ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet119f09 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1280 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 93 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 393 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 452 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 453 agtgagccacgccttcttatc 473 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74
>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1298 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 95 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 395 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 454 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 455 agtgagccacgccttcttatc 475 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76
>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1310 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 96 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 396 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 455 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 456 agtgagccacgccttcttatc 476 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77
>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1343 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 98 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 157 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 158 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 217 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 218 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 277 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 278 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 337 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 338 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 397 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 398 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 457 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 458 agtgagccacgccttcttatc 478 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 39 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 79
>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full insert sequence Length = 1298 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 95 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 395 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 454 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 455 agtgagccacgccttcttatc 475 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76
>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full insert sequence Length = 1280 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 93 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 393 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 452 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 453 agtgagccacgccttcttatc 473 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74
>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full insert sequence Length = 1342 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 97 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 156 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 157 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 216 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 217 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 276 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 277 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 336 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 337 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 396 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 397 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 456 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 457 agtgagccacgccttcttatc 477 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 38 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 78
>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full insert sequence Length = 1310 Score = 529 bits (267), Expect = e-147 Identities = 353/381 (92%), Gaps = 3/381 (0%) Strand = Plus / Plus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 96 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215 Query: 203 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 262 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275 Query: 263 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 322 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335 Query: 323 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 382 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395 Query: 383 aacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaaacttcgttc 442 |||||||||||||||||||||||||||||||||| ||||||||| |||| || || ||| Sbjct: 396 cacgccattgctggtaggcacactcctggtacatttaccaaccagctgcagacctcattc 455 Query: 443 agtgagccacgccttcttatc 463 ||||||||||||||||||||| Sbjct: 456 agtgagccacgccttcttatc 476 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77
>gb|AY105034.1| Zea mays PCO130341 mRNA sequence Length = 1213 Score = 442 bits (223), Expect = e-121 Identities = 316/347 (91%) Strand = Plus / Plus Query: 117 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 176 |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 76 tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135 Query: 177 agaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatttaca 236 |||||||||| |||||| |||||||||||| ||||||||||||||||| ||||| |||| Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195 Query: 237 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 296 |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| | Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255 Query: 297 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 356 |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| | Sbjct: 256 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 315 Query: 357 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggtacat 416 |||||||||| |||||||||||||| | ||||||||||| ||||||||||||||||||| Sbjct: 316 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 375 Query: 417 tcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatc 463 ||||||||||| ||||||| || |||||||||||||||||||||||| Sbjct: 376 tcaccaaccagttgcaaacctccttcagtgagccacgccttcttatc 422
>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence Length = 1208 Score = 434 bits (219), Expect = e-118 Identities = 315/347 (90%) Strand = Plus / Plus Query: 117 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 176 |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 73 tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132 Query: 177 agaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatttaca 236 |||||||||| |||||| |||||||||||| ||||||||||||||||| ||||| || | Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192 Query: 237 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 296 |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| | Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252 Query: 297 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 356 |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| | Sbjct: 253 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 312 Query: 357 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggtacat 416 |||||||||| |||||||||||||| | ||||||||||| ||||||||||||||||||| Sbjct: 313 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 372 Query: 417 tcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatc 463 ||||||||||| ||||||| || |||||||||||||||||||||||| Sbjct: 373 tcaccaaccagttgcaaacctccttcagtgagccacgccttcttatc 419
>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full insert sequence Length = 1264 Score = 385 bits (194), Expect = e-104 Identities = 311/350 (88%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 121 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 180 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| |||||||||||||||||||||||| | ||||| Sbjct: 181 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 240 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 241 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 300 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 301 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 360 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 361 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 420 Query: 410 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 |||||||| |||||||| ||||||| || |||||||||||||| ||||| Sbjct: 421 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttct 470
