moschatum 26S ribosomal RNA gene, pa... 86 1e-14
316gb|AY292892.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 86 1e-14
317gb|AY292891.1| Hedycarya sp. YLQ-2003 26S ribosomal RNA gene, pa... 86 1e-14
318gb|AY292890.1| Calycanthus sp. YLQ-2003 26S ribosomal RNA gene, ... 86 1e-14
319gb|AY292888.1| Chloranthus sp. YLQ-2003 26S ribosomal RNA gene, ... 86 1e-14
320gb|AY292887.1| Amborella trichopoda 26S ribosomal RNA gene, part... 86 1e-14
321gb|AY292884.1| Canella winterana 26S ribosomal RNA gene, partial... 86 1e-14
322gb|AY292882.1| Drimys sp. YLQ-2003 26S ribosomal RNA gene, parti... 86 1e-14
323gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, part... 86 1e-14
324gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, ... 86 1e-14
325gb|AY292879.1| Liriodendron sp. YLQ-2003 26S ribosomal RNA gene,... 86 1e-14
326gb|AY292878.1| Magnolia sp. YLQ-2003 26S ribosomal RNA gene, par... 86 1e-14
327gb|AF419999.1| Closterium spinosporum var. crassum 26S ribosomal... 86 1e-14
328gb|AF419998.1| Closterium selenastrum 26S ribosomal RNA gene, pa... 86 1e-14
329gb|AF419996.1| Closterium calosporum var. himalayense 26S riboso... 86 1e-14
330gb|AF419994.1| Closterium calosporum var. galiciense 26S ribosom... 86 1e-14
331gb|AF419990.1| Closterium spinosporum var. spinosporum 26S ribos... 86 1e-14
332gb|AF419988.1| Closterium spinosporum var. ryukyuense 26S riboso... 86 1e-14
333gb|AF419986.1| Closterium spinosporum var. malaysiense 26S ribos... 86 1e-14
334gb|AF419983.1| Closterium calosporum var. calosporum 26S ribosom... 86 1e-14
335gb|DQ108480.1| Corchorus olitorius SSR marker J-77-M13F genomic ... 86 1e-14
336gb|AY090986.1| Arabidopsis thaliana At3g41950 mRNA sequence 86 1e-14
337gb|AC006837.16| Arabidopsis thaliana chromosome 2 BAC F23H14 gen... 86 1e-14
338gb|AF274671.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 86 1e-14
339gb|AF274670.1| Tetracentron sinense 26S ribosomal RNA gene, comp... 86 1e-14
340gb|AF274668.1| Sullivantia oregana 26S ribosomal RNA gene, compl... 86 1e-14
341gb|AF274667.1| Sedum nudum 26S ribosomal RNA gene, complete sequ... 86 1e-14
342gb|AF274666.1| Saxifraga integrifolia 26S ribosomal RNA gene, co... 86 1e-14
343gb|AF274665.1| Ribes aureum 26S ribosomal RNA gene, complete seq... 86 1e-14
344gb|AF274664.1| Rhodoleia championii 26S ribosomal RNA gene, comp... 86 1e-14
345gb|AF274663.1| Pterostemon rotundifolius 26S ribosomal RNA gene,... 86 1e-14
346gb|AF274662.1| Platanus occidentalis 26S ribosomal RNA gene, com... 86 1e-14
347gb|AF274661.1| Penthorum sedoides 26S ribosomal RNA gene, comple... 86 1e-14
348gb|AF274656.1| Mytilaria laosensis 26S ribosomal RNA gene, compl... 86 1e-14
349gb|AF274654.1| Liquidambar styraciflua 26S ribosomal RNA gene, c... 86 1e-14
350gb|AF274653.1| Leea guineensis 26S ribosomal RNA gene, complete ... 86 1e-14
351gb|AF274652.1| Lambertia inermis 26S ribosomal RNA gene, complet... 86 1e-14
352gb|AF274651.1| Kalanchoe daigremontiana 26S ribosomal RNA gene, ... 86 1e-14
353gb|AF274650.1| Itea virginica 26S ribosomal RNA gene, complete s... 86 1e-14
354gb|AF274649.1| Heuchera micrantha 26S ribosomal RNA gene, comple... 86 1e-14
355gb|AF274647.1| Exbucklandia populnea 26S ribosomal RNA gene, com... 86 1e-14
356gb|AF274646.1| Dudleya viscida 26S ribosomal RNA gene, complete ... 86 1e-14
357gb|AF274645.1| Disanthus cercidifolius 26S ribosomal RNA gene, c... 86 1e-14
358gb|AF274644.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 86 1e-14
359gb|AF274642.1| Corylopsis sinensis var. calvescens 26S ribosomal... 86 1e-14
360gb|AF274641.1| Chrysosplenium iowense 26S ribosomal RNA gene, co... 86 1e-14
361gb|AF274640.1| Choristylis rhamnoides 26S ribosomal RNA gene, co... 86 1e-14
362gb|AF274639.1| Cercidiphyllum japonicum 26S ribosomal RNA gene, ... 86 1e-14
363gb|AF274638.1| Boykinia rotundifolia 26S ribosomal RNA gene, com... 86 1e-14
364gb|AF274637.1| Aphanopetalum resinosum 26S ribosomal RNA gene, c... 86 1e-14
365gb|DQ400572.1| Soyauxia talbotii voucher Cheek 10617 (K) 26S rib... 86 1e-14
366gb|DQ400571.1| Peridiscus lucidus voucher Soares 205 26S ribosom... 86 1e-14
367gb|AF297545.1|AF297545 Nyssa ogeche 26S ribosomal RNA gene, part... 86 1e-14
368gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, ... 86 1e-14
369gb|AF297540.1|AF297540 Cornus walteri 26S ribosomal RNA gene, pa... 86 1e-14
370gb|AF297539.1|AF297539 Cornus oblonga 26S ribosomal RNA gene, pa... 86 1e-14
371gb|AF297537.1|AF297537 Cornus sessilis 26S ribosomal RNA gene, p... 86 1e-14
372gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, part... 86 1e-14
373gb|DQ008663.1| Metasequoia glyptostroboides 26S ribosomal RNA ge... 86 1e-14
374gb|DQ008660.1| Nuphar sp. Qiu M114 26S ribosomal RNA gene, parti... 86 1e-14
375gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, parti... 86 1e-14
376gb|DQ008657.1| Kadsura japonica 26S ribosomal RNA gene, partial ... 86 1e-14
