ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet11h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL049773.1|HS10618A Human DNA sequence from clone RP5-1061O1... 40 0.62
2ref|XM_775510.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 0.62
3emb|CR607285.1| full-length cDNA clone CS0DF038YK15 of Fetal bra... 40 0.62
4dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 0.62
5ref|NM_203081.1| Arabidopsis thaliana GPI-anchor transamidase AT... 38 2.5
6ref|NM_121918.2| Arabidopsis thaliana GPI-anchor transamidase AT... 38 2.5
7gb|AE000659.1|HUAE000659 Homo sapiens T-cell receptor alpha delt... 38 2.5
8ref|NM_004210.3| Homo sapiens neuralized-like (Drosophila) (NEUR... 38 2.5
9gb|AC183540.2| Pan troglodytes BAC clone CH251-324O24 from chrom... 38 2.5
10gb|AC124496.3| Mus musculus BAC clone RP23-471J10 from chromosom... 38 2.5
11gb|AC098654.2| Homo sapiens chromosome 1 clone RP11-475O6, compl... 38 2.5
12emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416... 38 2.5
13gb|BC026336.1| Homo sapiens neuralized-like (Drosophila), mRNA (... 38 2.5
14emb|CR607490.1| full-length cDNA clone CS0DN003YL10 of Adult bra... 38 2.5
15gb|AC093877.3| Homo sapiens BAC clone RP11-637G19 from 4, comple... 38 2.5
16emb|BX831717.1|CNS0A1Q5 Arabidopsis thaliana Full-length cDNA Co... 38 2.5
17gb|AC131947.1| Homo sapiens BAC clone RP11-123I8 from 4, complet... 38 2.5
18gb|AC103595.2| Homo sapiens chromosome 1 clone RP11-415P10, comp... 38 2.5
19gb|BT002413.1| Arabidopsis thaliana GPAA1 - like protein (At5g19... 38 2.5
20gb|AC069326.1|AC069326 Genomic Sequence For Arabidopsis thaliana... 38 2.5
21emb|BX648827.1|HSM808978 Homo sapiens mRNA; cDNA DKFZp686N0398 (... 38 2.5
22gb|AF159341.1|AF159341 Neoditrema ransonnetti cytochrome b gene,... 38 2.5
23ref|NG_001332.1| Homo sapiens T cell receptor alpha delta locus ... 38 2.5
24gb|AC159250.2| Mus musculus BAC clone RP24-196J19 from chromosom... 36 9.7
25gb|AC158514.2| Mus musculus BAC clone RP24-480D16 from chromosom... 36 9.7
26gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromoso... 36 9.7
27gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map ... 36 9.7
28gb|AC145557.3| Mus musculus BAC clone RP23-313I19 from chromosom... 36 9.7
29emb|AJ249216.1|XLA249216 Xenopus laevis stomach mRNA p4.2 TFF ge... 36 9.7
30gb|AC154903.4| Mus musculus BAC clone RP23-414E24 from chromosom... 36 9.7
31gb|AC146043.2| Pan troglodytes BAC clone RP43-109E16 from 7, com... 36 9.7
32gb|AC127595.3| Mus musculus BAC clone RP23-49I18 from chromosome... 36 9.7
33ref|XM_810579.1| Trypanosoma cruzi strain CL Brener hypothetical... 36 9.7
34gb|DQ450542.1| Leishmania mexicana beta tubulin genes, partial cds 36 9.7
35gb|AC004455.2| Homo sapiens PAC clone RP5-1032B10 from 7, comple... 36 9.7
36gb|AE014075.1| Escherichia coli CFT073, complete genome 36 9.7
37gb|CP000243.1| Escherichia coli UTI89, complete genome 36 9.7
38gb|AC166100.2| Mus musculus BAC clone RP24-64H18 from chromosome... 36 9.7
39emb|AJ426044.2|ECO426044 Escherichia coli waa gene cluster encod... 36 9.7
40emb|AL596180.8| Mouse DNA sequence from clone RP23-243J8 on chro... 36 9.7
41dbj|AK155995.1| Mus musculus activated spleen cDNA, RIKEN full-l... 36 9.7
42gb|AC007937.18| Mus musculus chromosome 10, clone RP21-536F4, co... 36 9.7
43emb|CR388161.7| Zebrafish DNA sequence from clone CH211-288B17 i... 36 9.7
44gb|AC158618.5| Mus musculus 10 BAC RP23-280M4 (Roswell Park Canc... 36 9.7
45gb|AC153892.12| Mus musculus 10 BAC RP23-113O12 (Roswell Park Ca... 36 9.7
46dbj|AP006505.1| Mus musculus genomic DNA, chromosome 4, clone: R... 36 9.7
47gb|AC079080.5| Homo sapiens BAC clone RP11-162O12 from 4, comple... 36 9.7
48ref|NM_214188.1| Sus scrofa oligosaccharyltransferase OST48 (OST... 36 9.7
49gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 36 9.7
50gb|AY105096.1| Zea mays PCO148275 mRNA sequence 36 9.7
51gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, c... 36 9.7
52emb|AL139074.2|CJ11168X1 Campylobacter jejuni subsp. jejuni NCTC... 36 9.7
53emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D1... 36 9.7
54emb|CT030206.8| Mouse DNA sequence from clone RP23-100I15 on chr... 36 9.7
55gb|AC099701.4| Mus musculus chromosome 7, clone RP23-184F6, comp... 36 9.7
56emb|AL772345.5| Mouse DNA sequence from clone RP23-311I21 on chr... 36 9.7
57emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on ch... 36 9.7
58gb|AC159813.2| Mus musculus BAC clone RP23-386L9 from chromosome... 36 9.7
59emb|AJ293581.1|SSC293581 Sus scrofa mRNA for oligosaccharyltrans... 36 9.7
60emb|AL731655.8| Mouse DNA sequence from clone RP23-249G3 on chro... 36 9.7