>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full insert sequence Length = 1176 Score = 385 bits (194), Expect = e-104 Identities = 311/350 (88%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 124 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 183 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| |||||||||||||||||||||||| | ||||| Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 243 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 244 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 303 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 304 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 363 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 364 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 423 Query: 410 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 |||||||| |||||||| ||||||| || |||||||||||||| ||||| Sbjct: 424 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttct 473
>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full insert sequence Length = 1245 Score = 385 bits (194), Expect = e-104 Identities = 311/350 (88%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 127 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 186 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| |||||||||||||||||||||||| | ||||| Sbjct: 187 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 246 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 247 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 306 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 307 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 366 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 367 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 426 Query: 410 ggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 |||||||| |||||||| ||||||| || |||||||||||||| ||||| Sbjct: 427 ggtacatttaccaaccaactgcaaacctcattcagtgagccacgtcttct 476
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 327 bits (165), Expect = 2e-86 Identities = 219/237 (92%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || |||||| Sbjct: 25361297 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 25361238 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 25361237 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 25361178 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 25361177 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 25361118 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatc 463 ||||||||||| ||||||||| |||| || || |||||||||||||||||||||||| Sbjct: 25361117 cctggtacatttaccaaccagctgcagacctcattcagtgagccacgccttcttatc 25361061 Score = 210 bits (106), Expect = 3e-51 Identities = 138/148 (93%), Gaps = 3/148 (2%) Strand = Plus / Minus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 25362009 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 25361950 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 25361949 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 25361890 Query: 203 tacgtctacaagcgccgcactgacggta 230 |||||||||||||||||||||||||||| Sbjct: 25361889 tacgtctacaagcgccgcactgacggta 25361862 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 25362068 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 25362028
>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1056G08 Length = 168173 Score = 327 bits (165), Expect = 2e-86 Identities = 219/237 (92%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || |||||| Sbjct: 54387 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 54328 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 54327 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 54268 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 54267 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 54208 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttatc 463 ||||||||||| ||||||||| |||| || || |||||||||||||||||||||||| Sbjct: 54207 cctggtacatttaccaaccagctgcagacctcattcagtgagccacgccttcttatc 54151 Score = 210 bits (106), Expect = 3e-51 Identities = 138/148 (93%), Gaps = 3/148 (2%) Strand = Plus / Minus Query: 86 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 142 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 55099 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 55040 Query: 143 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagacggagcgc 202 |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||| Sbjct: 55039 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 54980 Query: 203 tacgtctacaagcgccgcactgacggta 230 |||||||||||||||||||||||||||| Sbjct: 54979 tacgtctacaagcgccgcactgacggta 54952 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 35 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 75 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 55158 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 55118
>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds Length = 1141 Score = 287 bits (145), Expect = 2e-74 Identities = 274/317 (86%) Strand = Plus / Plus Query: 134 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 193 ||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 118 gacatccagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaa 177 Query: 194 acggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 253 | ||| || ||| ||| ||||||||||| ||||| ||||||||||| |||||||| ||| Sbjct: 178 atggaacgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaag 237 Query: 254 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 313 || ||||||||||||||| | || || ||||| || ||||| ||||| ||||||||||| Sbjct: 238 acgtgggagaagcttcagctagcagctagggttatagttgcaattgagaacccccaggat 297 Query: 314 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 373 |||||||| |||||||| ||||| ||||| || || || ||||| |||||||| |||||| Sbjct: 298 atcattgttcaatctgcaaggccttatgggcaaagagcggttctgaagtttgctcagtac 357 Query: 374 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 433 ||||||||| | || |||||||| ||||||||||||||||| |||||||| ||| | ||| Sbjct: 358 actggtgctcatgctattgctggaaggcacactcctggtaccttcaccaatcagcttcaa 417 Query: 434 acttcgttcagtgagcc 450 ||||| ||||| ||||| Sbjct: 418 acttccttcagcgagcc 434
>ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 918 Score = 274 bits (138), Expect = 2e-70 Identities = 270/314 (85%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 28 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 87 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 88 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 147 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 148 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 207 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 208 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 267 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 || || |||||||| || ||||||||||| || ||||||||||||| ||||| || ||| Sbjct: 268 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 327 Query: 410 ggtacattcaccaa 423 |||||||| ||||| Sbjct: 328 ggtacatttaccaa 341
>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full insert sequence Length = 1310 Score = 274 bits (138), Expect = 2e-70 Identities = 270/314 (85%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 || || |||||||| || ||||||||||| || ||||||||||||| ||||| || ||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411 Query: 410 ggtacattcaccaa 423 |||||||| ||||| Sbjct: 412 ggtacatttaccaa 425
>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full insert sequence Length = 1276 Score = 274 bits (138), Expect = 2e-70 Identities = 270/314 (85%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 || || |||||||| || ||||||||||| || ||||||||||||| ||||| || ||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411 Query: 410 ggtacattcaccaa 423 |||||||| ||||| Sbjct: 412 ggtacatttaccaa 425
