ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet124b07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1366F05, complete sequence Length = 171022 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 231 tccggcctccaccctgtggtgctgctgccgggcagctcctgcagccagatcgaggtccgc 290 |||||||||||||| || ||||||||||||| || | ||||||||||| |||||| ||| Sbjct: 65893 tccggcctccaccccgtcgtgctgctgccggacaccacctgcagccagctcgaggcacgc 65952 Query: 291 ctcacggacgactacgagccgccgtcggcgctctgcgccgcgcac 335 |||||||||| ||||| |||||||||| ||| |||||||||||| Sbjct: 65953 ctcacggacgcctacgtgccgccgtcgccgcaatgcgccgcgcac 65997 Score = 77.8 bits (39), Expect = 2e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 249 gtgctgctgccgggcagctcctgcagccagatcgaggtccgcctcacggacgactacgag 308 |||||||||||||| ||| |||||||| || | |||| ||||||||||||| ||||| | Sbjct: 73896 gtgctgctgccggggagcacctgcagctagctggaggcacgcctcacggacgcctacgtg 73955 Query: 309 ccgccgtcggcgctctgcgccgcgcac 335 ||||||||| ||| |||||||||||| Sbjct: 73956 ccgccgtcgccgcaatgcgccgcgcac 73982
>dbj|AK059918.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-F05, full insert sequence Length = 1419 Score = 105 bits (53), Expect = 1e-19 Identities = 92/105 (87%) Strand = Plus / Plus Query: 231 tccggcctccaccctgtggtgctgctgccgggcagctcctgcagccagatcgaggtccgc 290 |||||||||||||| || ||||||||||||| || | ||||||||||| |||||| ||| Sbjct: 95 tccggcctccaccccgtcgtgctgctgccggacaccacctgcagccagctcgaggcacgc 154 Query: 291 ctcacggacgactacgagccgccgtcggcgctctgcgccgcgcac 335 |||||||||| ||||| |||||||||| ||| |||||||||||| Sbjct: 155 ctcacggacgcctacgtgccgccgtcgccgcaatgcgccgcgcac 199
>dbj|AK062291.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-E09, full insert sequence Length = 1555 Score = 77.8 bits (39), Expect = 2e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 249 gtgctgctgccgggcagctcctgcagccagatcgaggtccgcctcacggacgactacgag 308 |||||||||||||| ||| |||||||| || | |||| ||||||||||||| ||||| | Sbjct: 128 gtgctgctgccggggagcacctgcagctagctggaggcacgcctcacggacgcctacgtg 187 Query: 309 ccgccgtcggcgctctgcgccgcgcac 335 ||||||||| ||| |||||||||||| Sbjct: 188 ccgccgtcgccgcaatgcgccgcgcac 214
>dbj|AK063665.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-C10, full insert sequence Length = 1306 Score = 65.9 bits (33), Expect = 9e-08 Identities = 84/101 (83%) Strand = Plus / Plus Query: 231 tccggcctccaccctgtggtgctgctgccgggcagctcctgcagccagatcgaggtccgc 290 ||||| ||||| || || ||||||||||||||| | | ||||||||| |||||| |||| Sbjct: 25 tccggtctccatccggtcgtgctgctgccgggcgccacgtgcagccagctcgaggcccgc 84 Query: 291 ctcacggacgactacgagccgccgtcggcgctctgcgccgc 331 |||||||||| |||| |||||| ||| ||| |||||||| Sbjct: 85 ctcacggacgcctacttgccgccctcgccgcagtgcgccgc 125
>emb|BX537117.6| Zebrafish DNA sequence from clone CH211-281N15 in linkage group 17, complete sequence Length = 161999 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcctt 47 ||||||||||||||||||||||| Sbjct: 17653 attctatccatccatccatcctt 17631 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 18577 attctatccatccatccatcc 18557 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 18134 attctatccatccatccatcc 18114
>emb|BX539308.3| Zebrafish DNA sequence from clone DKEYP-84C8 in linkage group 1, complete sequence Length = 176769 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatccttgc 49 ||||||||||||||||||||||| Sbjct: 3125 tctatccatccatccatccttgc 3147
>emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in linkage group 10, complete sequence Length = 231131 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatccttgc 49 ||||||||||||||||||||||| Sbjct: 133564 tctatccatccatccatccttgc 133542
>emb|BX247899.17| Zebrafish DNA sequence from clone CH211-229B6 in linkage group 19, complete sequence Length = 150160 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatccttgc 49 ||||||||||||||||||||||| Sbjct: 33934 tctatccatccatccatccttgc 33956
>gb|AC150385.2| Branchiostoma floridae clone CH302-101G3, complete sequence Length = 121661 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 27429 ttctatccatccatccatcctt 27408
>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence Length = 163874 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Minus Query: 27 tctatccatccatccatccttgctct 52 ||||||||||||||||||| |||||| Sbjct: 113215 tctatccatccatccatccatgctct 113190
>gb|AC175692.4| Otolemur garnetti, clone XX-8153D2, complete sequence Length = 44850 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 26084 ttctatccatccatccatcctt 26063 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 25960 ttctatccatccatccatcc 25941
>emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E18 on chromosome 1p36.11-36.31 Contains the TARDBP gene for TAR DNA binding protein, the MASP2 gene for mannan-binding lectin serine protease 2, the SRM gene for spermidine synthase, the PMSCL2 gene for 100kDa polymyositis/scleroderma autoantigen 2 (FLJ41371, FLJ36636, two novel genes (FLJ30609), the 3' end of the FRAP1 gene for FK506 binding protein 12-rapamycin associated protein 1 and a CpG island, complete sequence Length = 112769 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 37151 ttctatccatccatccatcctt 37130 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 36100 tctatccatccatccatcctt 36080 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 38147 ttctatccatccatccatcc 38128
>emb|AL008629.9|HS197O17 Human DNA sequence from clone RP1-197O17 on chromosome Xq25-26.3 Contains a pseudogene similar to part of SMT3 suppressor of mif two 3 (yeast), the 5' end of gene LOC286467 and a myofibrillogenesis regulator 1 (MR-1) (FKSG19) pseudogene, complete sequence Length = 161812 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatccttg 48 |||||||||||||||||||||| Sbjct: 140640 tctatccatccatccatccttg 140661
>gb|AC083984.7| Homo sapiens chromosome 11, clone RP11-401C19, complete sequence Length = 117149 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Minus Query: 225 cacgcctccggcctccaccctgtggt 250 ||||||| |||||||||||||||||| Sbjct: 18148 cacgccttcggcctccaccctgtggt 18123
>emb|CR847548.8| Zebrafish DNA sequence from clone DKEY-185L9 in linkage group 8, complete sequence Length = 249728 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 17852 ttctatccatccatccatcctt 17873
>gb|AC016587.9| Homo sapiens chromosome 19 clone CTD-2632B17, complete sequence Length = 155221 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 60385 ttctatccatccatccatcctt 60364
>gb|AC091490.4| Homo sapiens BAC clone RP11-509I10 from 4, complete sequence Length = 21162 Score = 44.1 bits (22), Expect = 0.33 Identities = 28/30 (93%) Strand = Plus / Plus Query: 27 tctatccatccatccatccttgctctttgt 56 |||||||||||||||||||| |||||||| Sbjct: 4400 tctatccatccatccatcctctctctttgt 4429
>gb|AC151053.2| Mus musculus BAC clone RP23-402A4 from 7, complete sequence Length = 201862 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 30 atccatccatccatccttgctc 51 |||||||||||||||||||||| Sbjct: 151140 atccatccatccatccttgctc 151161
>emb|BX950217.14| Zebrafish DNA sequence from clone DKEY-192L17 in linkage group 4, complete sequence Length = 157921 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcctt 47 |||||||||||||||||||||| Sbjct: 19734 ttctatccatccatccatcctt 19755 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 19532 attctatccatccatccatcc 19552 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 18552 attctatccatccatccatcc 18572 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 19473 ttctatccatccatccatcc 19492
>dbj|AP006477.2| Homo sapiens genomic DNA, chromosome 11, clone:RP11-1335O1, complete sequence Length = 77332 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Plus Query: 225 cacgcctccggcctccaccctgtggt 250 ||||||| |||||||||||||||||| Sbjct: 63829 cacgccttcggcctccaccctgtggt 63854
>dbj|AP002799.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-806N19, complete sequence Length = 177564 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatccttg 48 |||||||||||||||||||||| Sbjct: 165053 tctatccatccatccatccttg 165032
>emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in linkage group 10, complete sequence Length = 160621 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 gattctatccatccatccatcc 45 |||||||||||||||||||||| Sbjct: 1490 gattctatccatccatccatcc 1469 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 gattctatccatccatccatc 44 ||||||||||||||||||||| Sbjct: 1579 gattctatccatccatccatc 1599
>gb|AC133655.4| Mus musculus BAC clone RP24-364H7 from 8, complete sequence Length = 177145 Score = 44.1 bits (22), Expect = 0.33 Identities = 25/26 (96%) Strand = Plus / Plus Query: 27 tctatccatccatccatccttgctct 52 ||||||||||||||||||| |||||| Sbjct: 143746 tctatccatccatccatccatgctct 143771
>gb|AC148977.3| Mus musculus BAC clone RP23-387F1 from 7, complete sequence Length = 201967 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 30 atccatccatccatccttgctc 51 |||||||||||||||||||||| Sbjct: 87626 atccatccatccatccttgctc 87647
>emb|AL591366.15| Mouse DNA sequence from clone RP23-80N1 on chromosome 11, complete sequence Length = 117612 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 gattctatccatccatccatcc 45 |||||||||||||||||||||| Sbjct: 101851 gattctatccatccatccatcc 101872
>gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, complete sequence Length = 200977 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 32850 tctatccatccatccatcctt 32830
>gb|AC150432.2| Branchiostoma floridae clone CH302-9D15, complete sequence Length = 173785 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 83676 tctatccatccatccatcctt 83696
>gb|AC115793.14| Mus musculus chromosome 9, clone RP23-400G18, complete sequence Length = 199109 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 38643 attctatccatccatccatcc 38663
>gb|AC131669.3| Mus musculus BAC clone RP23-307E9 from chromosome 7, complete sequence Length = 189956 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 186520 tctatccatccatccatcctt 186500
>gb|AC157805.3| Mus musculus chromosome 1, clone RP24-324B17, complete sequence Length = 212185 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 113844 tctatccatccatccatcctt 113824
>gb|DQ483525.1| Gymnogyps californianus clone 84D microsatellite sequence Length = 900 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 764 attctatccatccatccatcc 744
>emb|CR545479.12| Zebrafish DNA sequence from clone CH211-219M24 in linkage group 17, complete sequence Length = 188250 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 21283 tctatccatccatccatcctt 21303 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 22456 ttctatccatccatccatcc 22475
>emb|CR376739.10| Zebrafish DNA sequence from clone CH211-44M2 in linkage group 24, complete sequence Length = 163471 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 87868 attctatccatccatccatcc 87888
>gb|AC114684.10| Homo sapiens chromosome 18, clone RP11-1058N17, complete sequence Length = 196117 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 151178 tctatccatccatccatcctt 151198
>gb|AC012569.18| Homo sapiens chromosome , clone RP11-8H2, complete sequence Length = 153276 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 308 gccgccgtcggcgctctgcgc 328 ||||||||||||||||||||| Sbjct: 78635 gccgccgtcggcgctctgcgc 78615
>gb|AC090582.9| Homo sapiens chromosome 11, clone RP11-125F14, complete sequence Length = 96560 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 55611 attctatccatccatccatcc 55591
>gb|AC124700.3| Mus musculus BAC clone RP24-199L11 from chromosome 8, complete sequence Length = 163730 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 20 aggagattctatccatccatccatc 44 |||| |||||||||||||||||||| Sbjct: 133945 aggaaattctatccatccatccatc 133921
>emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in linkage group 1, complete sequence Length = 160252 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 92230 attctatccatccatccatcc 92210
>emb|CR407547.14| Zebrafish DNA sequence from clone DKEY-62A12 in linkage group 9, complete sequence Length = 204067 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 69977 tctatccatccatccatcctt 69997
>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence Length = 224790 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 129224 tctatccatccatccatcctt 129244
>emb|BX530034.9| Zebrafish DNA sequence from clone DKEY-284E7 in linkage group 9, complete sequence Length = 94504 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 26968 tctatccatccatccatcctt 26948
>emb|BX901925.10| Zebrafish DNA sequence from clone DKEYP-86C11 in linkage group 17, complete sequence Length = 187245 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 179815 tctatccatccatccatcctt 179795
>emb|BX511036.18| Zebrafish DNA sequence from clone DKEY-279D7 in linkage group 6, complete sequence Length = 164653 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 116890 attctatccatccatccatcc 116870
>emb|CR847786.13| Zebrafish DNA sequence from clone DKEYP-9B4 in linkage group 13, complete sequence Length = 156551 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 70799 tctatccatccatccatcctt 70779 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 70062 attctatccatccatccatcc 70042 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 68174 attctatccatccatccatcc 68154 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 73238 ttctatccatccatccatcc 73257 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 68028 attctatccatccatccatc 68009
>emb|CR392025.7| Zebrafish DNA sequence from clone CH211-248P17 in linkage group 17, complete sequence Length = 158863 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 152250 tctatccatccatccatcctt 152230 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 152022 tctatccatccatccatcctt 152002 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 155367 ttctatccatccatccatcc 155348
>emb|CR847503.8| Zebrafish DNA sequence from clone DKEY-20D21 in linkage group 8, complete sequence Length = 217514 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 204051 tctatccatccatccatcctt 204071
>emb|BX511026.2| Human DNA sequence from clone XXyac-4BF7 on chromosome 1, complete sequence Length = 28205 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 16765 tctatccatccatccatcctt 16745
>emb|AL391316.7| Human DNA sequence from clone XX-YM901F10 on chromosome 20 Contains ESTs, GSSs and STSs, complete sequence Length = 49377 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgct 50 ||||||||||||||||||||| Sbjct: 7405 atccatccatccatccttgct 7385
>emb|AL162586.26| Human DNA sequence from clone RP11-228B15 on chromosome 9 Contains the 5' end of the SH2D3C gene for SH2 domain containing 3C (CHAT,NSP3), the CDK9 gene for cyclin-dependent kinase 9 (CDC2-related kinase) (TAK, C-2k, CDC2L4, PITALRE), the FPGS gene for folylpolyglutamate synthase (folylpolyglutamate synthetase), the 3' end fo the ENG gene for endoglin (Osler-Rendu-Weber syndrome 1)(END, ORW, HHT1, ORW1, CD105), a novel gene and five CpG islands, complete sequence Length = 80642 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 69861 tctatccatccatccatcctt 69841
>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains the 3' end of the gene for KIAA1272 protein (similar to rat tulip proteins 1 and 2), the INSM1 gene for insulinoma-associated protein 1, the 3' end of the C20orf26 gene and a CpG island, complete sequence Length = 67356 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 4239 attctatccatccatccatcc 4219
>emb|AL161443.13| Human DNA sequence from clone RP11-169L18 on chromosome 9 Contains the 3' end of the JMJD2C gene for jumonji domain containing 2C, complete sequence Length = 140439 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 43964 tctatccatccatccatcctt 43984 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 43840 tctatccatccatccatcctt 43860
>gb|AC093567.13| Homo sapiens chromosome 18, clone RP11-484L8, complete sequence Length = 174698 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 103409 tctatccatccatccatcctt 103389