377gb|DQ008656.1| Ascarina rubricaulis 26S ribosomal RNA gene, part... 86 1e-14
378gb|DQ008654.1| Acorus calamus 26S ribosomal RNA gene, partial se... 86 1e-14
379gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, part... 86 1e-14
380gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, ... 86 1e-14
381gb|DQ008647.1| Croomia pauciflora 26S ribosomal RNA gene, partia... 86 1e-14
382gb|DQ008646.1| Asparagus officinalis 26S ribosomal RNA gene, par... 86 1e-14
383gb|DQ008645.1| Takhtajania perrieri 26S ribosomal RNA gene, part... 86 1e-14
384gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial seq... 86 1e-14
385gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial ... 86 1e-14
386gb|DQ008642.1| Thottea tomentosa 26S ribosomal RNA gene, partial... 86 1e-14
387gb|DQ008639.1| Anemopsis californica 26S ribosomal RNA gene, par... 86 1e-14
388gb|DQ008634.1| Annona muricata 26S ribosomal RNA gene, partial s... 86 1e-14
389gb|DQ008633.1| Idiospermum australiense 26S ribosomal RNA gene, ... 86 1e-14
390gb|DQ008630.1| Doryphora sassafras 26S ribosomal RNA gene, parti... 86 1e-14
391gb|DQ008629.1| Daphnandra micrantha 26S ribosomal RNA gene, part... 86 1e-14
392gb|DQ008627.1| Cryptocarya meissneriana 26S ribosomal RNA gene, ... 86 1e-14
393gb|DQ008625.1| Cinnamomum camphora 26S ribosomal RNA gene, parti... 86 1e-14
394gb|DQ008624.1| Gyrocarpus americanus 26S ribosomal RNA gene, par... 86 1e-14
395gb|DQ008621.1| Sanguinaria canadensis 26S ribosomal RNA gene, pa... 86 1e-14
396gb|DQ008620.1| Sargentodoxa cuneata 26S ribosomal RNA gene, part... 86 1e-14
397gb|DQ008619.1| Akebia quinata 26S ribosomal RNA gene, partial se... 86 1e-14
398gb|DQ008618.1| Lardizabala biternata 26S ribosomal RNA gene, par... 86 1e-14
399gb|DQ008617.1| Cocculus trilobus 26S ribosomal RNA gene, partial... 86 1e-14
400gb|DQ008615.1| Xanthorhiza simplicissima 26S ribosomal RNA gene,... 86 1e-14
401gb|DQ008613.1| Mahonia bealei 26S ribosomal RNA gene, partial se... 86 1e-14
402gb|DQ008612.1| Grevillea banksii 26S ribosomal RNA gene, partial... 86 1e-14
403gb|DQ008610.1| Petrophile canescens 26S ribosomal RNA gene, part... 86 1e-14
404gb|DQ008609.1| Meliosma squamulata 26S ribosomal RNA gene, parti... 86 1e-14
405gb|DQ008607.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 86 1e-14
406gb|AF364907.1|AF364907 Picea abies 25S ribosomal RNA, partial se... 86 1e-14
407gb|AF479245.1| Chloranthus japonicus 26S ribosomal RNA gene, com... 86 1e-14
408gb|AF479244.1| Magnolia denudata 26S ribosomal RNA gene, complet... 86 1e-14
409gb|AF479243.1| Roussea simplex 26S ribosomal RNA gene, complete ... 86 1e-14
410gb|AF479242.1| Symphoricarpos albus 26S ribosomal RNA gene, comp... 86 1e-14
411gb|AF479240.1| Lythrum salicaria 26S ribosomal RNA gene, complet... 86 1e-14
412gb|AF479239.1| Cabomba caroliniana 26S ribosomal RNA gene, compl... 86 1e-14
413gb|AF479238.1| Amborella trichopoda 26S ribosomal RNA gene, comp... 86 1e-14
414gb|AF479237.1| Petroselinum crispum 26S ribosomal RNA gene, comp... 86 1e-14
415gb|AF479236.1| Rhodoleia sp. DES-2002 26S ribosomal RNA gene, co... 86 1e-14
416gb|AF479234.1| Thymelaea hirsuta 26S ribosomal RNA gene, complet... 86 1e-14
417gb|AF479233.1| Polygala cruciata 26S ribosomal RNA gene, complet... 86 1e-14
418gb|AF479231.1| Dipsacus sativus 26S ribosomal RNA gene, complete... 86 1e-14
419gb|AF479229.1| Bixa orellana 26S ribosomal RNA gene, complete se... 86 1e-14
420gb|AF479225.1| Neurada procumbens 26S ribosomal RNA gene, comple... 86 1e-14
421gb|AF479220.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 86 1e-14
422gb|AF479219.1| Exbucklandia populnea 26S ribosomal RNA gene, com... 86 1e-14
423gb|AF479218.1| Disanthus cercidifolia 26S ribosomal RNA gene, co... 86 1e-14
424gb|AF479217.1| Liquidambar styraciflua 26S ribosomal RNA gene, c... 86 1e-14
425gb|AF479216.1| Itea virginica 26S ribosomal RNA gene, complete s... 86 1e-14
426gb|AF479215.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 86 1e-14
427gb|AF479214.1| Ribes speciosum 26S ribosomal RNA gene, complete ... 86 1e-14
428gb|AF479213.1| Corylopsis pauciflora 26S ribosomal RNA gene, com... 86 1e-14
429gb|AF479212.1| Sullivantia oregana 26S ribosomal RNA gene, compl... 86 1e-14
430gb|AF479211.1| Heuchera micrantha 26S ribosomal RNA gene, comple... 86 1e-14
431gb|AF479206.1| Lambertia inermis 26S ribosomal RNA gene, complet... 86 1e-14
432gb|AF479205.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 86 1e-14
433gb|AF479203.1| Ilex opaca 26S ribosomal RNA gene, complete sequence 86 1e-14
434gb|AF479201.1| Gonocaryum litorale 26S ribosomal RNA gene, compl... 86 1e-14
435gb|AF479200.1| Abelia triflora 26S ribosomal RNA gene, complete ... 86 1e-14
436gb|AF479199.1| Valeriana officinalis 26S ribosomal RNA gene, com... 86 1e-14
437gb|AF479198.1| Scabiosa sp. Albach 39 26S ribosomal RNA gene, co... 86 1e-14
438gb|AF479197.1| Griselinia lucida 26S ribosomal RNA gene, complet... 86 1e-14