>emb|AL049773.1|HS10618A Human DNA sequence from clone RP5-1061O18 on chromosome 22q13.32-13.33
             Contains a GSS, complete sequence
          Length = 45333

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aatggctgctgcttcccttg 57
             ||||||||||||||||||||
Sbjct: 44209 aatggctgctgcttcccttg 44190



to top

>ref|XM_775510.1| PREDICTED: Strongylocentrotus purpuratus similar to Ly1 antibody
           reactive clone (LOC575094), mRNA
          Length = 2335

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 26  ccaagcaggaacaatggctgctgc 49
           |||| |||||||||||||||||||
Sbjct: 387 ccaaacaggaacaatggctgctgc 410



to top

>emb|CR607285.1| full-length cDNA clone CS0DF038YK15 of Fetal brain of Homo sapiens
           (human)
          Length = 1946

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 29  agcaggaacaatggctgctgcttc 52
           |||||||| |||||||||||||||
Sbjct: 301 agcaggaataatggctgctgcttc 324



to top

>dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-872D17, complete
             sequence
          Length = 190251

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 29    agcaggaacaatggctgctgcttc 52
             |||||||| |||||||||||||||
Sbjct: 58496 agcaggaataatggctgctgcttc 58473



to top

>ref|NM_203081.1| Arabidopsis thaliana GPI-anchor transamidase AT5G19130 transcript
           variant AT5G19130.2 mRNA, complete cds
          Length = 3095

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 33  ggaacaatggctgctgctt 51
           |||||||||||||||||||
Sbjct: 806 ggaacaatggctgctgctt 824



to top

>ref|NM_121918.2| Arabidopsis thaliana GPI-anchor transamidase AT5G19130 transcript
           variant AT5G19130.1 mRNA, complete cds
          Length = 3118

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 33  ggaacaatggctgctgctt 51
           |||||||||||||||||||
Sbjct: 829 ggaacaatggctgctgctt 847



to top

>gb|AE000659.1|HUAE000659 Homo sapiens T-cell receptor alpha delta locus from bases 250472 to
             501670 (section 2 of 5) of the Complete Nucleotide
             Sequence
          Length = 251199

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 36    acaatggctgctgcttccc 54
             |||||||||||||||||||
Sbjct: 57901 acaatggctgctgcttccc 57919



to top

>ref|NM_004210.3| Homo sapiens neuralized-like (Drosophila) (NEURL), mRNA
          Length = 4011

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 40   tggctgctgcttcccttgt 58
            |||||||||||||||||||
Sbjct: 3934 tggctgctgcttcccttgt 3952



to top

>gb|AC183540.2| Pan troglodytes BAC clone CH251-324O24 from chromosome 7, complete
             sequence
          Length = 176962

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    gaacaatggctgctgcttc 52
             |||||||||||||||||||
Sbjct: 21769 gaacaatggctgctgcttc 21787



to top

>gb|AC124496.3| Mus musculus BAC clone RP23-471J10 from chromosome 3, complete sequence
          Length = 185141

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 43    ctgctgcttcccttgttct 61
             |||||||||||||||||||
Sbjct: 99943 ctgctgcttcccttgttct 99925



to top

>gb|AC098654.2| Homo sapiens chromosome 1 clone RP11-475O6, complete sequence
          Length = 159975