>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full insert sequence Length = 1223 Score = 274 bits (138), Expect = 2e-70 Identities = 270/314 (85%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 || || |||||||| || ||||||||||| || ||||||||||||| ||||| || ||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 411 Query: 410 ggtacattcaccaa 423 |||||||| ||||| Sbjct: 412 ggtacatttaccaa 425
>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full insert sequence Length = 1320 Score = 274 bits (138), Expect = 2e-70 Identities = 270/314 (85%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 122 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 181 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 241 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 242 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 301 Query: 290 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 349 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 302 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 361 Query: 350 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 409 || || |||||||| || ||||||||||| || ||||||||||||| ||||| || ||| Sbjct: 362 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 421 Query: 410 ggtacattcaccaa 423 |||||||| ||||| Sbjct: 422 ggtacatttaccaa 435
>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence Length = 1267 Score = 244 bits (123), Expect = 2e-61 Identities = 267/315 (84%) Strand = Plus / Plus Query: 113 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 172 |||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198 Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||||||||||||||||| ||||||||| | || ||||||||||| ||||| || Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||||||| |||||||| || ||| | || || ||||| || ||| Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || || || ||||| ||||||||||| || || || || | |||||||| ||| | ||| Sbjct: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctatggccagcgtgct 378 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || |||||||| || ||||||||||| ||| | ||||| ||||| |||||||| |||||| Sbjct: 379 gtcctcaagttcgctcagtacactggcgctcatgccatcgctgggaggcacacccctggt 438 Query: 413 acattcaccaaccag 427 || ||||| |||||| Sbjct: 439 accttcactaaccag 453
>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full insert sequence Length = 1182 Score = 238 bits (120), Expect = 1e-59 Identities = 189/212 (89%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 113 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 172 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggt 229 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| | || ||| Sbjct: 173 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 232 Query: 230 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 289 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 233 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 292 Query: 290 gttgcgattgaaaacccccaggacatcattgt 321 ||||| ||||| |||||||||||||||||||| Sbjct: 293 gttgccattgagaacccccaggacatcattgt 324 Score = 46.1 bits (23), Expect = 0.10 Identities = 35/39 (89%) Strand = Plus / Plus Query: 385 cgccattgctggtaggcacactcctggtacattcaccaa 423 |||||||||||| ||||| || ||||||||||| ||||| Sbjct: 335 cgccattgctggaaggcatacgcctggtacatttaccaa 373
>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete cds Length = 1138 Score = 226 bits (114), Expect = 5e-56 Identities = 267/318 (83%) Strand = Plus / Plus Query: 134 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 193 |||||| |||||||| ||| || || || |||||||| |||||||||||| | | ||| Sbjct: 88 gacatcaagatgatgtgcgctgctgaggttcacctcggaaccaagaactgcaactaccaa 147 Query: 194 acggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 253 | |||||| ||||||| |||| | |||| |||||||||||||| | |||||||| ||| Sbjct: 148 atggagcgttacgtcttcaagagacgcaacgacggtatttacatctttaaccttggaaag 207 Query: 254 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 313 || ||||||||||| |||||| ||| | ||||| ||||| || || ||||| || ||| Sbjct: 208 acatgggagaagctgatgatggctgcacgagtcatcgttgctatcgagaacccacaagac 267 Query: 314 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 373 ||||||||||| || |||||||||||||| ||||| |||||| | ||||| || |||||| Sbjct: 268 atcattgtgcagtcagctaggccctatggtcagagagctgttttgaagttcgctcagtac 327 Query: 374 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 433 ||||| ||||| ||||||||||| ||||||||||||||||| |||||||| |||||||| Sbjct: 328 actggagctaatgccattgctggaaggcacactcctggtactttcaccaatcagatgcag 387 Query: 434 acttcgttcagtgagcca 451 ||||||||||| |||||| Sbjct: 388 acttcgttcagcgagcca 405
>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence Length = 1275 Score = 222 bits (112), Expect = 8e-55 Identities = 286/344 (83%) Strand = Plus / Plus Query: 113 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 172 |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237 Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||||||||||||||||| |||||| || |||| ||||| ||||| ||||| || Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| |||||| Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| || |||||||| || || || || | ||||| || ||| | ||| Sbjct: 358 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 417 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || |||||||| || ||||||||||| || | ||||| ||||| |||||||| |||||| Sbjct: 418 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 477 Query: 413 acattcaccaaccagatgcaaacttcgttcagtgagccacgcct 456 || |||||||| ||| | || || || ||||| ||||| ||||| Sbjct: 478 accttcaccaatcagctccagacctctttcagcgagcctcgcct 521
>gb|AY103617.1| Zea mays PCO143386 mRNA sequence Length = 1516 Score = 222 bits (112), Expect = 8e-55 Identities = 286/344 (83%) Strand = Plus / Plus Query: 113 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 172 |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276 Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||||||||||||||||| |||||| || |||| ||||| ||||| ||||| || Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| |||||| Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| || |||||||| || || || || | ||||| || ||| | ||| Sbjct: 397 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 456 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || |||||||| || ||||||||||| || | ||||| ||||| |||||||| |||||| Sbjct: 457 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 516 Query: 413 acattcaccaaccagatgcaaacttcgttcagtgagccacgcct 456 || |||||||| ||| | || || || ||||| ||||| ||||| Sbjct: 517 accttcaccaatcagctccagacctctttcagcgagcctcgcct 560
>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence Length = 1418 Score = 216 bits (109), Expect = 5e-53 Identities = 247/293 (84%) Strand = Plus / Plus Query: 128 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 187 ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 145 gagcaggacatacagatgatgctcgccgccgacgtccaccttggcaccaagaactgcgat 204 Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||||||||||||| |||| |||||||| | ||||| || ||||| ||||| ||| Sbjct: 205 ttccagacggagcgctatgtctttaagcgccgttccgacggcatctacatcatcaatctt 264 Query: 248 ggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccc 307 |||||||| ||||| || || ||| | || || ||||| || ||||| || || ||||| Sbjct: 265 ggcaagacatgggataaactccagcttgcagcgagggttatcgttgccatcgagaacccg 324 Query: 308 caggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcc 367 ||||||||||| || || ||||| | || ||||| ||| | ||||| |||||||| || Sbjct: 325 caggacatcatcgtccagtctgcccgcccatatggccagcgtgctgtcctcaagttcgct 384 Query: 368 cagtacactggtgctaacgccattgctggtaggcacactcctggtacattcac 420 ||||||||||| || | ||||| ||||| |||||||| |||||||||||||| Sbjct: 385 cagtacactggcgcccatgccatcgctgggaggcacacccctggtacattcac 437
>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome AT1G72370 (P40) transcript variant AT1G72370.2 mRNA, complete cds Length = 1173 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 416 accttcaccaatcagatgcagacatccttcagtga 450
>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome AT1G72370 (P40) transcript variant AT1G72370.1 mRNA, complete cds Length = 1185 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 416 accttcaccaatcagatgcagacatccttcagtga 450
>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1032 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 331 accttcaccaatcagatgcagacatccttcagtga 365