439gb|AF479195.1| Apium graveolens 26S ribosomal RNA gene, complete... 86 1e-14
440gb|AF479194.1| Hedera helix 26S ribosomal RNA gene, complete seq... 86 1e-14
441gb|AF479193.1| Panax quinquefolius 26S ribosomal RNA gene, compl... 86 1e-14
442gb|AF479191.1| Campanula trachelium 26S ribosomal RNA gene, comp... 86 1e-14
443gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, compl... 86 1e-14
444gb|AF479189.1| Donatia sp. Morgan 2142 26S ribosomal RNA gene, c... 86 1e-14
445gb|AF479188.1| Phelline comosa 26S ribosomal RNA gene, partial s... 86 1e-14
446gb|AF479187.1| Corokia cotoneaster 26S ribosomal RNA gene, compl... 86 1e-14
447gb|AF479185.1| Menyanthes trifoliata 26S ribosomal RNA gene, com... 86 1e-14
448gb|AF479184.1| Boopis graminea 26S ribosomal RNA gene, complete ... 86 1e-14
449gb|AF479182.1| Vahlia capensis 26S ribosomal RNA gene, complete ... 86 1e-14
450gb|AF479178.1| Nerium oleander 26S ribosomal RNA gene, partial s... 86 1e-14
451gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete s... 86 1e-14
452gb|AF479176.1| Convolvulus arvensis 26S ribosomal RNA gene, part... 86 1e-14
453gb|AF479175.1| Montinia caryophyllacea 26S ribosomal RNA gene, c... 86 1e-14
454gb|AF479171.1| Olea europaea 26S ribosomal RNA gene, partial seq... 86 1e-14
455gb|AF479170.1| Myoporum mauritianum 26S ribosomal RNA gene, comp... 86 1e-14
456gb|AF479164.1| Rhynchoglossum notonianum 26S ribosomal RNA gene,... 86 1e-14
457gb|AF479160.1| Manilkara zapota 26S ribosomal RNA gene, complete... 86 1e-14
458gb|AF479159.1| Fouquieria columnaris 26S ribosomal RNA gene, com... 86 1e-14
459gb|AF479157.1| Halesia diptera 26S ribosomal RNA gene, complete ... 86 1e-14
460gb|AF479156.1| Styrax japonicus 26S ribosomal RNA gene, complete... 86 1e-14
461gb|AF479155.1| Gilia capitata 26S ribosomal RNA gene, complete s... 86 1e-14
462gb|AF479154.1| Impatiens repens 26S ribosomal RNA gene, complete... 86 1e-14
463gb|AF479153.1| Tetramerista sp. Coode 7925 26S ribosomal RNA gen... 86 1e-14
464gb|AF479152.1| Maesa myrsinoides 26S ribosomal RNA gene, partial... 86 1e-14
465gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, com... 86 1e-14
466gb|AF479149.1| Anagallis tenella 26S ribosomal RNA gene, complet... 86 1e-14
467gb|AF479148.1| Clarkia xantiana 26S ribosomal RNA gene, complete... 86 1e-14
468gb|AF479147.1| Terminalia boivinii 26S ribosomal RNA gene, compl... 86 1e-14
469gb|AF479146.1| Tapiscia sinensis 26S ribosomal RNA gene, complet... 86 1e-14
470gb|AF479145.1| Carica papaya 26S ribosomal RNA gene, complete se... 86 1e-14
471gb|AF479144.1| Tropaeolum tricolor 26S ribosomal RNA gene, compl... 86 1e-14
472gb|AF479143.1| Floerkea proserpinacoides 26S ribosomal RNA gene,... 86 1e-14
473gb|AF479141.1| Byblis gigantea 26S ribosomal RNA gene, complete ... 86 1e-14
474gb|AF479139.1| Cupaniopsis anacardioides 26S ribosomal RNA gene,... 86 1e-14
475gb|AF479138.1| Aesculus pavia 26S ribosomal RNA gene, complete s... 86 1e-14
476gb|AF479137.1| Sterculia apetala 26S ribosomal RNA gene, complet... 86 1e-14
477gb|AF479136.1| Durio zibethinus 26S ribosomal RNA gene, complete... 86 1e-14
478gb|AF479135.1| Ochroma pyramidale 26S ribosomal RNA gene, comple... 86 1e-14
479gb|AF479134.1| Bombax ceiba 26S ribosomal RNA gene, complete seq... 86 1e-14
480gb|AF479133.1| Staphylea trifolia 26S ribosomal RNA gene, comple... 86 1e-14
481gb|AF479132.1| Aphloia theiformis 26S ribosomal RNA gene, comple... 86 1e-14
482gb|AF479131.1| Crossosoma californicum 26S ribosomal RNA gene, p... 86 1e-14
483gb|AF479130.1| Viviania marifolia 26S ribosomal RNA gene, comple... 86 1e-14
484gb|AF479129.1| Geranium sanguineum 26S ribosomal RNA gene, compl... 86 1e-14
485gb|AF479128.1| Elaeocarpus sphaericus 26S ribosomal RNA gene, pa... 86 1e-14
486gb|AF479127.1| Averrhoa carambola 26S ribosomal RNA gene, comple... 86 1e-14
487gb|AF479126.1| Sloanea berteriana 26S ribosomal RNA gene, comple... 86 1e-14
488gb|AF479125.1| Euphorbia polychroma 26S ribosomal RNA gene, comp... 86 1e-14
489gb|AF479124.1| Reinwardtia indica 26S ribosomal RNA gene, partia... 86 1e-14
490gb|AF479123.1| Androstachys johnsonii 26S ribosomal RNA gene, pa... 86 1e-14
491gb|AF479120.1| Medusagyne oppositifolia 26S ribosomal RNA gene, ... 86 1e-14
492gb|AF479118.1| Populus tremuloides 26S ribosomal RNA gene, compl... 86 1e-14
493gb|AF479117.1| Idesia polycarpa 26S ribosomal RNA gene, complete... 86 1e-14
494gb|AF479116.1| Krameria ixine 26S ribosomal RNA gene, complete s... 86 1e-14
495gb|AF479115.1| Afrostyrax sp. Cheek 5007 26S ribosomal RNA gene,... 86 1e-14
496gb|AF479114.1| Stackhousia minima 26S ribosomal RNA gene, comple... 86 1e-14
497gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete ... 86 1e-14
498gb|AF479112.1| Brexia madagascariensis 26S ribosomal RNA gene, c... 86 1e-14
499gb|AF479111.1| Hippocratea barbata 26S ribosomal RNA gene, compl... 86 1e-14
500gb|AF479108.1| Cucurbita pepo 26S ribosomal RNA gene, complete s... 86 1e-14