>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the C20orf148 gene for a novel tyrosine kinase, the PTK6 gene for protein tyrosine kinase 6, a novel gene, the EEF1A2 gene for eukaryotic translation elongation factor 1 alpha 2, the 5' end of the KCNQ2 gene for potassium voltage-gated channel (KQT-like subfamily member 2), the gene for peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the C20orf149 gene, the gene for novel protein MGC5356 (MGC5356), the gene for a novel protein (LOC200213), a novel gene and thirteen CpG islands, complete sequence Length = 113196 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 21559 tctatccatccatccatcctt 21539
>emb|AL133479.11| Human DNA sequence from clone RP11-299F23 on chromosome 9p23-24.3, complete sequence Length = 167497 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 41843 attctatccatccatccatcc 41863
>emb|AL035541.15|HS718J7 Human DNA sequence from clone RP4-718J7 on chromosome 20q13.31-13.33 Contains the PCK1 gene for soluble phosphoenolpyruvate carboxykinase 1, the ZBP1 gene for Z-DNA binding protein 1, the 3' end of the TMEPAI gene for transmembrane prostate androgen induced mRNA, two putative novel genes, the 5' end of the CTCFL gene for CCCTC-binding factor (zinc finger)-like and a CpG island, complete sequence Length = 130435 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 50984 tctatccatccatccatcctt 51004
>emb|BX322579.23| Zebrafish DNA sequence from clone CH211-3G21 in linkage group 1, complete sequence Length = 96025 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 986 attctatccatccatccatcc 966 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 754 attctatccatccatccatcc 734 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 606 attctatccatccatccatcc 586 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 530 attctatccatccatccatcc 510 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 338 attctatccatccatccatcc 318 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 1266 attctatccatccatccatc 1247
>gb|AC165259.2| Mus musculus BAC clone RP23-146P7 from chromosome 17, complete sequence Length = 252045 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 200171 attctatccatccatccatcc 200151
>emb|AL646047.9| Mouse DNA sequence from clone RP23-69P8 on chromosome 11 Contains the Myo1g gene for myosin 1G, a novel gene, a ribosomal protein L21 (Rpl21) pseudogene, the 5' end of a novel gene and two CpG islands, complete sequence Length = 93553 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 79523 tctatccatccatccatcctt 79503
>emb|BX119903.13| Zebrafish DNA sequence from clone CH211-188I6 in linkage group 17, complete sequence Length = 138645 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 31218 tctatccatccatccatcctt 31238
>emb|BX927294.7| Zebrafish DNA sequence from clone CH211-222I16 in linkage group 13, complete sequence Length = 104811 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 26941 attctatccatccatccatcc 26961
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 15115 tctatccatccatccatcctt 15135
>emb|BX649467.5| Zebrafish DNA sequence from clone CH211-117L16 in linkage group 4 Contains the gene for a novel protein similar to vertebrate mitochondrial ribosomal protein S18A (MRPS18A) and two novel genes, complete sequence Length = 74769 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 43142 attctatccatccatccatcc 43122
>emb|CR387924.6| Zebrafish DNA sequence from clone CH211-259A19 in linkage group 1, complete sequence Length = 68126 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 9499 attctatccatccatccatcc 9519
>gb|AC161939.4| Mus musculus 10 BAC RP24-364P6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162031 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 130722 tctatccatccatccatcctt 130702
>emb|CR318584.8| Zebrafish DNA sequence from clone CH211-123F21 in linkage group 13, complete sequence Length = 138029 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 56939 tctatccatccatccatcctt 56919
>emb|BX323590.8| Zebrafish DNA sequence from clone CH211-42I9 in linkage group 1, complete sequence Length = 178876 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 atccatccatccatccttgctcttt 54 |||||||||||||||||| |||||| Sbjct: 101007 atccatccatccatcctttctcttt 101031
>emb|BX537102.13| Zebrafish DNA sequence from clone DKEY-276L17 in linkage group 14, complete sequence Length = 239944 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 200446 attctatccatccatccatcc 200466
>emb|BX004842.13| Zebrafish DNA sequence from clone DKEY-18N12 in linkage group 24, complete sequence Length = 193257 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 122393 tctatccatccatccatcctt 122373
>emb|BX005225.20| Zebrafish DNA sequence from clone DKEY-34L15 in linkage group 14, complete sequence Length = 206042 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 58102 attctatccatccatccatcc 58122 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 57998 attctatccatccatccatcc 58018 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 57926 attctatccatccatccatcc 57946 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 57854 attctatccatccatccatcc 57874
>emb|CR388089.8| Zebrafish DNA sequence from clone CH211-87C14, complete sequence Length = 165808 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcct 46 ||||||||||||||||||||| Sbjct: 63142 ttctatccatccatccatcct 63162
>gb|AC151838.6| Mus musculus BAC clone RP23-226C6 from chromosome 7, complete sequence Length = 222398 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 168719 tctatccatccatccatcctt 168739
>gb|AC020913.9| Homo sapiens chromosome 19 clone CTD-3032J10, complete sequence Length = 117751 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 94392 tctatccatccatccatcctt 94372
>gb|AC011353.5| Homo sapiens chromosome 5 clone CTC-328A6, complete sequence Length = 143527 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 66726 tctatccatccatccatcctt 66706
>emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in linkage group 2, complete sequence Length = 146969 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 126143 tctatccatccatccatcctt 126163
>gb|AC098970.2| Homo sapiens chromosome 3 clone RP11-30G4, complete sequence Length = 153590 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 25861 tctatccatccatccatcctt 25841
>gb|AC156984.9| Mus musculus chromosome 5, clone RP23-418H8, complete sequence Length = 171080 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 62970 attctatccatccatccatcc 62950
>gb|AC087867.5| Genomic sequence for Mus musculus, clone RP23-183P4, complete sequence Length = 217281 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 4751 attctatccatccatccatcc 4771
>emb|BX470072.8| Zebrafish DNA sequence from clone DKEY-163I6 in linkage group 21, complete sequence Length = 211164 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcct 46 ||||||||||||||||||||| Sbjct: 126287 ttctatccatccatccatcct 126307
>gb|AC009032.8| Homo sapiens chromosome 16 clone RP11-140H17, complete sequence Length = 184511 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 181406 tctatccatccatccatcctt 181426
>emb|BX248236.16| Zebrafish DNA sequence from clone CH211-207B24 in linkage group 3, complete sequence Length = 228572 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 172263 attctatccatccatccatcc 172283
>gb|AC132139.4| Mus musculus BAC clone RP23-181A24 from chromosome 10, complete sequence Length = 206712 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 gattctatccatccatccatc 44 ||||||||||||||||||||| Sbjct: 118166 gattctatccatccatccatc 118186
>gb|AC026464.7| Homo sapiens chromosome 16 clone RP11-343C2, complete sequence Length = 190185 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 177210 tctatccatccatccatcctt 177190
>dbj|AK077821.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length enriched library, clone:5930402D10 product:unclassifiable, full insert sequence Length = 1362 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 1240 tctatccatccatccatcctt 1220
>gb|AC160408.6| Mus musculus 10 BAC RP23-116I16 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210970 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 23561 tctatccatccatccatcctt 23581