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 34     gaacaatggctgctgcttc 52
              |||||||||||||||||||
Sbjct: 141843 gaacaatggctgctgcttc 141861



to top

>emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416N2 on chromosome 10 Contains the
             3' end of the NEURL gene for neuralized-like (Drosophila),
             the 3' end of the SH3MD1 gene for SH3 multiple domains 1
             and seven CpG islands, complete sequence
          Length = 203262

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    tggctgctgcttcccttgt 58
             |||||||||||||||||||
Sbjct: 66219 tggctgctgcttcccttgt 66237



to top

>gb|BC026336.1| Homo sapiens neuralized-like (Drosophila), mRNA (cDNA clone MGC:26482
            IMAGE:4812302), complete cds
          Length = 4011

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 40   tggctgctgcttcccttgt 58
            |||||||||||||||||||
Sbjct: 3934 tggctgctgcttcccttgt 3952



to top

>emb|CR607490.1| full-length cDNA clone CS0DN003YL10 of Adult brain of Homo sapiens
            (human)
          Length = 1522

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 40   tggctgctgcttcccttgt 58
            |||||||||||||||||||
Sbjct: 1496 tggctgctgcttcccttgt 1514



to top

>gb|AC093877.3| Homo sapiens BAC clone RP11-637G19 from 4, complete sequence
          Length = 162150

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cccaagcaggaacaatggc 43
             |||||||||||||||||||
Sbjct: 64143 cccaagcaggaacaatggc 64161



to top

>emb|BX831717.1|CNS0A1Q5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH25ZF02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2328

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 33  ggaacaatggctgctgctt 51
           |||||||||||||||||||
Sbjct: 806 ggaacaatggctgctgctt 824



to top

>gb|AC131947.1| Homo sapiens BAC clone RP11-123I8 from 4, complete sequence
          Length = 132585

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 25    cccaagcaggaacaatggc 43
             |||||||||||||||||||
Sbjct: 69321 cccaagcaggaacaatggc 69339



to top

>gb|AC103595.2| Homo sapiens chromosome 1 clone RP11-415P10, complete sequence
          Length = 122000

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    gaacaatggctgctgcttc 52
             |||||||||||||||||||
Sbjct: 25245 gaacaatggctgctgcttc 25263



to top

>gb|BT002413.1| Arabidopsis thaliana GPAA1 - like protein (At5g19130) mRNA,
           complete cds
          Length = 2334

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 33  ggaacaatggctgctgctt 51
           |||||||||||||||||||
Sbjct: 829 ggaacaatggctgctgctt 847



to top

>gb|AC069326.1|AC069326 Genomic Sequence For Arabidopsis thaliana Clone T24G5 From Chromosome
            V, complete sequence
          Length = 86358

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 33   ggaacaatggctgctgctt 51
            |||||||||||||||||||
Sbjct: 9376 ggaacaatggctgctgctt 9358



to top

>emb|BX648827.1|HSM808978 Homo sapiens mRNA; cDNA DKFZp686N0398 (from clone DKFZp686N0398)
          Length = 4189

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  tggctgctgcttcccttgt 58
           |||||||||||||||||||
Sbjct: 223 tggctgctgcttcccttgt 241



to top

>gb|AF159341.1|AF159341 Neoditrema ransonnetti cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 687

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 42  gctgctgcttcccttgttc 60
           |||||||||||||||||||
Sbjct: 568 gctgctgcttcccttgttc 586



to top

>ref|NG_001332.1| Homo sapiens T cell receptor alpha delta locus (TCRA/TCRD) on chromosome
              14
          Length = 1071646

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 36     acaatggctgctgcttccc 54
              |||||||||||||||||||
Sbjct: 308372 acaatggctgctgcttccc 308390



to top

>gb|AC159250.2| Mus musculus BAC clone RP24-196J19 from chromosome 12, complete sequence
          Length = 193510

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 25     cccaagcaggaacaatgg 42
              ||||||||||||||||||
Sbjct: 158689 cccaagcaggaacaatgg 158706



to top

>gb|AC158514.2| Mus musculus BAC clone RP24-480D16 from chromosome 12, complete
             sequence
          Length = 204825

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 46    ctgcttcccttgttctgg 63
             ||||||||||||||||||
Sbjct: 72636 ctgcttcccttgttctgg 72619



to top

>gb|AC186367.2| Gallus gallus BAC clone TAM31-55N19 from chromosome 17, complete
             sequence
          Length = 181509

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 30    gcaggaacaatggctgct 47
             ||||||||||||||||||
Sbjct: 20833 gcaggaacaatggctgct 20816



to top

>gb|AC184800.2| Pan troglodytes chromosome X clone PTB-18K16 map human ortholog p11.23,
             complete sequence
          Length = 142154