>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
             fosmid clone:OSJNOa109J19
          Length = 30481

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23281 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 23335



 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15353 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 15407



 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7425 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 7479



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                       
Query: 2        tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28734230 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 28734284



to top

>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0013K10
          Length = 129118

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30937 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 30991



 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23009 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 23063



 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15081 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 15135



 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 7153 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 7207



to top

>dbj|AP004778.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0459B01
          Length = 163087

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 50803 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 50857



to top

>dbj|AK105002.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-005-E07, full
           insert sequence
          Length = 1568

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 295



to top

>dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-A02, full
            insert sequence
          Length = 2780

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1250 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1304



to top

>dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-H02, full
            insert sequence
          Length = 3078

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1363 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1417



to top

>dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-G12, full
            insert sequence
          Length = 2472

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1363 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1417



to top

>dbj|AK119873.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-D07, full
           insert sequence
          Length = 2841

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 294 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 348



to top

>dbj|AK119652.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G12, full
           insert sequence
          Length = 1890

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 549



to top

>dbj|AK111221.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-C03, full
           insert sequence
          Length = 1815

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 666 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 720



to top

>dbj|AK111213.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-A12, full
           insert sequence
          Length = 2495

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 692 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 746



to top

>dbj|AK110460.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-F10, full
           insert sequence
          Length = 2397

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 415



to top

>dbj|AK110456.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-F02, full
            insert sequence
          Length = 2806

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 980  tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1034



to top

>dbj|AK110438.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D01, full
           insert sequence
          Length = 2305

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 767 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 821



to top

>dbj|AK110417.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-H07, full
            insert sequence
          Length = 2845

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1357 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1411



to top

>dbj|AK110408.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-G09, full
           insert sequence
          Length = 3620

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 752 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 806



to top

>dbj|AK110378.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-C09, full
            insert sequence
          Length = 2695

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1006 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1060



to top

>dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-F03, full
            insert sequence
          Length = 2885

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1229 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1283



to top

>dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-C07, full
            insert sequence
          Length = 2440

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1345 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1399



to top

>dbj|AK110295.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-H01, full
           insert sequence
          Length = 2802

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 673 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 727



to top

>dbj|AK110074.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-160-F02, full
            insert sequence
          Length = 3099

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 996  tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1050



to top

>dbj|AK109985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-E01, full
           insert sequence
          Length = 1802

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 666 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 720



to top

>dbj|AK108869.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-152-C06, full
           insert sequence
          Length = 2179

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 786 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 840



to top

>dbj|AK107285.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-B05, full
           insert sequence
          Length = 1586

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 581



to top

>dbj|AK106985.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-H12, full
           insert sequence
          Length = 1541

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 658 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 712



to top

>dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A08, full
            insert sequence
          Length = 1640

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1076 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1130



to top

>dbj|AK106431.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-C05, full
            insert sequence
          Length = 1801

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 979  tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1033



to top

>dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-F01, full
            insert sequence
          Length = 2644

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1310 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1364



to top

>dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H11, full
            insert sequence
          Length = 1765

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1248 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1302



to top

>dbj|AK064546.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-112-B04, full
           insert sequence
          Length = 1471

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 163 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 217



to top

>dbj|AK063163.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-B01, full
           insert sequence
          Length = 2669

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 760 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 814



to top

>dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-B06, full
            insert sequence
          Length = 1742

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1076 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1130



to top

>dbj|AK058406.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-B11, full
            insert sequence
          Length = 1207

 Score =  109 bits (55), Expect = 7e-22
 Identities = 55/55 (100%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1030 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1084



to top

>gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial sequence
          Length = 3341