>emb|BX324225.7| Zebrafish DNA sequence from clone DKEY-180I22 in linkage group 21, complete sequence Length = 207125 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcct 46 ||||||||||||||||||||| Sbjct: 195864 ttctatccatccatccatcct 195884
>gb|AC048330.20| Homo sapiens 12 BAC RP11-334L2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 188719 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcct 46 ||||||||||||||||||||| Sbjct: 33115 ttctatccatccatccatcct 33135
>gb|AC008403.8| Homo sapiens chromosome 19 clone CTC-273B12, complete sequence Length = 190076 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcct 46 ||||||||||||||||||||| Sbjct: 131882 ttctatccatccatccatcct 131862
>gb|AC008744.6|AC008744 Homo sapiens chromosome 19 clone CTD-2561O20, complete sequence Length = 203200 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 119802 tctatccatccatccatcctt 119822
>gb|AC037423.16|AC037423 Homo sapiens chromosome 9 clone RP11-287F15, complete sequence Length = 171029 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 107045 attctatccatccatccatcc 107065
>gb|AC018366.39| Mus musculus strain 129/SvJ chromosome 5 clone mgs1-458e5, complete sequence Length = 126143 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 98471 attctatccatccatccatcc 98491
>emb|BX322555.7| Zebrafish DNA sequence from clone DKEY-19D21 in linkage group 15, complete sequence Length = 209310 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 91194 tctatccatccatccatcctt 91214
>emb|BX001036.12| Zebrafish DNA sequence from clone CH211-155G22 in linkage group 1, complete sequence Length = 178860 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 30 atccatccatccatccttgctcttt 54 |||||||||||||||||| |||||| Sbjct: 100714 atccatccatccatcctttctcttt 100738
>dbj|BS000211.1| Pan troglodytes chromosome 22 clone:PTB-017A17, map 22, complete sequences Length = 129385 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 29585 tctatccatccatccatcctt 29565
>emb|AL953869.12| Zebrafish DNA sequence from clone CH211-261J13 in linkage group 7, complete sequence Length = 171417 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 30183 attctatccatccatccatcc 30203 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 19212 attctatccatccatccatcc 19192 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 101720 ttctatccatccatccatcc 101701
>emb|AL512791.3|CNS07EFF Human chromosome 14 DNA sequence BAC R-471B22 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 178834 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 166681 attctatccatccatccatcc 166661
>gb|AC005871.3|AC005871 citb_109_p_11, complete sequence Length = 186418 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 130087 attctatccatccatccatcc 130107
>emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 in linkage group 20, complete sequence Length = 182841 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 132947 attctatccatccatccatcc 132927
>emb|BX927218.17| Zebrafish DNA sequence from clone DKEY-14O18 in linkage group 19, complete sequence Length = 208809 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 28146 attctatccatccatccatcc 28166
>emb|CR318592.7| Zebrafish DNA sequence from clone CH211-51F17 in linkage group 19, complete sequence Length = 124310 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 24743 tctatccatccatccatcctt 24723
>emb|AL935282.14| Zebrafish DNA sequence from clone CH211-281O21 in linkage group 2, complete sequence Length = 173134 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 71751 attctatccatccatccatcc 71771 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 72219 ttctatccatccatccatcc 72238 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 72009 ttctatccatccatccatcc 72028
>emb|BX510353.10| Zebrafish DNA sequence from clone DKEY-201E17 in linkage group 4, complete sequence Length = 77999 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 29025 attctatccatccatccatcc 29005
>emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in linkage group 19, complete sequence Length = 179493 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 111233 attctatccatccatccatcc 111213 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 163244 ttctatccatccatccatcc 163263 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 104995 ttctatccatccatccatcc 104976 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 100269 ttctatccatccatccatcc 100250
>emb|BX296546.6| Zebrafish DNA sequence from clone CH211-234P1 in linkage group 4, complete sequence Length = 174235 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 107966 tctatccatccatccatcctt 107946
>emb|CR774192.15| Zebrafish DNA sequence from clone DKEY-191M6 in linkage group 12, complete sequence Length = 146133 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 28989 attctatccatccatccatcc 29009
>emb|BX284620.5| Zebrafish DNA sequence from clone CH211-218E20 in linkage group 20, complete sequence Length = 201942 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 63106 tctatccatccatccatcctt 63126
>emb|CT025691.7| Zebrafish DNA sequence from clone CH211-206I4 in linkage group 4, complete sequence Length = 68685 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 27123 tctatccatccatccatcctt 27103
>gb|AC006536.2|AC006536 Homo sapiens chromosome 14 clone BAC257P13 map 14q31, complete sequence Length = 185402 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 126458 attctatccatccatccatcc 126438
>emb|BX927333.11| Zebrafish DNA sequence from clone CH211-69C15 in linkage group 10, complete sequence Length = 146168 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 111342 attctatccatccatccatcc 111362
>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 228097 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 149561 attctatccatccatccatcc 149581
>dbj|AP002499.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-107P10, complete sequence Length = 176429 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 68298 tctatccatccatccatcctt 68318
>dbj|AP003063.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-65M17, complete sequence Length = 181208 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 9189 tctatccatccatccatcctt 9209
>dbj|AP001697.1| Homo sapiens genomic DNA, chromosome 21q, section 41/105 Length = 340000 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 98085 tctatccatccatccatcctt 98065
>emb|CT009569.17| Pig DNA sequence from clone CH242-213C10 on chromosome 17, complete sequence Length = 201723 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 148287 tctatccatccatccatcctt 148267 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 148199 tctatccatccatccatcctt 148179
>emb|BX004781.7| Zebrafish DNA sequence from clone CH211-149G8 in linkage group 1, complete sequence Length = 169991 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 162185 tctatccatccatccatcctt 162165
>emb|AL954820.11| Zebrafish DNA sequence from clone CH211-6M6, complete sequence Length = 188661 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 152491 attctatccatccatccatcc 152471 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 152369 ttctatccatccatccatcc 152350 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 151796 ttctatccatccatccatcc 151777
>emb|AL732610.16| Zebrafish DNA sequence from clone CH211-12N8, complete sequence Length = 176982 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 167513 tctatccatccatccatcctt 167533
>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete sequence Length = 229583 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 98287 tctatccatccatccatcctt 98267
>emb|AL845320.10| Zebrafish DNA sequence from clone DKEY-30J19, complete sequence Length = 183417 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 71462 attctatccatccatccatcc 71482
>gb|AC129321.5| Mus musculus BAC clone RP24-160I20 from 8, complete sequence Length = 198439 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 20 aggagattctatccatccatccatc 44 |||| |||||||||||||||||||| Sbjct: 1308 aggaaattctatccatccatccatc 1284