>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue Length = 1073 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 96 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 216 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 275 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 276 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 335 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 336 accttcaccaatcagatgcagacatccttcagtga 370
>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1103 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 273 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 332 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 333 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 392 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 393 accttcaccaatcagatgcagacatccttcagtga 427
>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1042 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 331 accttcaccaatcagatgcagacatccttcagtga 365
>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 897 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 331 accttcaccaatcagatgcagacatccttcagtga 365
>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370; T10D10.16) mRNA, complete cds Length = 1151 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 413 accttcaccaatcagatgcagacatccttcagtga 447
>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 1182 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 416 accttcaccaatcagatgcagacatccttcagtga 450
>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 1168 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 276 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 335 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 336 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 395 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 396 accttcaccaatcagatgcagacatccttcagtga 430
>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1096 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 280 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 339 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 340 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 399 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 400 accttcaccaatcagatgcagacatccttcagtga 434
>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS23ZA01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1126 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 266 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 325 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 326 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 385 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 386 accttcaccaatcagatgcagacatccttcagtga 420
>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence Length = 1177 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 413 accttcaccaatcagatgcagacatccttcagtga 447
>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA, complete cds Length = 1137 Score = 204 bits (103), Expect = 2e-49 Identities = 232/275 (84%) Strand = Plus / Plus Query: 173 accaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgacggtatt 232 |||||||| ||| ||| ||||| |||||| ||||||| |||| | |||| || |||||| Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204 Query: 233 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 292 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264 Query: 293 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 352 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 265 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 324 Query: 353 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggt 412 || | |||||||| ||||||||||| || || ||||||||||| || |||||||||||| Sbjct: 325 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 384 Query: 413 acattcaccaaccagatgcaaacttcgttcagtga 447 || |||||||| |||||||| || || |||||||| Sbjct: 385 accttcaccaatcagatgcagacatccttcagtga 419
>gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence Length = 405672 Score = 188 bits (95), Expect = 1e-44 Identities = 137/151 (90%) Strand = Plus / Minus Query: 313 catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 372 |||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |||| Sbjct: 25882 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 25823 Query: 373 cactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgca 432 |||||||||| | |||||||| || |||||||||||||||||||||||||||||| |||| Sbjct: 25822 cactggtgctcatgccattgccggcaggcacactcctggtacattcaccaaccagttgca 25763 Query: 433 aacttcgttcagtgagccacgccttcttatc 463 ||| || ||||| |||||||||||||||||| Sbjct: 25762 aacctccttcagcgagccacgccttcttatc 25732 Score = 73.8 bits (37), Expect = 4e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 128 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaa 180 |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| Sbjct: 26632 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaa 26580 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 276 ||||| |||||||| ||||||||||||||||| |||||||||||| |||| Sbjct: 25949 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 25900
>gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence Length = 323584 Score = 188 bits (95), Expect = 1e-44 Identities = 137/151 (90%) Strand = Plus / Minus Query: 313 catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 372 |||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |||| Sbjct: 6056 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 5997 Query: 373 cactggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgca 432 |||||||||| | |||||||| || |||||||||||||||||||||||||||||| |||| Sbjct: 5996 cactggtgctcatgccattgccggcaggcacactcctggtacattcaccaaccagttgca 5937 Query: 433 aacttcgttcagtgagccacgccttcttatc 463 ||| || ||||| |||||||||||||||||| Sbjct: 5936 aacctccttcagcgagccacgccttcttatc 5906 Score = 73.8 bits (37), Expect = 4e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 128 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaa 180 |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| Sbjct: 6806 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaa 6754 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 276 ||||| |||||||| ||||||||||||||||| |||||||||||| |||| Sbjct: 6123 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 6074
>emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40 Length = 3690 Score = 184 bits (93), Expect = 2e-43 Identities = 189/221 (85%) Strand = Plus / Plus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 2279 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 2338 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 2339 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 2398 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 2399 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 2458 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtga 447 |||||||| |||||||| |||||||| || || |||||||| Sbjct: 2459 cctggtaccttcaccaatcagatgcagacatccttcagtga 2499
>emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene Length = 2049 Score = 184 bits (93), Expect = 2e-43 Identities = 189/221 (85%) Strand = Plus / Plus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 768 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 827 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 828 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 887 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 888 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 947 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtga 447 |||||||| |||||||| |||||||| || || |||||||| Sbjct: 948 cctggtaccttcaccaatcagatgcagacatccttcagtga 988
>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete sequence Length = 87039 Score = 184 bits (93), Expect = 2e-43 Identities = 189/221 (85%) Strand = Plus / Plus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 69070 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 69129 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 69130 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 69189 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 69190 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 69249 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtga 447 |||||||| |||||||| |||||||| || || |||||||| Sbjct: 69250 cctggtaccttcaccaatcagatgcagacatccttcagtga 69290
>ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constituent of ribosome AT3G04770 (RPSAB) transcript variant AT3G04770.1 mRNA, complete cds Length = 1200 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402
>ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constituent of ribosome AT3G04770 (RPSAB) transcript variant AT3G04770.2 mRNA, complete cds Length = 1124 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402
>gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal protein (At3g04770/F7O18_26) mRNA, complete cds Length = 999 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 145 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 204 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 205 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 264 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 265 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 324 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 325 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 371
>gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, complete cds Length = 1157 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 356 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 402
>gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete sequence Length = 1027 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 178 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 237 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 238 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 297 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 298 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 357 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 358 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 404
>gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mRNA, complete cds Length = 1105 Score = 172 bits (87), Expect = 7e-40 Identities = 192/227 (84%) Strand = Plus / Plus Query: 224 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 283 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 157 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 216 Query: 284 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 343 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 217 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 276 Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 277 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 336 Query: 404 actcctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 ||||||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 337 actcctggtactttcactaaccaaatgcagacttctttcagtgagcc 383
>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40 Length = 1169 Score = 170 bits (86), Expect = 3e-39 Identities = 257/314 (81%) Strand = Plus / Plus Query: 134 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 193 ||||||||||||||| | || ||||| || |||||||| ||||||||||| | |||||| Sbjct: 114 gacatccagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccag 173 Query: 194 acggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 253 | |||||| ||| | | || ||||||| ||| |||||||| || || || ||||| ||| Sbjct: 174 atggagcgttacatttttaaacgccgcaatgatggtatttatatcataaatcttggaaag 233 Query: 254 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 313 || ||||| || ||| | | || || ||| |||||||||| ||||| || | |||||| Sbjct: 234 acatgggataaacttaaccttgctgctaggatcattgttgccattgagaattctcaggac 293 Query: 314 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 373 |||||||| |||||||| || || |||||||| || ||||||||||| ||||| |||||| Sbjct: 294 atcattgttcaatctgcaagaccttatggacaaagagctgttctcaaatttgctcagtac 353 Query: 374 actggtgctaacgccattgctggtaggcacactcctggtacattcaccaaccagatgcaa 433 ||||| ||| | || |||||||| |||||||||||||| || |||||||| ||| | ||| Sbjct: 354 actggagctcatgctattgctggaaggcacactcctggaaccttcaccaatcagctacaa 413 Query: 434 acttcgttcagtga 447 ||||| |||||||| Sbjct: 414 acttccttcagtga 427
>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequence Length = 95310 Score = 167 bits (84), Expect = 4e-38 Identities = 189/224 (84%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||||| Sbjct: 88836 ggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagggtt 88777 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||||| Sbjct: 88776 attgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatggacaa 88717 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || ||||| | |||||||| ||||||||||||| ||| || |||||||| || |||||| Sbjct: 88716 agagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacacact 88657 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagcc 450 |||||||| ||||| ||||| ||||| ||||| ||||||||||| Sbjct: 88656 cctggtactttcactaaccaaatgcagacttctttcagtgagcc 88613
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 157 bits (79), Expect = 4e-35 Identities = 103/111 (92%) Strand = Plus / Minus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 4320455 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320396 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgc 220 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| Sbjct: 4320395 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320345 Score = 129 bits (65), Expect = 9e-27 Identities = 164/197 (83%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 4319939 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319880 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 4319879 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319820 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| || Sbjct: 4319819 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 4319760 Query: 407 cctggtacattcaccaa 423 ||||||||||| ||||| Sbjct: 4319759 cctggtacatttaccaa 4319743 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 tgctcgccgccgacgtccacctcg 170 ||||||||||||||||| |||||| Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027
>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0032G08, from Chromosome 3, complete sequence Length = 122052 Score = 157 bits (79), Expect = 4e-35 Identities = 103/111 (92%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 106042 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 106101 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgc 220 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| Sbjct: 106102 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 106152 Score = 129 bits (65), Expect = 9e-27 Identities = 164/197 (83%) Strand = Plus / Plus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 106558 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 106617 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 106618 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 106677 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| || Sbjct: 106678 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 106737 Query: 407 cctggtacattcaccaa 423 ||||||||||| ||||| Sbjct: 106738 cctggtacatttaccaa 106754
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 157 bits (79), Expect = 4e-35 Identities = 103/111 (92%) Strand = Plus / Minus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 169 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 4320570 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320511 Query: 170 ggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgc 220 ||||||||||||||||| ||||||| ||||||||||||||||||||||||| Sbjct: 4320510 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320460 Score = 129 bits (65), Expect = 9e-27 Identities = 164/197 (83%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 4320054 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319995 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 4319994 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319935 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| || Sbjct: 4319934 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacg 4319875 Query: 407 cctggtacattcaccaa 423 ||||||||||| ||||| Sbjct: 4319874 cctggtacatttaccaa 4319858 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 tgctcgccgccgacgtccacctcg 170 ||||||||||||||||| |||||| Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660