 Score =  107 bits (54), Expect = 3e-21
 Identities = 54/54 (100%)
 Strand = Plus / Plus

                                                                  
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtg 55
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2123 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtg 2176



to top

>dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G06, full
            insert sequence
          Length = 2893

 Score =  107 bits (54), Expect = 3e-21
 Identities = 54/54 (100%)
 Strand = Plus / Plus

                                                                  
Query: 3    gtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1578 gtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 1631



to top

>dbj|AK107604.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-131-B09,
          full insert sequence
          Length = 1366

 Score =  105 bits (53), Expect = 1e-20
 Identities = 53/53 (100%)
 Strand = Plus / Plus

                                                               
Query: 4  tttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  tttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 53



to top

>gb|AY095452.1| Austrobaileya scandens 26S ribosomal RNA gene, partial sequence
          Length = 2979

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2052 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctgacgcaatgtga 2106



to top

>gb|AY292886.1| Austrobaileya scandens 26S ribosomal RNA gene, partial sequence
          Length = 2979

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 2052 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctgacgcaatgtga 2106



to top

>gb|DQ008655.1| Sarcandra chloranthoides 26S ribosomal RNA gene, partial sequence
          Length = 3078

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1930 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctcacgcaatgtga 1984



to top

>gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, complete sequence
          Length = 3200

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1965 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctaacgcaatgtga 2019



to top

>gb|AF479097.1| Tetracera asiatica 26S ribosomal RNA gene, complete sequence
          Length = 3052

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 2128 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctgacgcaatgtga 2182



to top

>dbj|AK111208.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-G09, full
           insert sequence
          Length = 2395

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 681 tgtttaattaaaacaaagcattgcggtggtcctcgcggatgctgacgcaatgtga 735



to top

>dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-A01, full
            insert sequence
          Length = 3553

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1244 tgtttaattaaaacaaagcattgcgatggtcctcgcagatgctgacgcaatgtga 1298



to top

>gb|M37231.1|RYENORR1 Rye 26S rRNA 3' end and 18S rRNA, 5' end
          Length = 4507

 Score =  101 bits (51), Expect = 2e-19
 Identities = 54/55 (98%)
 Strand = Plus / Plus

                                                                 
Query: 2  tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 35 tgtttaattaaaacaaaacattgcgatggtcctcgcggatgctgacgcaatgtga 89



to top

>emb|AL663020.4|OSJN00220 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0049H08,
             complete sequence
          Length = 186642

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                                  
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgt 54
             ||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 88390 tgtttaattaaaataaagcattgcgatggtcctcgcggatgctgacgcaatgt 88442



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 52/53 (98%)
 Strand = Plus / Plus

                                                                     
Query: 2        tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgt 54
                ||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 17716015 tgtttaattaaaataaagcattgcgatggtcctcgcggatgctgacgcaatgt 17716067



to top

>dbj|AK105013.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-B11,
          full insert sequence
          Length = 1262

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                           
Query: 8  attaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  attaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 49



to top

>dbj|AK061005.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-A03,
          full insert sequence
          Length = 900

 Score = 97.6 bits (49), Expect = 3e-18
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                           
Query: 8  attaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  attaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 49



to top

>gb|BT018529.1| Zea mays clone EL01N0433D12.d mRNA sequence
          Length = 1172

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||| |||||||| |||||||||||||||||||
Sbjct: 513 tgtttaattaaaacaaagcattgcgacggtcctcgaggatgctgacgcaatgtga 567



to top

>gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2176



to top

>gb|AF389258.1| Tinospora caffra 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 2176



to top

>gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2174



to top

>gb|AF389245.1| Kingdonia uniflora 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2172



to top

>gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partial sequence
          Length = 3319

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2103 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2157



to top

>gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2155



to top

>gb|AY189032.1| Anginon rugosum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2153



to top

>gb|AY428812.1| Quercus suber 26S large subunit ribosomal RNA gene, complete sequence
          Length = 3399

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2144 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 2198



to top

>gb|AY342317.1| Marchantia polymorpha chromosome X 5S ribosomal RNA and 18S ribosomal
             RNA genes, internal transcribed spacer 1, 5.8S ribosomal
             RNA gene, internal transcribed spacer 2, and 26S ribosomal
             RNA gene, complete sequence
          Length = 17275

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 16003 tgtttaattaaaacaaagcattgcgatggtcctcacggatgttgacgcaatgtga 16057



to top

>gb|AY095476.1| Larix sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3105

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 1910 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 1964



to top

>gb|AY095474.1| Tacca chantieri 26S ribosomal RNA gene, partial sequence
          Length = 2858

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2064 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 2118



to top

>gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3314

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccttgcggatgttgacgcaatgtga 2172



to top

>gb|AY095461.1| Hedyosmum bonplandianum 26S ribosomal RNA gene, partial sequence
          Length = 3312

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccccgcggatgcttacgcaatgtga 2172



to top

>gb|AY095460.1| Gomortega keule 26S ribosomal RNA gene, partial sequence
          Length = 3041

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2117 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 2171



to top

>gb|AY095458.1| Cinnamodendron sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3259

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2063 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctgacgcaatgtga 2117



to top

>gb|AY260031.1| Eucnide urens 26S ribosomal RNA gene, complete sequence
          Length = 3378

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2148 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2202



to top

>gb|AY260029.1| Petalonyx parryi 26S ribosomal RNA gene, complete sequence
          Length = 3386

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2147 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2201



to top

>gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3216

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2010 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2064



to top

>gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccttgcggatgttgacgcaatgtga 2172



to top

>gb|AY292889.1| Hedyosmum sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3327

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccccgcggatgcttacgcaatgtga 2172



to top

>gb|AY292885.1| Cinnamodendron sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3274