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 35    aacaatggctgctgcttc 52
             ||||||||||||||||||
Sbjct: 55622 aacaatggctgctgcttc 55639



to top

>gb|AC145557.3| Mus musculus BAC clone RP23-313I19 from chromosome 19, complete sequence
          Length = 226099

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      ccagcagctccaacgtac 21
              ||||||||||||||||||
Sbjct: 124884 ccagcagctccaacgtac 124901



to top

>emb|AJ249216.1|XLA249216 Xenopus laevis stomach mRNA p4.2 TFF gene product
          Length = 875

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 35  aacaatggctgctgcttc 52
           ||||||||||||||||||
Sbjct: 479 aacaatggctgctgcttc 496



to top

>gb|AC154903.4| Mus musculus BAC clone RP23-414E24 from chromosome 12, complete
             sequence
          Length = 201338

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 46    ctgcttcccttgttctgg 63
             ||||||||||||||||||
Sbjct: 20699 ctgcttcccttgttctgg 20716



to top

>gb|AC146043.2| Pan troglodytes BAC clone RP43-109E16 from 7, complete sequence
          Length = 154413

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ccaagcaggaacaatggc 43
             ||||||||||||||||||
Sbjct: 30984 ccaagcaggaacaatggc 30967



to top

>gb|AC127595.3| Mus musculus BAC clone RP23-49I18 from chromosome 7, complete sequence
          Length = 239586

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     aagcaggaacaatggctg 45
              ||||||||||||||||||
Sbjct: 106311 aagcaggaacaatggctg 106328



to top

>ref|XM_810579.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511545.100) partial mRNA
          Length = 5208

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1    aatccagcagctccaacg 18
            ||||||||||||||||||
Sbjct: 3715 aatccagcagctccaacg 3698



to top

>gb|DQ450542.1| Leishmania mexicana beta tubulin genes, partial cds
          Length = 2354

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 40   tggctgctgcttcccttg 57
            ||||||||||||||||||
Sbjct: 1105 tggctgctgcttcccttg 1122



to top

>gb|AC004455.2| Homo sapiens PAC clone RP5-1032B10 from 7, complete sequence
          Length = 78520

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    ccaagcaggaacaatggc 43
             ||||||||||||||||||
Sbjct: 11842 ccaagcaggaacaatggc 11825



to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 27      caagcaggaacaatggctgctg 48
               ||||||||||||| ||||||||
Sbjct: 4236237 caagcaggaacaagggctgctg 4236216



to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 27      caagcaggaacaatggctgctg 48
               ||||||||||||| ||||||||
Sbjct: 4063767 caagcaggaacaagggctgctg 4063746



to top

>gb|AC166100.2| Mus musculus BAC clone RP24-64H18 from chromosome 19, complete sequence
          Length = 275852

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 32     aggaacaatggctgctgc 49
              ||||||||||||||||||
Sbjct: 177173 aggaacaatggctgctgc 177156



to top

>emb|AJ426044.2|ECO426044 Escherichia coli waa gene cluster encoding the LPS R1 core
            biosynthesis region
          Length = 11821

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 27   caagcaggaacaatggctgctg 48
            ||||||||||||| ||||||||
Sbjct: 4579 caagcaggaacaagggctgctg 4600



to top

>emb|AL596180.8| Mouse DNA sequence from clone RP23-243J8 on chromosome 11 Contains the
             Akap1 gene for A kinase (PRKA) anchor protein 1, complete
             sequence
          Length = 76410

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 32    aggaacaatggctgctgcttcc 53
             ||||||| ||||||||||||||
Sbjct: 11146 aggaacactggctgctgcttcc 11167



to top

>dbj|AK155995.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830003G14 product:unclassifiable, full
           insert sequence
          Length = 1414

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 39  atggctgctgcttccctt 56
           ||||||||||||||||||
Sbjct: 208 atggctgctgcttccctt 225



to top

>gb|AC007937.18| Mus musculus chromosome 10, clone RP21-536F4, complete sequence
          Length = 205015

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 22     gtacccaagcaggaacaa 39
              ||||||||||||||||||
Sbjct: 104035 gtacccaagcaggaacaa 104052



to top

>emb|CR388161.7| Zebrafish DNA sequence from clone CH211-288B17 in linkage group 18,
             complete sequence
          Length = 80508

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 30    gcaggaacaatggctgctgctt 51
             ||||| ||||||||||||||||
Sbjct: 11839 gcagggacaatggctgctgctt 11860



to top

>gb|AC158618.5| Mus musculus 10 BAC RP23-280M4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 235639