>gb|AC117209.3| Mus musculus BAC clone RP23-281E24 from 10, complete sequence Length = 195911 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 66169 tctatccatccatccatcctt 66149
>emb|AL935047.12| Zebrafish DNA sequence from clone DKEY-20L10, complete sequence Length = 201929 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 118334 tctatccatccatccatcctt 118354
>gb|AC079445.28| Mus musculus strain C57BL/6J chromosome 5 clone rp23-403l21, complete sequence Length = 189517 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 142710 attctatccatccatccatcc 142690
>emb|AL773564.8| Zebrafish DNA sequence from clone CH211-204C7, complete sequence Length = 159763 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 9337 attctatccatccatccatcc 9357 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 9185 attctatccatccatccatcc 9205 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 9074 attctatccatccatccatcc 9094 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 9006 attctatccatccatccatcc 9026 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8899 attctatccatccatccatcc 8919 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8791 attctatccatccatccatcc 8811 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8739 attctatccatccatccatcc 8759 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8691 attctatccatccatccatcc 8711 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8592 attctatccatccatccatcc 8612 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8484 attctatccatccatccatcc 8504 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8432 attctatccatccatccatcc 8452 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 8384 attctatccatccatccatcc 8404 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 10765 ttctatccatccatccatcc 10784 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 10693 attctatccatccatccatc 10712
>emb|AL805923.6| Mouse DNA sequence from clone RP23-65B16 on chromosome 4, complete sequence Length = 182774 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 78447 tctatccatccatccatcctt 78467
>emb|AL928939.6| Mouse DNA sequence from clone RP23-294B13 on chromosome 2, complete sequence Length = 191291 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 127303 tctatccatccatccatcctt 127323
>emb|AL583893.17| Mouse DNA sequence from clone RP23-189A18 on chromosome 15, complete sequence Length = 184558 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 160502 attctatccatccatccatcc 160482
>dbj|AP001598.1| Homo sapiens genomic DNA, chromosome 21, clone:KB2043D3, APP-D21S292 region, complete sequence Length = 171038 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 32104 tctatccatccatccatcctt 32084
>emb|AL627086.22| Mouse DNA sequence from clone RP23-477P14 on chromosome 3, complete sequence Length = 106019 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcctt 47 ||||||||||||||||||||| Sbjct: 91552 tctatccatccatccatcctt 91572
>emb|AL611935.6| Mouse DNA sequence from clone RP23-284L12 on chromosome 11, complete sequence Length = 64198 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatcc 45 ||||||||||||||||||||| Sbjct: 17132 attctatccatccatccatcc 17112
>gb|AC122560.8| Mus musculus chromosome 15, clone RP24-93E14, complete sequence Length = 174003 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 173136 ttctatccatccatccatcc 173155
>gb|AC164119.4| Mus musculus BAC clone RP24-288I15 from chromosome 5, complete sequence Length = 189243 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 110681 tctatccatccatccatcct 110662
>gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, complete sequence Length = 196519 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 159912 ttctatccatccatccatcc 159931
>gb|AC116121.8| Mus musculus chromosome 8, clone RP23-79K4, complete sequence Length = 216001 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 18699 ttctatccatccatccatcc 18718
>gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosome 1, complete sequence Length = 224730 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 213427 tctatccatccatccatcct 213446
>gb|AC113271.10| Mus musculus chromosome 5, clone RP23-376H8, complete sequence Length = 185353 Score = 40.1 bits (20), Expect = 5.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 150 ctcctcctgctcgtccactccaccttcttcct 181 |||||||| ||| ||| ||||||||||||||| Sbjct: 70945 ctcctcctcctcctcctctccaccttcttcct 70976
>gb|AC111129.12| Mus musculus chromosome 5, clone RP23-339H11, complete sequence Length = 196458 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ctatccatccatccatcctt 47 |||||||||||||||||||| Sbjct: 180906 ctatccatccatccatcctt 180887
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete sequence Length = 1019846 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ctatccatccatccatcctt 47 |||||||||||||||||||| Sbjct: 980118 ctatccatccatccatcctt 980099
>gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome 9, complete sequence Length = 204750 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 203276 ttctatccatccatccatcc 203295 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 203172 ttctatccatccatccatcc 203191
>gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome 17, complete sequence Length = 198085 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 77529 ttctatccatccatccatcc 77510
>gb|AC137676.11| Mus musculus chromosome 5, clone RP23-1N19, complete sequence Length = 187726 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 45687 ttctatccatccatccatcc 45668
>gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, complete sequence Length = 81310 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 2729 tctatccatccatccatcct 2710 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 2475 tctatccatccatccatcct 2456
>gb|AC133579.10| Mus musculus chromosome 7, clone RP23-222I22, complete sequence Length = 197206 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 10952 ttctatccatccatccatcc 10971
>gb|AC123722.8| Mus musculus chromosome 5, clone RP23-424O22, complete sequence Length = 205851 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 171488 ttctatccatccatccatcc 171469
>gb|AC158542.2| Pan troglodytes BAC clone CH251-262O17 from chromosome y, complete sequence Length = 174274 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 20574 atccatccatccatccttgc 20555
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 ctatccatccatccatcctt 47 |||||||||||||||||||| Sbjct: 18780 ctatccatccatccatcctt 18799
>gb|AC140279.4| Mus musculus BAC clone RP23-338N10 from chromosome 16, complete sequence Length = 211002 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 61621 ttctatccatccatccatcc 61602
>gb|AC084310.16| Mus musculus chromosome 1, clone RP23-10C10, complete sequence Length = 194800 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 173264 tctatccatccatccatcct 173245
>gb|AC101777.8| Mus musculus chromosome 1, clone RP24-123J3, complete sequence Length = 177788 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 164702 ttctatccatccatccatcc 164721
>gb|AC131728.4| Mus musculus BAC clone RP23-122G5 from chromosome 5, complete sequence Length = 211796 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 200826 tctatccatccatccatcct 200845
>gb|AE009037.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 63 of 256 of the complete sequence Length = 11357 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 tctcgccatggccatggcca 126 |||||||||||||||||||| Sbjct: 6761 tctcgccatggccatggcca 6742
>gb|AC132288.5| Mus musculus BAC clone RP24-315D13 from chromosome 19, complete sequence Length = 177655 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 gccatggccacgaagctcca 136 |||||||||||||||||||| Sbjct: 10849 gccatggccacgaagctcca 10868
>gb|AC092249.3| Canis familiaris clone RP81-256F7, complete sequence Length = 42879 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 14531 ttctatccatccatccatcc 14550
>gb|AC146701.9| Mus musculus chromosome 10, clone RP24-142C15, complete sequence Length = 121683 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 121516 atccatccatccatccttgc 121535