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2063 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctgacgcaatgtga 2117



to top

>gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial sequence
          Length = 3306

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2115 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2169



to top

>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence
          Length = 10658

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||| |||||||| |||||||||||||||||||
Sbjct: 9369 tgtttaattaaaacaaagcattgcgacggtcctcgaggatgctgacgcaatgtga 9423



to top

>gb|AF274672.1| Vitis aestivalis 26S ribosomal RNA gene, complete sequence
          Length = 3368

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2139 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2193



to top

>gb|AF274660.1| Paeonia tenuifolia 26S ribosomal RNA gene, complete sequence
          Length = 3367

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2137 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2191



to top

>gb|AF274659.1| Paeonia suffruticosa 26S ribosomal RNA gene, complete sequence
          Length = 3369

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2139 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2193



to top

>gb|AF274658.1| Paeonia californica 26S ribosomal RNA gene, complete sequence
          Length = 3369

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2139 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2193



to top

>gb|AF274636.1| Altingia excelsa 26S ribosomal RNA gene, complete sequence
          Length = 3366

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2136 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2190



to top

>gb|AY920800.1| Blackfordia virginica large subunit 28S ribosomal RNA gene, partial
            sequence
          Length = 3286

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||
Sbjct: 2293 tgtttaattaaaacaaagcattgcgatggtcttcgcggatgttgacgcaatgtga 2347



to top

>gb|AY920799.1| Aequorea victoria large subunit 28S ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||
Sbjct: 2298 tgtttaattaaaacaaagcattgcgatggtcttcgcggatgttgacgcaatgtga 2352



to top

>gb|DQ008667.1| Cycas revoluta 26S ribosomal RNA gene, partial sequence
          Length = 3314

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctgacgcaatgtga 2154



to top

>gb|DQ008664.1| Podocarpus macrophyllus 26S ribosomal RNA gene, partial sequence
          Length = 3322

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2085 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2139



to top

>gb|DQ008649.1| Potamogeton berchtoldii 26S ribosomal RNA gene, partial sequence
          Length = 3236

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2080 tgtttaattaaaacaaagcattgcgatggtccttgcggatgcttacgcaatgtga 2134



to top

>gb|DQ008648.1| Carludovica palmata 26S ribosomal RNA gene, partial sequence
          Length = 2401

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 1484 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 1538



to top

>gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partial sequence
          Length = 2357

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 1442 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 1496



to top

>gb|DQ008616.1| Cissampelos pareira 26S ribosomal RNA gene, partial sequence
          Length = 2486

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 1485 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 1539



to top

>gb|AF479247.1| Morella cerifera 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2095 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2149



to top

>gb|AF479227.1| Greyia radlkoferi 26S ribosomal RNA gene, complete sequence
          Length = 3326

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||
Sbjct: 2087 tgtttaattaaaacaaagcattgcgatggtcctcgaggatgctaacgcaatgtga 2141



to top

>gb|AF479226.1| Hedyosmum arborescens 26S ribosomal RNA gene, complete sequence
          Length = 3327

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccccgcggatgcttacgcaatgtga 2172



to top

>gb|AF479224.1| Saxifraga mertensiana 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2134 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2188



to top

>gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene, partial sequence
          Length = 2775

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 2131 tgtttaattaaaacaaagcattgcaatggtccttgcggatgctgacgcaatgtga 2185



to top

>gb|AF479208.1| Altingia excelsa 26S ribosomal RNA gene, complete sequence
          Length = 3359

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2133 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2187



to top

>gb|AF479207.1| Vitis aestivalis 26S ribosomal RNA gene, complete sequence
          Length = 3360

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2136 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2190



to top

>gb|AF479204.1| Gunnera hamiltonii 26S ribosomal RNA gene, complete sequence
          Length = 3335

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2174



to top

>gb|AF479202.1| Irvingbaileya sp. Plunkett 1510 26S ribosomal RNA gene, complete
            sequence
          Length = 3140

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2109 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2163



to top

>gb|AF479140.1| Capparis sandwichiana 26S ribosomal RNA gene, complete sequence
          Length = 3361

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2130 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctaacgcaatgtga 2184



to top

>gb|AF479110.1| Corynocarpus laevigatus 26S ribosomal RNA gene, complete sequence
          Length = 3370

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2134 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2188



to top

>gb|AF479109.1| Begonia metallica x Begonia sanguinea 26S ribosomal RNA gene,
            complete sequence
          Length = 3168

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2130 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2184



to top

>gb|AF479104.1| Securidaca diversifolia 26S ribosomal RNA gene, partial sequence
          Length = 1581

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 347 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 401



to top

>gb|AF479098.1| Celtis yunnanensis 26S ribosomal RNA gene, complete sequence
          Length = 3344

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2131 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2185



to top

>gb|AF479096.1| Dillenia retusa 26S ribosomal RNA gene, partial sequence
          Length = 2967

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2140 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2194



to top

>gb|AF479083.1| Tamarix pentandra 26S ribosomal RNA gene, complete sequence
          Length = 3348

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctaacgcaatgtga 2175



to top

>dbj|AK062902.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-F05,
          full insert sequence
          Length = 780

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 47/47 (100%)
 Strand = Plus / Plus

                                                         
Query: 10 taaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  taaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 47



to top

>gb|AF036498.1|AF036498 Saxifraga mertensiana large subunit 26S ribosomal RNA gene, partial
            sequence
          Length = 3365

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2134 tgtttaattaaaacaaagcattgcgatggtccttgcggatgctcacgcaatgtga 2188



to top

>gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA gene, partial
            sequence
          Length = 3213

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||||| |||||||||||
Sbjct: 2153 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatgtga 2207



to top

>gb|AF036488.1|AF036488 Gnetum gnemon large subunit 26S ribosomal RNA gene, partial sequence
          Length = 3414

