| Clone Name | baet12d02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT024071.1| Zea mays clone EL01N0501E06 mRNA sequence Length = 2118 Score = 121 bits (61), Expect = 2e-24 Identities = 181/221 (81%) Strand = Plus / Plus Query: 108 gctcatgcattcttatggaaaacatcggaacttacttgtgtactgcgacacttcattgtc 167 |||| ||||||||| ||||| ||||| |||||||||| |||||||| | | || || | Sbjct: 560 gctcgtgcattcttgtggaatacatcagaacttacttctgtactgcaaaattttgttttt 619 Query: 168 gtatgcaatgagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagc 227 | ||||| |||||||||||||||| |||||||||||||| ||||||| ||| | Sbjct: 620 gcgtgcaacgagcttctgtatgggagtactgatgtcgaaagctttgttcatgacctacaa 679 Query: 228 ctcacactagattggatactgaaccactgcttttcactacaagatgtatcagagatgagg 287 ||||| ||||||||||| ||||||||||||| ||||| | |||||||||||| |||| | Sbjct: 680 gtcacattagattggataatgaaccactgcttctcacttcgagatgtatcagacatgaag 739 Query: 288 gaaactatcataaagcatttggatttagatagcagtgatgg 328 ||| | ||||| ||||||||||| ||| | | ||||||||| Sbjct: 740 gaagccatcatgaagcatttggaattaaacaacagtgatgg 780
>ref|XM_474123.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2751 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 1663 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 1722 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 1723 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 1782 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 1783 ataaagaacttggagataaatagcagt 1809
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 33118417 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 33118476 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 33118477 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 33118536 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 33118537 ataaagaacttggagataaatagcagt 33118563
>dbj|AK103112.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119E14, full insert sequence Length = 3116 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 1768 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 1827 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 1828 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 1887 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 1888 ataaagaacttggagataaatagcagt 1914
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete sequence Length = 118971 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 9248 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 9307 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 9308 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 9367 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 9368 ataaagaacttggagataaatagcagt 9394
>emb|AL732335.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0721B11, complete sequence Length = 43586 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 43074 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 43133 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 43134 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 43193 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 43194 ataaagaacttggagataaatagcagt 43220
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02, complete sequence Length = 165745 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 1067 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 1126 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 1127 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 1186 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 1187 ataaagaacttggagataaatagcagt 1213
>emb|AL606635.3|OSJN00057 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0010D21, complete sequence Length = 140626 Score = 109 bits (55), Expect = 6e-21 Identities = 124/147 (84%) Strand = Plus / Plus Query: 177 gagcttctgtatgggaacactgatgtcgaaagatttgttcttgaagtgagcctcacacta 236 |||||| ||||||||| || ||||| ||||||||||| |||||| | | |||||||| Sbjct: 127998 gagcttttgtatgggagtacagatgttgaaagatttgtgcttgaaatcaatatcacacta 128057 Query: 237 gattggatactgaaccactgcttttcactacaagatgtatcagagatgagggaaactatc 296 || |||||| | | ||||||||||||||| |||||||||||||| |||||||| |||||| Sbjct: 128058 gactggataatcagccactgcttttcactccaagatgtatcagacatgagggagactatc 128117 Query: 297 ataaagcatttggatttagatagcagt 323 |||||| | ||||| || |||||||| Sbjct: 128118 ataaagaacttggagataaatagcagt 128144
>emb|AL500525.4| Human DNA sequence from clone RP5-944N15 on chromosome 1 Contains the 3' end of the gene for mesoderm induction early response 1 (MI-ER1) and the 3' end of the SLC35D1 gene for solute carrier family 35 (UDP-glucuronicacid/UDP-N-acetylgalactosamine dual transporter), member D1, complete sequence Length = 37306 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 tgcattcttatggaaaacat 132 |||||||||||||||||||| Sbjct: 2451 tgcattcttatggaaaacat 2470
>emb|AL136365.9| Human DNA sequence from clone RP11-143M15 on chromosome 9p23-24.3 Contains the DMRT1 gene for doublesex and mab-3 related transcription factor 1, the DMRT3 gene for doublesex and mab-3 related transcription factor 3 and four CpG islands, complete sequence Length = 179006 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 305 tttggatttagatagcagtgatgg 328 |||||| ||||||||||||||||| Sbjct: 108828 tttggaattagatagcagtgatgg 108805
>gb|AC005189.2| Homo sapiens PAC clone RP5-905J8 from 7p11.2-p21, complete sequence Length = 176413 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 aaagatttgttcttgaagtg 224 |||||||||||||||||||| Sbjct: 155409 aaagatttgttcttgaagtg 155428
>gb|AC010997.12| Homo sapiens chromosome 10 clone RP11-399K21, complete sequence Length = 189639 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 292 ctatcataaagcatttggat 311 |||||||||||||||||||| Sbjct: 17081 ctatcataaagcatttggat 17100
>gb|AC096748.1| Homo sapiens BAC clone RP11-400D2 from 4, complete sequence Length = 176749 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 246 ctgaaccactgcttttcact 265 |||||||||||||||||||| Sbjct: 161083 ctgaaccactgcttttcact 161102
>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome Length = 4969803 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 19 ttcagagatcgtcaaaggattaca 42 |||||||||||| ||||||||||| Sbjct: 2732473 ttcagagatcgttaaaggattaca 2732450 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,719,768 Number of Sequences: 3902068 Number of extensions: 2719768 Number of successful extensions: 48223 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 48171 Number of HSP's gapped (non-prelim): 45 length of query: 355 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 333 effective length of database: 17,147,199,772 effective search space: 5710017524076 effective search space used: 5710017524076 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)