>gb|AC115860.9| Mus musculus chromosome 1, clone RP24-290C11, complete sequence Length = 240785 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 226881 tctatccatccatccatcct 226862
>gb|AC164637.3| Mus musculus BAC clone RP23-128I20 from chromosome 13, complete sequence Length = 222651 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 3482 tctatccatccatccatcct 3463
>gb|AC167229.4| Mus musculus BAC RP24-337D17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 197711 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 140124 ttctatccatccatccatcc 140143
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ctatccatccatccatcctt 47 |||||||||||||||||||| Sbjct: 168467 ctatccatccatccatcctt 168448
>gb|AC004970.2| Homo sapiens BAC clone RP5-1122F4 from 7, complete sequence Length = 149951 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 48878 ttctatccatccatccatcc 48859
>ref|XR_003613.1| PREDICTED: Mus musculus similar to prothymosin alpha (LOC625801), mRNA Length = 937 Score = 40.1 bits (20), Expect = 5.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 150 ctcctcctgctcgtccactccaccttcttcct 181 |||||||| ||| ||| ||||||||||||||| Sbjct: 195 ctcctcctcctcttcctctccaccttcttcct 164
>ref|XM_890368.2| PREDICTED: Mus musculus similar to prothymosin alpha (LOC625801), mRNA Length = 936 Score = 40.1 bits (20), Expect = 5.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 150 ctcctcctgctcgtccactccaccttcttcct 181 |||||||| ||| ||| ||||||||||||||| Sbjct: 195 ctcctcctcctcttcctctccaccttcttcct 164
>gb|AC136743.5| Mus musculus chromosome 9, clone RP23-149D5, complete sequence Length = 213343 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 152524 ttctatccatccatccatcc 152543
>gb|AC109495.4| Homo sapiens chromosome 16 clone RP11-916L7, complete sequence Length = 120065 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 43304 ttctatccatccatccatcc 43285
>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8) gene, complete cds Length = 84102 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 24935 ttctatccatccatccatcc 24954
>emb|BX248397.8| Zebrafish DNA sequence from clone CH211-233H19 in linkage group 18, complete sequence Length = 160938 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 96190 ttctatccatccatccatcc 96171 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 50740 ttctatccatccatccatcc 50721
>emb|CR524823.17| Zebrafish DNA sequence from clone CH211-150A18 in linkage group 16, complete sequence Length = 155638 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 84171 tctatccatccatccatcct 84190
>emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in linkage group 23, complete sequence Length = 165253 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 151854 attctatccatccatccatc 151873
>emb|CR847981.15| Zebrafish DNA sequence from clone CH211-195H23 in linkage group 15, complete sequence Length = 197506 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 44313 ttctatccatccatccatcc 44332 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 44007 ttctatccatccatccatcc 44026
>emb|BX649247.9| Zebrafish DNA sequence from clone DKEY-181C10 in linkage group 15, complete sequence Length = 194916 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 176752 ttctatccatccatccatcc 176733
>emb|CR788319.8| Zebrafish DNA sequence from clone DKEY-245H10 in linkage group 12, complete sequence Length = 188205 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 96798 ttctatccatccatccatcc 96817
>emb|BX324230.15| Zebrafish DNA sequence from clone CH211-42C5 in linkage group 7, complete sequence Length = 179902 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 63540 ttctatccatccatccatcc 63559
>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23, complete sequence Length = 201764 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 93230 attctatccatccatccatc 93211
>emb|CR394563.17| Zebrafish DNA sequence from clone CH211-147P18, complete sequence Length = 165013 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 82167 ttctatccatccatccatcc 82186 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 81583 ttctatccatccatccatcc 81602 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 20960 ttctatccatccatccatcc 20979
>gb|AC140248.3| Mus musculus BAC clone RP24-285L8 from chromosome 7, complete sequence Length = 182854 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 174566 atccatccatccatccttgc 174547 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 174454 atccatccatccatccttgc 174435
>gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosome 16, complete sequence Length = 147166 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 56748 ttctatccatccatccatcc 56767
>gb|AC132260.3| Mus musculus BAC clone RP24-370C1 from chromosome 13, complete sequence Length = 160903 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 29689 tctatccatccatccatcct 29670
>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence Length = 152908 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 51855 atccatccatccatccttgc 51836 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 51743 atccatccatccatccttgc 51724
>gb|AC132268.3| Mus musculus BAC clone RP24-399H6 from chromosome 19, complete sequence Length = 191573 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 gccatggccacgaagctcca 136 |||||||||||||||||||| Sbjct: 173074 gccatggccacgaagctcca 173093
>gb|AC132144.3| Mus musculus BAC clone RP23-39L19 from chromosome 2, complete sequence Length = 233042 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 75902 ttctatccatccatccatcc 75883
>gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosome 8, complete sequence Length = 199412 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 35654 ttctatccatccatccatcc 35635
>gb|AC126552.5| Mus musculus BAC clone RP23-342F3 from chromosome 15, complete sequence Length = 213862 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 137049 tctatccatccatccatcct 137068
>gb|AC117256.4| Mus musculus BAC clone RP24-483G23 from chromosome 16, complete sequence Length = 167118 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 31128 ttctatccatccatccatcc 31147
>emb|CR450824.9| Zebrafish DNA sequence from clone CH211-147F12 in linkage group 23, complete sequence Length = 170611 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 73866 ttctatccatccatccatcc 73885
>emb|BX664703.21| Zebrafish DNA sequence from clone DKEYP-74A8 in linkage group 6, complete sequence Length = 193958 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ctatccatccatccatcctt 47 |||||||||||||||||||| Sbjct: 50568 ctatccatccatccatcctt 50549
>emb|CR762488.16| Zebrafish DNA sequence from clone DKEY-266J7 in linkage group 18, complete sequence Length = 154489 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 119183 ttctatccatccatccatcc 119164
>emb|CR354583.8| Zebrafish DNA sequence from clone CH211-230G15 in linkage group 24, complete sequence Length = 113731 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 19242 ttctatccatccatccatcc 19261
>gb|AC115291.7| Mus musculus BAC clone RP23-65P2 from 15, complete sequence Length = 237119 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 69931 ttctatccatccatccatcc 69950
>emb|CR382290.16| Zebrafish DNA sequence from clone CH211-236D22 in linkage group 1, complete sequence Length = 148582 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 69481 ttctatccatccatccatcc 69462
>emb|CR555294.10| Zebrafish DNA sequence from clone CH211-169P4 in linkage group 19, complete sequence Length = 142042 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 76073 ttctatccatccatccatcc 76092 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 24636 attctatccatccatccatc 24655
>gb|AC110374.3| Mus musculus BAC clone RP23-293P18 from 15, complete sequence Length = 199869 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 189459 ttctatccatccatccatcc 189440