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||||
Sbjct: 2173 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgtga 2227



to top

>emb|AJ271022.1|BRO271022 Buccegia romanica 25S rRNA gene for 25S ribosomal RNA
          Length = 3590

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 2349 tgtttaattaaaacaaagcattgcgatggtcctcacggatgttgacgcaatgtga 2403



to top

>gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene
          Length = 3377

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 54/55 (98%), Gaps = 1/55 (1%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtcctcgcggatgc-gacgcaatgtga 2175



to top

>dbj|AB021684.1| Marchantia polymorpha genes for 26S rRNA, 5S rRNA, 18S rRNA, 5.8S rRNA
             and 26S rRNA
          Length = 17477

 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                    
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
             |||||||||||||||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 16839 tgtttaattaaaacaaagcattgcgatggtcctcacggatgttgacgcaatgtga 16893



 Score = 93.7 bits (47), Expect = 4e-17
 Identities = 53/55 (96%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           |||||||||||||||||||||||||||||||||| |||||| |||||||||||||
Sbjct: 736 tgtttaattaaaacaaagcattgcgatggtcctcacggatgttgacgcaatgtga 790



to top

>gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||
Sbjct: 2102 tgtttaattwaaacaaagcattgcgatggtccttgcggatgctaacgcaatgtga 2156



to top

>gb|AY260028.1| Petalonyx nitidus 26S ribosomal RNA gene, complete sequence
          Length = 3390

 Score = 89.7 bits (45), Expect = 6e-16
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                 
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgt 54
            ||||||||||||||||||||||||||||||||  |||||||||||||||||||
Sbjct: 2150 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctgacgcaatgt 2202



to top

>gb|AY095475.1| Ginkgo biloba 26S ribosomal RNA gene, partial sequence
          Length = 3309

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 54/56 (96%), Gaps = 1/56 (1%)
 Strand = Plus / Plus

                                                                    
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctc-gcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| | |||||||||||||||||||||
Sbjct: 2113 tgtttaattaaaacaaagcattgcgatggtcccctgcggatgctgacgcaatgtga 2168



to top

>gb|AF479241.1| Swietenia macrophylla 26S ribosomal RNA gene, complete sequence
          Length = 3091

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 50/52 (96%)
 Strand = Plus / Plus

                                                                
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatg 53
            |||||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 2102 tgtttaattaaaacaaagcattgcgatggtccccgcggatgctcacgcaatg 2153



to top

>gb|AF479230.1| Oxalis dillenii 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2095 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctnacgcaatgtga 2149



to top

>dbj|AK063412.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-B04,
          full insert sequence
          Length = 1686

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 44/44 (100%)
 Strand = Plus / Plus

                                                      
Query: 13 aacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  aacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 44



to top

>dbj|AP004494.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09I17, TM0026,
             complete sequence
          Length = 103129

 Score = 87.7 bits (44), Expect = 2e-15
 Identities = 50/52 (96%)
 Strand = Plus / Minus

                                                                 
Query: 2     tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatg 53
             ||||||||||||||||||||||||||||||||| ||||||| ||||||||||
Sbjct: 23538 tgtttaattaaaacaaagcattgcgatggtccttgcggatgttgacgcaatg 23487



to top

>gb|DQ287987.1| Abutilon theophrasti 26S ribosomal RNA gene, partial sequence
          Length = 672

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 436 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 490



to top

>gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2154



to top

>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2154



to top

>gb|AY563529.1| Camellia sinensis 26S ribosomal RNA gene, partial sequence
          Length = 389

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                 
Query: 2  tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
          ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 39 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 93



to top

>gb|AY555065.1| Corchorus olitorius 26S ribosomal RNA gene, partial sequence
          Length = 1010

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                  
Query: 2   tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
           ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 350 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 404



to top

>gb|AF389276.1| Sarracenia purpurea 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2175



to top

>gb|AF389275.1| Viscum album 26S ribosomal RNA gene, partial sequence
          Length = 3059

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2126 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctcacgcaatgtga 2180



to top

>gb|AF389274.1| Osyris lanceolata 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2124 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2178



to top

>gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2126 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2180



to top

>gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2128 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2182



to top

>gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2128 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2182



to top

>gb|AF389269.1| Ranunculus keniensis 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2174



to top

>gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctaacgcaatgtga 2174



to top

>gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 3344

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2128 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2182



to top

>gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2124 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2178



to top

>gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial sequence
          Length = 3341

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2123 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2177



to top

>gb|AF389259.1| Nelumbo lutea 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2123 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2177



to top

>gb|AF389257.1| Menispermum canadense 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2123 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2177



to top

>gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2176



to top

>gb|AF389254.1| Decaisnea fargesii 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2176



to top

>gb|AF389253.1| Akebia quinata 26S ribosomal RNA gene, partial sequence
          Length = 3341

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2130 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2184



to top

>gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partial sequence
          Length = 3343

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2126 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2180



to top

>gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partial sequence
          Length = 3326

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2115 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2169



to top

>gb|AF389246.1| Circaeaster agrestis 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2117 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2171



to top

>gb|AF389244.1| Pachysandra procumbens 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2119 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2173



to top

>gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AY189150.1| Petroselinum crispum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3283

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189116.1| Tupidanthus calyptratus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2096 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2150



to top

>gb|AY189115.1| Trevesia palmata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3287

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189113.1| Torricellia tiliifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3265

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189112.1| Tetraplasandra hawaiensis 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3292

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189111.1| Tetrapanax papyriferus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3286

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189110.1| Spananthe paniculata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3311

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189108.1| Schefflera arboricola 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3290

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2096 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2150



to top

>gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189103.1| Pseudopanax arboreus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3286

