ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet124c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_312411.2| Anopheles gambiae str. PEST ENSANGP00000003008 ... 46 0.082
2dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 44 0.32
3gb|AY241958.1| Dermacentor variabilis putative glutathione S-tra... 42 1.3
4emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 42 1.3
5emb|AL356632.12| Human DNA sequence from clone RP11-7D5 on chrom... 40 5.1
6emb|X82071.1|PAHEMA Pseudomonas aeruginosa hemA gene, ORF2, ORF3... 40 5.1
7gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 5.1
8gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.1
9gb|AE004880.1| Pseudomonas aeruginosa PAO1, section 441 of 529 o... 40 5.1
10dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 5.1
11emb|X98835.1|PCPCC2 P.chrysosporium DNA for transposon-like elem... 40 5.1

>ref|XM_312411.2| Anopheles gambiae str. PEST ENSANGP00000003008
           (ENSANGG00000002468), partial mRNA
          Length = 3999

 Score = 46.1 bits (23), Expect = 0.082
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 302 tcacgctgctgctcggggcggcc 324
           |||||||||||||||||||||||
Sbjct: 350 tcacgctgctgctcggggcggcc 372



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 306     gctgctgctcggggcggcctcg 327
               ||||||||||||||||||||||
Sbjct: 8899661 gctgctgctcggggcggcctcg 8899640



to top

>gb|AY241958.1| Dermacentor variabilis putative glutathione S-transferase mRNA,
           complete cds
          Length = 893

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 292 gccaccaccgtcacgctgctg 312
           |||||||||||||||||||||
Sbjct: 488 gccaccaccgtcacgctgctg 508



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 306    gctgctgctcggggcggcctcgtcc 330
              ||||||||||||||||||| |||||
Sbjct: 259917 gctgctgctcggggcggccgcgtcc 259941



to top

>emb|AL356632.12| Human DNA sequence from clone RP11-7D5 on chromosome 10 Contains a
              ribosomal protein S3A (RPS3A) pseudogene, the PYCS gene for
              pyrroline-5-carboxylate synthetase (glutamate
              gamma-semialdehyde synthetase) (GSAS, P5CS), the gene for a
              novel protein (DKFZP564D116, FLJ40976), the 5' end of the
              ENTPD1 gene for ectonucleoside triphosphate
              diphosphohydrolase 1 and two CpG islands, complete sequence
          Length = 163166

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     gtggttttgtgtatatcata 71
              ||||||||||||||||||||
Sbjct: 112630 gtggttttgtgtatatcata 112649



to top

>emb|X82071.1|PAHEMA Pseudomonas aeruginosa hemA gene, ORF2, ORF3, prf1 gene and hemM
            gene, strain PAO1
          Length = 4781

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  accgtcacgctgctgctcgg 317
            ||||||||||||||||||||
Sbjct: 2995 accgtcacgctgctgctcgg 2976



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 289     atggccaccaccgtcacgctgctg 312
               |||||||||||| |||||||||||
Sbjct: 2005824 atggccaccaccttcacgctgctg 2005801



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 301   gtcacgctgctgctcggggc 320
             ||||||||||||||||||||
Sbjct: 87181 gtcacgctgctgctcggggc 87162



to top

>gb|AE004880.1| Pseudomonas aeruginosa PAO1, section 441 of 529 of the complete
            genome
          Length = 13518

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  accgtcacgctgctgctcgg 317
            ||||||||||||||||||||
Sbjct: 9147 accgtcacgctgctgctcgg 9166



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 346     ggcaccggccgggacggctt 365
               ||||||||||||||||||||
Sbjct: 1960222 ggcaccggccgggacggctt 1960241



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 346     ggcaccggccgggacggctt 365
               ||||||||||||||||||||
Sbjct: 1960003 ggcaccggccgggacggctt 1960022



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 346     ggcaccggccgggacggctt 365
               ||||||||||||||||||||
Sbjct: 1959343 ggcaccggccgggacggctt 1959362



to top

>emb|X98835.1|PCPCC2 P.chrysosporium DNA for transposon-like element Pcc2
          Length = 2657

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 355  cgggacggcttccagtgctc 374
            ||||||||||||||||||||
Sbjct: 1205 cgggacggcttccagtgctc 1224


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,689,923
Number of Sequences: 3902068
Number of extensions: 2689923
Number of successful extensions: 46171
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45944
Number of HSP's gapped (non-prelim): 227
length of query: 379
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 357
effective length of database: 17,147,199,772
effective search space: 6121550318604
effective search space used: 6121550318604
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top