>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds Length = 1111 Score = 151 bits (76), Expect = 2e-33 Identities = 241/296 (81%) Strand = Plus / Plus Query: 167 ctcggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgcactgac 226 ||||||||||| ||||| |||||||||| |||||| || |||| ||||||||| | || Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212 Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 |||||||| || ||||| | || ||||| |||||||||||| | |||| || ||||| Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagcttatgttggctgctagggtt 272 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 |||||| | ||||| || ||||||||||||||||| || ||||||||||| || || ||| Sbjct: 273 attgtttctattgagaatccccaggacatcattgtccagtctgctaggccttacggtcag 332 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || ||||| | |||||||| ||||| ||||||||| | || ||||||||| | |||||| Sbjct: 333 agagctgtcttgaagtttgctcagtatactggtgctcatgctattgctggtcgtcacact 392 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttcttat 462 || || || |||||||| ||| | || || ||||| || ||||| || |||||||| Sbjct: 393 cccggaactttcaccaatcagcttcagacgtcgtttagcgagcctcgtcttcttat 448
>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds Length = 1061 Score = 141 bits (71), Expect = 2e-30 Identities = 242/299 (80%) Strand = Plus / Plus Query: 161 gtccacctcggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgc 220 ||||||||||| || |||||||| || ||||| | ||| || ||||||| |||||| ||| Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162 Query: 221 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 280 | |||||||| || ||||| ||| ||| ||||| ||||| ||||| || ||||| || Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagctgcatatggcagct 222 Query: 281 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 340 || || |||||| | ||||| || || ||||||||||||||||||||||| ||||||||| Sbjct: 223 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 282 Query: 341 ggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtagg 400 |||||||| || || | ||||| || || || |||||||| | ||||||||||| | Sbjct: 283 ggacagagagccgtcttgaagttcgcacaatatactggtgcacatgccattgctggccgt 342 Query: 401 cacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 ||||| |||||||| || ||||| ||| | || ||||| | |||||||||||| ||||| Sbjct: 343 cacacccctggtacctttaccaatcagcttcagacttcatacagtgagccacgacttct 401
>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence Length = 114535 Score = 137 bits (69), Expect = 4e-29 Identities = 192/233 (82%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 |||||||| || || || ||||| || || |||||||| ||||| | || || |||||| Sbjct: 42238 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 42179 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 || ||||| || || |||||||||||||| ||||| |||||||| ||||| ||||||||| Sbjct: 42178 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 42119 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || || ||||| |||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 42118 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 42059 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 ||||| || || || || || |||||| ||| ||||||||||| || ||||| Sbjct: 42058 cctggaacctttactaatcaaatgcaagtttccttcagtgagcctcgtcttct 42006 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 134 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttcca 192 ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| Sbjct: 42991 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttcca 42933
>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence Length = 127701 Score = 137 bits (69), Expect = 4e-29 Identities = 192/233 (82%) Strand = Plus / Minus Query: 227 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 286 |||||||| || || || ||||| || || |||||||| ||||| | || || |||||| Sbjct: 7758 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 7699 Query: 287 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 346 || ||||| || || |||||||||||||| ||||| |||||||| ||||| ||||||||| Sbjct: 7698 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 7639 Query: 347 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 406 || || ||||| |||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 7638 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 7579 Query: 407 cctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 ||||| || || || || || |||||| ||| ||||||||||| || ||||| Sbjct: 7578 cctggaacctttactaatcaaatgcaagtttccttcagtgagcctcgtcttct 7526 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 134 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttcca 192 ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| Sbjct: 8511 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttcca 8453
>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like mRNA, complete cds Length = 1106 Score = 133 bits (67), Expect = 6e-28 Identities = 241/299 (80%) Strand = Plus / Plus Query: 161 gtccacctcggcaccaagaactgcgatttccagacggagcgctacgtctacaagcgccgc 220 ||||||||||| || |||||||| || ||||| | ||| || ||||||| |||||| ||| Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173 Query: 221 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 280 | |||||||| |||||||| ||| ||| ||||| ||||| ||||| || ||||| || Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagctgcatatggcagct 233 Query: 281 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 340 || || |||||| | ||||| || || ||||||||||||||||||||||| ||||||||| Sbjct: 234 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 293 Query: 341 ggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtagg 400 |||||||| || || | ||||| || || || |||||||| | ||||||||||| | Sbjct: 294 ggacagagagccgtcttgaagttcgcacaatatactggtgcacatgccattgctggccgt 353 Query: 401 cacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgccttct 459 ||||| |||||||| || || || ||| | || ||||| | ||| |||||||| ||||| Sbjct: 354 cacacccctggtacctttacgaatcagcttcagacttcatacagcgagccacgacttct 412
>emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH91ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1125 Score = 121 bits (61), Expect = 2e-24 Identities = 169/205 (82%) Strand = Plus / Plus Query: 243 accttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaa 302 |||||||||||| ||||| ||||| |||||||| || || || |||||||| ||||| | Sbjct: 232 accttggcaagagatgggaaaagctccagatggctgctagagttattgttgccattgaga 291 Query: 303 acccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagt 362 |||| ||| ||||||| || || | |||||||||||||||||||| |||||| | |||| Sbjct: 292 acccacagaacatcatcgtccagtgagctaggccctatggacagagagctgttttgaagt 351 Query: 363 ttgcccagtacactggtgctaacgccattgctggtaggcacactcctggtacattcacca 422 |||| ||||| ||||| || || |||||| |||| || | ||||||||||| ||||| | Sbjct: 352 ttgctcagtagactggagcgaatgccatttctggcagaaaaactcctggtaccttcacaa 411 Query: 423 accagatgcaaacttcgttcagtga 447 | |||||||| || || |||||||| Sbjct: 412 atcagatgcagacatccttcagtga 436
>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full insert sequence Length = 1144 Score = 119 bits (60), Expect = 8e-24 Identities = 105/120 (87%) Strand = Plus / Plus Query: 202 ctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctggga 261 ||||||||||||||||||| | || ||||| ||||| |||||||| |||||||| ||||| Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225 Query: 262 gaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgt 321 |||||| ||| | || || ||||| |||||||| ||||| |||||||||||||||||||| Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgt 285 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Plus Query: 110 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtc 163 ||||||||||| ||| ||||||||| | |||||||||||||||||| ||||| Sbjct: 119 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgcctacgtc 172
>gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb001_104_J07, complete sequence Length = 103334 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 338 tatggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggt 397 ||||| ||||| || |||||||||||||| ||||||| ||||||| | ||||||||||| Sbjct: 67616 tatgggcagagagcagttctcaagtttgctcagtacattggtgcttatgccattgctgga 67557 Query: 398 aggcacactcctggtacattcaccaaccagatgcaaacttcgttcagtgagccacgcctt 457 ||||| || | || ||| |||| ||| || | |||||||| |||||||||| |||||| Sbjct: 67556 aggcatacccttgatactttcaacaattagcttcaaacttccttcagtgagcatcgcctt 67497 Query: 458 ct 459 || Sbjct: 67496 ct 67495
