| Clone Name | baet124c11 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_312411.2| Anopheles gambiae str. PEST ENSANGP00000003008 (ENSANGG00000002468), partial mRNA Length = 3999 Score = 46.1 bits (23), Expect = 0.082 Identities = 23/23 (100%) Strand = Plus / Plus Query: 302 tcacgctgctgctcggggcggcc 324 ||||||||||||||||||||||| Sbjct: 350 tcacgctgctgctcggggcggcc 372
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 306 gctgctgctcggggcggcctcg 327 |||||||||||||||||||||| Sbjct: 8899661 gctgctgctcggggcggcctcg 8899640
>gb|AY241958.1| Dermacentor variabilis putative glutathione S-transferase mRNA, complete cds Length = 893 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 gccaccaccgtcacgctgctg 312 ||||||||||||||||||||| Sbjct: 488 gccaccaccgtcacgctgctg 508
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 306 gctgctgctcggggcggcctcgtcc 330 ||||||||||||||||||| ||||| Sbjct: 259917 gctgctgctcggggcggccgcgtcc 259941
>emb|AL356632.12| Human DNA sequence from clone RP11-7D5 on chromosome 10 Contains a ribosomal protein S3A (RPS3A) pseudogene, the PYCS gene for pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS), the gene for a novel protein (DKFZP564D116, FLJ40976), the 5' end of the ENTPD1 gene for ectonucleoside triphosphate diphosphohydrolase 1 and two CpG islands, complete sequence Length = 163166 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 gtggttttgtgtatatcata 71 |||||||||||||||||||| Sbjct: 112630 gtggttttgtgtatatcata 112649
>emb|X82071.1|PAHEMA Pseudomonas aeruginosa hemA gene, ORF2, ORF3, prf1 gene and hemM gene, strain PAO1 Length = 4781 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 298 accgtcacgctgctgctcgg 317 |||||||||||||||||||| Sbjct: 2995 accgtcacgctgctgctcgg 2976
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 atggccaccaccgtcacgctgctg 312 |||||||||||| ||||||||||| Sbjct: 2005824 atggccaccaccttcacgctgctg 2005801
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 301 gtcacgctgctgctcggggc 320 |||||||||||||||||||| Sbjct: 87181 gtcacgctgctgctcggggc 87162
>gb|AE004880.1| Pseudomonas aeruginosa PAO1, section 441 of 529 of the complete genome Length = 13518 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 accgtcacgctgctgctcgg 317 |||||||||||||||||||| Sbjct: 9147 accgtcacgctgctgctcgg 9166
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 ggcaccggccgggacggctt 365 |||||||||||||||||||| Sbjct: 1960222 ggcaccggccgggacggctt 1960241 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 ggcaccggccgggacggctt 365 |||||||||||||||||||| Sbjct: 1960003 ggcaccggccgggacggctt 1960022 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 ggcaccggccgggacggctt 365 |||||||||||||||||||| Sbjct: 1959343 ggcaccggccgggacggctt 1959362
>emb|X98835.1|PCPCC2 P.chrysosporium DNA for transposon-like element Pcc2 Length = 2657 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 355 cgggacggcttccagtgctc 374 |||||||||||||||||||| Sbjct: 1205 cgggacggcttccagtgctc 1224 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,689,923 Number of Sequences: 3902068 Number of extensions: 2689923 Number of successful extensions: 46171 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 45944 Number of HSP's gapped (non-prelim): 227 length of query: 379 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 357 effective length of database: 17,147,199,772 effective search space: 6121550318604 effective search space used: 6121550318604 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)