>gb|AY445095.1| Homo sapiens nitric oxide synthase 1 (neuronal) (NOS1) gene, complete cds Length = 152210 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 119823 tctatccatccatccatcct 119804
>gb|AY391268.1| Aeromonas hydrophila clone PB52 conserved hypothetical protein, putative twitching motility protein PilT, and putative twitching motility protein PilU genes, complete cds Length = 3196 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 256 tgccgggcagctcctgcagccaga 279 ||||||||||||||||| |||||| Sbjct: 2366 tgccgggcagctcctgctgccaga 2343
>gb|AC092648.3| Homo sapiens BAC clone RP11-421N10 from 7, complete sequence Length = 171881 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 104192 atccatccatccatccttgc 104173
>gb|AC159807.2| Mus musculus BAC clone RP24-399D3 from chromosome 12, complete sequence Length = 131785 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 123235 ttctatccatccatccatcc 123254
>gb|AC152503.5| Mus musculus BAC clone RP23-190G10 from chromosome 16, complete sequence Length = 204940 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 197022 ttctatccatccatccatcc 197041
>gb|AC102426.6| Mus musculus chromosome 1, clone RP24-88A10, complete sequence Length = 192016 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 114447 ttctatccatccatccatcc 114428
>gb|AC115885.29| Mus musculus chromosome 3, clone RP24-396D16, complete sequence Length = 186636 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 86270 ttctatccatccatccatcc 86251
>gb|AC107703.10| Mus musculus, clone RP23-472H1, complete sequence Length = 215019 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 21443 ttctatccatccatccatcc 21462
>emb|BX897686.8| Zebrafish DNA sequence from clone DKEY-145M5 in linkage group 15, complete sequence Length = 115533 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 37675 ttctatccatccatccatcc 37656 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 37136 ttctatccatccatccatcc 37117 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 34879 ttctatccatccatccatcc 34860
>emb|Z95624.1|HSU237H1 Human DNA sequence from clone LL0XNC01-237H1 on chromosome X Contains a novel gene, a novel protein similar to RAB40A member of RAS oncogene family (RAB40A) and the 3' end of a novel gene, complete sequence Length = 37322 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 atccatccatccatccttgc 49 |||||||||||||||||||| Sbjct: 435 atccatccatccatccttgc 416
>emb|BX323851.7| Human DNA sequence from clone RP11-242D10 on chromosome 1 Contains the gene for a novel protein and part of a pseudogene similar to part of solute carrier family 25 (mitochondrial carrier; phosphate carrier) member 24 (SLC25A24), complete sequence Length = 54646 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 47776 tctatccatccatccatcct 47757
>emb|CR381612.5| Zebrafish DNA sequence from clone DKEY-274K7, complete sequence Length = 96276 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 6496 ttctatccatccatccatcc 6515
>emb|AL611922.7| Human DNA sequence from clone RP11-633N4 on chromosome 9, complete sequence Length = 176612 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 169002 tctatccatccatccatcct 169021
>emb|AL451060.13| Human DNA sequence from clone RP11-264J19 on chromosome 1 Contains a novel gene, the 5' end of the PPP2R5A gene for protein phosphatase 2 regulatory subunit B (B56) alpha isoform and a CpG island, complete sequence Length = 62348 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 36477 tctatccatccatccatcct 36458
>emb|AL445675.9| Human DNA sequence from clone RP11-498M14 on chromosome 1 Contains a CpG island, complete sequence Length = 171985 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 15490 tctatccatccatccatcct 15471
>emb|AL390965.15| Human DNA sequence from clone RP11-640E11 on chromosome 13 Contains a solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5) pseudogene, complete sequence Length = 92179 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 45459 ttctatccatccatccatcc 45478
>emb|AL359258.23| Human DNA sequence from clone RP11-483I13 on chromosome 1 Contains the 5' end of the SLC25A24 gene for solute carrier family 25 (mitochondrial carrier; phosphate carrier) member 24, the gene for a novel protein, two novel genes, a pseudogene similar to solute carrier family 25 (mitochondrial carrier; phosphate carrier) member 24 (SLC25A24) and two CpG islands, complete sequence Length = 188622 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 126259 tctatccatccatccatcct 126278
>emb|AL358177.20| Human DNA sequence from clone RP11-469G10 on chromosome 1, complete sequence Length = 91202 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 24767 ttctatccatccatccatcc 24786
>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the TNFRSF8 gene for tumor necrosis factor receptor superfamily member 8, a ribosomal protein L23a (RPL23A) pseudogene, the 5' end of the TNFRSF1B gene for tumor necrosis factor receptor superfamily member 1B and three CpG islands, complete sequence Length = 151498 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 40557 ttctatccatccatccatcc 40576
>emb|AL353615.37| Human DNA sequence from clone RP11-555H7 on chromosome 9 Contains a gene for a novel protein (MGC35463), complete sequence Length = 107891 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 95012 ttctatccatccatccatcc 94993
>emb|AL162719.18| Human DNA sequence from clone RP11-461D23 on chromosome 6 Contains part of a putative novel transcript, complete sequence Length = 91219 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 68747 tctatccatccatccatcct 68766
>emb|AL138969.16| Human DNA sequence from clone RP1-110C15 on chromosome X, complete sequence Length = 144658 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 116766 tctatccatccatccatcct 116785
>emb|AL137857.29| Human DNA sequence from clone RP5-1166H10 on chromosome 1p33-35.1 Contains the MATN1 gene for matrilin 1 cartilage matrix protein, a novel gene (FLJ46197, FLJ33163), the 3' end of the gene for Lysosomal-associated multispanning membrane protein-5 (LAPTM5) and a CpG island, complete sequence Length = 152042 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 117608 tctatccatccatccatcct 117627
>emb|AL136171.17| Human DNA sequence from clone RP4-584N17 on chromosome 1q42.2-43 Contains part of the DISC1 gene for disrupted in schizophrenia 1, complete sequence Length = 133968 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 99852 ttctatccatccatccatcc 99833
>gb|AC073617.16| Homo sapiens Xp BAC RP11-413F15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 151302 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 49419 ttctatccatccatccatcc 49400
>emb|AL049562.7|HSDA86H19 Human DNA sequence from clone RP6-86H19 on chromosome Xq25-26.2, complete sequence Length = 91201 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 49113 tctatccatccatccatcct 49094
>emb|AL035702.7|HS593C16 Human DNA sequence from clone RP4-593C16 on chromosome 1q24.1-25.2 Contains the 3' end of the RASAL2 gene for RAS protein activator like 2, the 3' end of a novel gene and a CpG island, complete sequence Length = 81971 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 56000 tctatccatccatccatcct 55981
>gb|AC162874.2| Mus musculus chromosome 5, clone RP24-289G19, complete sequence Length = 152182 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 148489 ttctatccatccatccatcc 148508
>emb|BX510944.11| Zebrafish DNA sequence from clone DKEY-286H17 in linkage group 14, complete sequence Length = 131659 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 106180 tctatccatccatccatcct 106161
>emb|AL008710.1|HS292H14 Human DNA sequence from clone RP1-292H14 on chromosome Xp21, complete sequence Length = 97129 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 34715 ttctatccatccatccatcc 34734
>gb|AC116036.3| Homo sapiens chromosome 3 clone RP11-359I18, complete sequence Length = 178119 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 tcttcctggtcagccacacc 194 |||||||||||||||||||| Sbjct: 41165 tcttcctggtcagccacacc 41146