>gb|BT017775.1| Zea mays clone EL01N0502H12.c mRNA sequence Length = 903 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 344 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 403 |||||||||| ||||| ||||| | | |||||||||| ||||||||||| |||||| Sbjct: 5 cagagggctgacctcaaatttgcgctgaacactggtgcccgtgccattgctggaaggcac 64 Query: 404 actcctggtacattcaccaacca 426 ||||||||||||| |||| |||| Sbjct: 65 actcctggtacatacaccgacca 87
>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA Length = 2515 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 1683 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 1742 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 1743 ggcaagacctgggagaagctgcagctggc 1771
>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence Length = 627 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 195 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 196 ggcaagacctgggagaagctgcagctggc 224
>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence Length = 579 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 61 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 120 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 121 ggcaagacctgggagaagctgcagctggc 149
>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7 Length = 45861 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 16963 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 16904 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 16903 ggcaagacctgggagaagctgcagctggc 16875
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181360 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 159534 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 159475 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 159474 ggcaagacctgggagaagctgcagctggc 159446
>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA Length = 1104 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362
>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA Length = 964 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 759 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 700 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 699 ggcaagacctgggagaagctgcagctggc 671
>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D (sta), mRNA Length = 1041 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 223 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 282 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 283 ggcaagacctgggagaagctgcagctggc 311
>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B (sta), mRNA Length = 1089 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362
>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end Length = 1272 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 176 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 235 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 236 ggcaagacctgggagaagctgcagctggc 264
>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A (sta), mRNA Length = 1236 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 421 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 480 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 481 ggcaagacctgggagaagctgcagctggc 509
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 22118 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 22059 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 22058 ggcaagacctgggagaagctgcagctggc 22030
>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds Length = 902 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 93 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 152 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 153 ggcaagacctgggagaagctgcagctggc 181
>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds Length = 1545 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 247 ||||||| ||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 723 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 782 Query: 248 ggcaagacctgggagaagcttcagatggc 276 |||||||||||||||||||| ||| |||| Sbjct: 783 ggcaagacctgggagaagctgcagctggc 811
>gb|AY857457.1| Suberites domuncula SA mRNA, complete cds Length = 978 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Plus Query: 354 ttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcctggta 413 |||||||||||||||| |||||||| || | ||||||||||| | ||||||||||| Sbjct: 260 ttctcaagtttgcccactacactggrgccttccccattgctggtcgtttcactcctggta 319 Query: 414 cattcaccaaccagat 429 | ||||| |||||||| Sbjct: 320 cgttcactaaccagat 335
>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 499 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197
>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 198
>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215
>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 206
>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 96 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 154
>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 164 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 222
>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 296 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 212
>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 981 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 923
>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1027 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 223
>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 818 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219
>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219
>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 426 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 228
>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 216
>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207
>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 214
>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208
>emb|BX025854.1|CNS08S42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 394 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 210
>emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 343 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX020718.1|CNS08O5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207
>emb|BX015795.1|CNS08KCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208
>emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197
>emb|BX015037.1|CNS08JRL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215
>emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 671 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203
>emb|BX012242.1|CNS08HLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 359 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203
>emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 289 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 126 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 184
>emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226
>ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 (ENSANGG00000017682), partial mRNA Length = 803 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226
>ref|XM_655684.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3172.2), mRNA Length = 843 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 237 ttatcaaccttggcaagacctgggagaag 265 |||||||| |||||||||||||||||||| Sbjct: 149 ttatcaacgttggcaagacctgggagaag 177
>emb|BX006256.1|CNS08CZO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 50.1 bits (25), Expect = 0.007 Identities = 52/61 (85%) Strand = Plus / Plus Query: 186 atttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacc 245 ||||||||| ||||| ||||| |||||||||||||| |||||| | |||| ||||||| Sbjct: 134 atttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193 Query: 246 t 246 | Sbjct: 194 t 194
>dbj|AB032439.1| Drosophila orena sta gene for stubarista, partial cds Length = 1371 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 240 tcaaccttggcaagacctgggagaagcttcagatggc 276 ||||||| |||||||||||||||||||| ||| |||| Sbjct: 608 tcaacctaggcaagacctgggagaagctgcagctggc 644
>ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predicted mRNA Length = 726 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Plus Query: 234 acattatcaaccttggcaagacctgggagaag 265 |||| |||||| |||||||||||||||||||| Sbjct: 47 acatcatcaacgttggcaagacctgggagaag 78