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189102.1| Polyscias guilfoylei 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189101.1| Platysace lanceolata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtcccggcggatgctaacgcaatgtga 2153



to top

>gb|AY189098.1| Panax quinquefolius 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189097.1| Osmoxylon novoguineense 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3300

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189093.1| Mulinum sp. Hufford s.n. 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3311

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2102 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2156



to top

>gb|AY189092.1| Mulinum ulicinum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3255

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2078 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2132



to top

>gb|AY189091.1| Mulinum spinosum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3301

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2076 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2130



to top

>gb|AY189090.1| Mulinum chillanense 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3269

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2071 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2125



to top

>gb|AY189089.1| Mulinum albovaginatum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3235

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2077 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2131



to top

>gb|AY189088.1| Motherwellia haplosciadea 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3311

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189086.1| Meryta sinclairii 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189080.1| Kalopanax pictus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3305

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||| |||||||| | |||||||||||
Sbjct: 2098 tgtttaattaaaacaaagcattgcgatggtccccgcggatgttaacgcaatgtga 2152



to top

>gb|AY189078.1| Hydrocotyle verticillata 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2155



to top

>gb|AY189077.1| Hydrocotyle modesta 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3223

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2069 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2123



to top

>gb|AY189076.1| Hydrocotyle bowlesioides 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3295

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189075.1| Huanaca acaulis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3292

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2095 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2149



to top

>gb|AY189073.1| Hedera helix 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3277

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189072.1| Gymnophyton polycephalum 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3277

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2094 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2148



to top

>gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3312

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3229

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2045 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2099



to top

>gb|AY189069.1| Fatsia japonica 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3283

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2096 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2150



to top

>gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2098 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2152



to top

>gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189066.1| Endressia castellana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189065.1| Eleutherococcus trifoliatus 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3293

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189063.1| Diplaspis hydrocotyle 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189062.1| Dickinsia hydrocotyloides 26S large subunit ribosomal RNA gene,
            partial sequence
          Length = 3282

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2098 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2152



to top

>gb|AY189060.1| Dendropanax arboreus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3283

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2097 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2151



to top

>gb|AY189058.1| Daucus carota 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3308

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189057.1| Cussonia spicata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3304

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189055.1| Cheirodendron trigynum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3291

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189052.1| Bowlesia tropaeolifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3239

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2088 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2142



to top

>gb|AY189051.1| Bowlesia incana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgcttacgcaatgtga 2153



to top

>gb|AY189048.1| Azorella trifurcata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2069 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2123



to top

>gb|AY189046.1| Azorella selago 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189045.1| Azorella monantha 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3258

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2066 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2120



to top

>gb|AY189044.1| Azorella macquariensis 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2093 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2147



to top

>gb|AY189041.1| Astrotricha pterocarpa 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3313

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2103 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2157



to top

>gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3312

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2101 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2155



to top

>gb|AY189039.1| Arthrophyllum mackeei 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189037.1| Arctopus echinatus 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189035.1| Aralia spinosa 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3295

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2100 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2154



to top

>gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3275

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2099 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2153



to top

>gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3308

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2098 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2152



to top

>gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2176



to top

>gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, partial sequence
          Length = 3304

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||  |||||||| |||||||||||
Sbjct: 2093 tgtttaattaaaacaaagcattgcgatggtccttacggatgctaacgcaatgtga 2147



to top

>gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partial sequence
          Length = 3335

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, partial sequence
          Length = 3320

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2107 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2161



to top

>gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA gene, partial
            sequence
          Length = 3330

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2117 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2171



to top

>gb|AY727967.1| Sarracenia psittacina 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            |||||||||||||||||||||||||||||||||  |||||||| |||||||||||
Sbjct: 2122 tgtttaattaaaacaaagcattgcgatggtccttacggatgctcacgcaatgtga 2176



to top

>gb|AY727966.1| Heliamphora minor 26S ribosomal RNA gene, partial sequence
          Length = 3293

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2080 tgtttaattaaaacaaagcattgcgatggtccatgcggatgctcacgcaatgtga 2134



to top

>gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partial sequence
          Length = 3264

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2053 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2107



to top

>gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2112 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2166



to top

>gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2175



to top

>gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtcccagcggatgctaacgcaatgtga 2174



to top

>gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2174



to top

>gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2172



to top

>gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2119 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2173



to top

>gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, partial sequence
          Length = 3330

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2117 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2171



to top

>gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, partial sequence
          Length = 3256

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2043 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2097



to top

>gb|AY727953.1| Eurya japonica 26S ribosomal RNA gene, partial sequence
          Length = 3262

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2049 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2103



to top

>gb|AY727952.1| Cleyera japonica 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727951.1| Napoleona sp. JS-2005 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2121 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2175



to top

>gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, partial sequence
          Length = 3258

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2045 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2099



to top

>gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2120 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2174



to top

>gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2119 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2173



to top

>gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2123 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctcacgcaatgtga 2177



to top

>gb|AY727944.1| Cobaea scandens 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 85.7 bits (43), Expect = 1e-14
 Identities = 52/55 (94%)
 Strand = Plus / Plus

                                                                   
Query: 2    tgtttaattaaaacaaagcattgcgatggtcctcgcggatgctgacgcaatgtga 56
            ||||||||||||||||||||||||||||||||  ||||||||| |||||||||||
Sbjct: 2118 tgtttaattaaaacaaagcattgcgatggtccctgcggatgctaacgcaatgtga 2172


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 659,175
Number of Sequences: 3902068
Number of extensions: 659175
Number of successful extensions: 174071
Number of sequences better than 10.0: 2727
Number of HSP's better than 10.0 without gapping: 2725
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 169938
Number of HSP's gapped (non-prelim): 3934
length of query: 56
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 36
effective length of database: 17,155,003,908
effective search space: 617580140688
effective search space used: 617580140688
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top