>emb|CR352233.9| Zebrafish DNA sequence from clone CH211-193J5 in linkage group 13, complete sequence Length = 149899 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 53347 ttctatccatccatccatcc 53328 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 52913 ttctatccatccatccatcc 52894 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 52503 ttctatccatccatccatcc 52484 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 52068 ttctatccatccatccatcc 52049
>emb|CR536617.9| Zebrafish DNA sequence from clone CH211-276B5 in linkage group 14, complete sequence Length = 38800 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 34877 ttctatccatccatccatcc 34858 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 12611 ttctatccatccatccatcc 12592
>emb|BX547932.17| Zebrafish DNA sequence from clone DKEY-269E10 in linkage group 7, complete sequence Length = 82464 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 66334 ttctatccatccatccatcc 66315
>emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in linkage group 25, complete sequence Length = 168743 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 60165 ttctatccatccatccatcc 60184 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 59841 attctatccatccatccatc 59860 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 57516 ttctatccatccatccatcc 57535
>emb|BX914201.6| Zebrafish DNA sequence from clone DKEYP-108B3 in linkage group 21, complete sequence Length = 162420 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 144617 ttctatccatccatccatcc 144598
>emb|CR376827.6| Zebrafish DNA sequence from clone CH211-154C21 in linkage group 14, complete sequence Length = 110290 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 4191 ttctatccatccatccatcc 4172 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 3924 ttctatccatccatccatcc 3905
>gb|BC035756.1| Homo sapiens, clone IMAGE:5763894, mRNA Length = 864 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 tcgccatggccatggccacg 128 |||||||||||||||||||| Sbjct: 18 tcgccatggccatggccacg 37
>gb|AC159199.3| Mus musculus BAC clone RP23-401H23 from chromosome 16, complete sequence Length = 218059 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 30905 ttctatccatccatccatcc 30924
>emb|AL645792.7| Zebrafish DNA sequence from clone RP71-1D10 in linkage group 14 Contains two novel genes similar to MATR3 (matrin 3), a novel gene similar to PDE6A (cGMP-specific phosphodiesterase 6A alpha (rod)), a novel gene similar to PERC (PGC-1-related estrogen receptor alpha coactivator) and two CpG islands, complete sequence Length = 170221 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 54961 ttctatccatccatccatcc 54980
>emb|BX572603.1| Rhodopseudomonas palustris CGA009 complete genome; segment 11/16 Length = 349635 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 162 gtccactccaccttcttcctggtc 185 |||||| ||||||||||||||||| Sbjct: 81621 gtccacgccaccttcttcctggtc 81644
>gb|AC163293.4| Mus musculus BAC clone RP23-156J21 from chromosome 16, complete sequence Length = 205834 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 144913 ttctatccatccatccatcc 144932
>gb|AC159230.2| Mus musculus BAC clone RP24-378I19 from chromosome 13, complete sequence Length = 190521 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 102394 tctatccatccatccatcct 102375
>emb|BX294092.1|NCB11H7 Neurospora crassa DNA linkage group V BAC clone B11H7 Length = 74977 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 20432 ttctatccatccatccatcc 20451
>emb|CR524821.5| Zebrafish DNA sequence from clone CH211-192F15 in linkage group 16, complete sequence Length = 152728 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 136246 ttctatccatccatccatcc 136227
>emb|CR352297.14| Zebrafish DNA sequence from clone CH211-165L15 in linkage group 8, complete sequence Length = 159143 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 40758 ttctatccatccatccatcc 40777
>emb|AL662953.3|OSJN00153 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0011F23, complete sequence Length = 149353 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 tatccatccatccatccttg 48 |||||||||||||||||||| Sbjct: 66669 tatccatccatccatccttg 66650
>emb|CR848041.4| Zebrafish DNA sequence from clone DKEY-4K21 in linkage group 21, complete sequence Length = 177962 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 101844 ttctatccatccatccatcc 101863
>gb|AC164627.4| Mus musculus 10 BAC RP23-382A18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192275 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 143139 ttctatccatccatccatcc 143120
>emb|BX005379.9| Zebrafish DNA sequence from clone DKEY-184P9 in linkage group 21, complete sequence Length = 185814 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 82974 ttctatccatccatccatcc 82955
>emb|CR381633.6| Zebrafish DNA sequence from clone CH211-230M9 in linkage group 14, complete sequence Length = 163910 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 117654 ttctatccatccatccatcc 117635
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 59183 ttctatccatccatccatcc 59164 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 59059 ttctatccatccatccatcc 59040
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 134493 ttctatccatccatccatcc 134512 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 134389 ttctatccatccatccatcc 134408
>emb|BX571701.10| Zebrafish DNA sequence from clone CH211-233M11 in linkage group 13, complete sequence Length = 154641 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 90249 attctatccatccatccatc 90230
>emb|BX248577.16| Zebrafish DNA sequence from clone CH211-162H21 in linkage group 11, complete sequence Length = 155980 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 tctatccatccatccatcct 46 |||||||||||||||||||| Sbjct: 47870 tctatccatccatccatcct 47851
>emb|AL663082.5| Mouse DNA sequence from clone RP23-327G1 on chromosome 11 Contains the 3' end of the Ankfy1 gene for ankyrin repeat and FYVE domain containing 1, a new gene, the gene for a novel ZZ type zinc finger domain containing protein, the 5' end of the Atp2a3 gene for ubiquitous Ca++ transporting ATPase and two CpG islands, complete sequence Length = 243654 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 31 tccatccatccatccttgctcttt 54 |||||| ||||||||||||||||| Sbjct: 130554 tccatctatccatccttgctcttt 130531
>gb|AC068797.29| Homo sapiens 12 BAC RP1-81P11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 136257 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 61038 ttctatccatccatccatcc 61019
>emb|CR293525.10| Zebrafish DNA sequence from clone CH211-142B9 in linkage group 12, complete sequence Length = 155553 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 155435 ttctatccatccatccatcc 155454
>emb|BX511222.10| Zebrafish DNA sequence from clone DKEY-250J7 in linkage group 18, complete sequence Length = 151023 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 137954 ttctatccatccatccatcc 137973
>emb|BX294100.11| Zebrafish DNA sequence from clone DKEYP-2G11 in linkage group 12, complete sequence Length = 173405 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 attctatccatccatccatc 44 |||||||||||||||||||| Sbjct: 155213 attctatccatccatccatc 155194
>emb|BX321886.14| Zebrafish DNA sequence from clone DKEYP-46C9 in linkage group 8, complete sequence Length = 168093 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ttctatccatccatccatcc 45 |||||||||||||||||||| Sbjct: 161732 ttctatccatccatccatcc 161751 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,140,887 Number of Sequences: 3902068 Number of extensions: 3140887 Number of successful extensions: 322332 Number of sequences better than 10.0: 450 Number of HSP's better than 10.0 without gapping: 450 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 305309 Number of HSP's gapped (non-prelim): 16949 length of query: 390 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 368 effective length of database: 17,147,199,772 effective search space: 6310169516096 effective search space used: 6310169516096 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