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica Length = 2303261 Score = 48.1 bits (24), Expect = 0.026 Identities = 30/32 (93%) Strand = Plus / Plus Query: 234 acattatcaaccttggcaagacctgggagaag 265 |||| |||||| |||||||||||||||||||| Sbjct: 1902094 acatcatcaacgttggcaagacctgggagaag 1902125
>ref|XM_527842.1| PREDICTED: Pan troglodytes similar to monoacylglycerol O-acyltransferase 3; acyl coenzyme A:monoacylglycerol acyltransferase 3 (LOC472468), mRNA Length = 1623 Score = 46.1 bits (23), Expect = 0.10 Identities = 47/55 (85%) Strand = Plus / Plus Query: 253 gacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccc 307 ||||||||||||||||| | |||| || | | ||||||||| |||||||||||| Sbjct: 48 gacctgggagaagcttctgctggcagctcgtggcattgttgccattgaaaacccc 102
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 237 ttatcaaccttggcaagacctgggagaagct 267 |||||||| | |||||||||||||||||||| Sbjct: 1158853 ttatcaacgtcggcaagacctgggagaagct 1158823 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 163 ccacctcggcaccaagaactgcga 186 ||||||||| |||||||||||||| Sbjct: 1158980 ccacctcggtaccaagaactgcga 1158957
>ref|XM_572918.1| Cryptococcus neoformans var. neoformans JEC21 40S ribosomal protein S0 (CNI04340) partial mRNA Length = 1619 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Plus Query: 237 ttatcaaccttggcaagacctgggagaagct 267 |||||||| | |||||||||||||||||||| Sbjct: 250 ttatcaacgtcggcaagacctgggagaagct 280 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 163 ccacctcggcaccaagaactgcga 186 ||||||||| |||||||||||||| Sbjct: 176 ccacctcggtaccaagaactgcga 199
>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163
>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223
>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198
>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193
>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 99 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 157
>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 260 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 116 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 174
>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 584 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 582 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207
>emb|BX069252.1|CNS09PLK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181
>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 572 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 962 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 904
>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 162 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 220
>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897
>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 194
>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 609 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 781 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196
>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 169 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 227
>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 642 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| || || ||||||||||||||||||||| | |||| |||||||| Sbjct: 954 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 896
>emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| || || ||||||||||||||||||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 211
>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacct 897
>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 457 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198
>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 319 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 348 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196
>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 93 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 151
>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 131 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 189
>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 617 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 193 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 97 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 155
>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 107 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 165
>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 977 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 919
>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187
>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 58 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 116
>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 285 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 228
>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181
>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 715 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 808 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163
>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 425 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 121 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 179
>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 163 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 221
>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 338 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186
>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 215
>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 166 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 224
>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186
>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195
>emb|BX041242.1|CNS093ZI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 864 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 806
>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180
>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 226
>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 343 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193
>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 83 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 141
>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195
>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180
>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 216
>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 82 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 140
>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187
>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207
>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1018 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897
>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1079 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 650 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 979 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 921
>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1027 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 991 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 933
>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1033 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223
>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Minus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 984 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 926
>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 397 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 46.1 bits (23), Expect = 0.10 Identities = 50/59 (84%) Strand = Plus / Plus Query: 188 ttccagacggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 246 ||||||| ||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,179,479 Number of Sequences: 3902068 Number of extensions: 3179479 Number of successful extensions: 70038 Number of sequences better than 10.0: 500 Number of HSP's better than 10.0 without gapping: 441 Number of HSP's successfully gapped in prelim test: 61 Number of HSP's that attempted gapping in prelim test: 69111 Number of HSP's gapped (non-prelim): 900 length of query: 465 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 443 effective length of database: 17,147,199,772 effective search space: 7596209498996 effective search space used: 7596209498996 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