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 22    gtacccaagcaggaacaa 39
             ||||||||||||||||||
Sbjct: 78573 gtacccaagcaggaacaa 78590



to top

>gb|AC153892.12| Mus musculus 10 BAC RP23-113O12 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 197426

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    gtacccaagcaggaacaa 39
             ||||||||||||||||||
Sbjct: 15740 gtacccaagcaggaacaa 15723



to top

>dbj|AP006505.1| Mus musculus genomic DNA, chromosome 4, clone: RP23-266A3, complete
             sequence
          Length = 199759

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 39    atggctgctgcttccctt 56
             ||||||||||||||||||
Sbjct: 70455 atggctgctgcttccctt 70438



to top

>gb|AC079080.5| Homo sapiens BAC clone RP11-162O12 from 4, complete sequence
          Length = 161647

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 41     ggctgctgcttcccttgt 58
              ||||||||||||||||||
Sbjct: 114420 ggctgctgcttcccttgt 114437



to top

>ref|NM_214188.1| Sus scrofa oligosaccharyltransferase OST48 (OST48), mRNA
          Length = 1618

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 40 tggctgctgcttcccttg 57
          ||||||||||||||||||
Sbjct: 59 tggctgctgcttcccttg 76



to top

>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 29    agcaggaacaatggctgc 46
             ||||||||||||||||||
Sbjct: 18265 agcaggaacaatggctgc 18248



to top

>gb|AY105096.1| Zea mays PCO148275 mRNA sequence
          Length = 2592

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 33   ggaacaatggctgctgct 50
            ||||||||||||||||||
Sbjct: 995  ggaacaatggctgctgct 1012



to top

>gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, complete sequence
          Length = 217397

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 37    caatggctgctgcttccc 54
             ||||||||||||||||||
Sbjct: 87385 caatggctgctgcttccc 87402



to top

>emb|AL139074.2|CJ11168X1 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
              1/6
          Length = 314150

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 35     aacaatggctgctgcttc 52
              ||||||||||||||||||
Sbjct: 284888 aacaatggctgctgcttc 284871



to top

>emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D10, complete sequence
          Length = 171446

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 28     aagcaggaacaatggctgctgc 49
              |||||||||||||||| |||||
Sbjct: 124313 aagcaggaacaatggcagctgc 124292



to top

>emb|CT030206.8| Mouse DNA sequence from clone RP23-100I15 on chromosome 12, complete
              sequence
          Length = 201135

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     cccaagcaggaacaatgg 42
              ||||||||||||||||||
Sbjct: 114248 cccaagcaggaacaatgg 114231



to top

>gb|AC099701.4| Mus musculus chromosome 7, clone RP23-184F6, complete sequence
          Length = 226167

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 29     agcaggaacaatggctgc 46
              ||||||||||||||||||
Sbjct: 202119 agcaggaacaatggctgc 202136



to top

>emb|AL772345.5| Mouse DNA sequence from clone RP23-311I21 on chromosome 1, complete
             sequence
          Length = 198092

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 40    tggctgctgcttcccttg 57
             ||||||||||||||||||
Sbjct: 17787 tggctgctgcttcccttg 17770



to top

>emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on chromosome 9, complete
             sequence
          Length = 110444

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 28    aagcaggaacaatggctgctgc 49
             |||||||||||||||| |||||
Sbjct: 91630 aagcaggaacaatggcagctgc 91609



to top

>gb|AC159813.2| Mus musculus BAC clone RP23-386L9 from chromosome 12, complete sequence
          Length = 213561

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 28     aagcaggaacaatggctg 45
              ||||||||||||||||||
Sbjct: 119608 aagcaggaacaatggctg 119625



to top

>emb|AJ293581.1|SSC293581 Sus scrofa mRNA for oligosaccharyltransferase OST48
          Length = 1618

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 40 tggctgctgcttcccttg 57
          ||||||||||||||||||
Sbjct: 59 tggctgctgcttcccttg 76



to top

>emb|AL731655.8| Mouse DNA sequence from clone RP23-249G3 on chromosome 4, complete
             sequence
          Length = 126753

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 39    atggctgctgcttccctt 56
             ||||||||||||||||||
Sbjct: 46960 atggctgctgcttccctt 46977


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 641,707
Number of Sequences: 3902068
Number of extensions: 641707
Number of successful extensions: 46610
Number of sequences better than 10.0: 60
Number of HSP's better than 10.0 without gapping: 60
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46488
Number of HSP's gapped (non-prelim): 122
length of query: 65
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 44
effective length of database: 17,151,101,840
effective search space: 754648480960
effective search space used: 754648480960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top