ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet113f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 458 e-126
2dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 450 e-123
3dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 450 e-123
4gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 379 e-102
5emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 335 8e-89
6gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 289 4e-75
7gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 254 2e-64
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 254 2e-64
9dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 254 2e-64
10ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 190 3e-45
11emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 190 3e-45
12gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 190 3e-45
13dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 190 3e-45
14dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 190 3e-45
15dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 190 3e-45
16dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 190 3e-45
17emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 186 4e-44
18gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 184 2e-43
19gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 184 2e-43
20gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 184 2e-43
21dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
22dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
23dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 182 7e-43
24dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
25dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
26dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
27dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 7e-43
28gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 176 4e-41
29emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 174 2e-40
30dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
31gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 172 7e-40
32dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 170 3e-39
33emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 167 4e-38
34gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 167 4e-38
35dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 167 4e-38
36ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 163 6e-37
37gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 163 6e-37
38dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 163 6e-37
39emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 163 6e-37
40dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
41dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
42dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
43dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
44emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 159 1e-35
45emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 155 2e-34
46gb|AY109324.1| Zea mays CL187_1 mRNA sequence 155 2e-34
47gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 155 2e-34
48gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 153 6e-34
49gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 153 6e-34
50emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 153 6e-34
51emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 151 2e-33
52emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 149 9e-33
53gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 147 4e-32
54emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 145 1e-31
55emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 143 6e-31
56emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 141 2e-30
57gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 139 9e-30
58dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 137 4e-29
59dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 133 6e-28
60ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 131 2e-27
61ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
62ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
63ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
64ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
65ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
66ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
67ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 131 2e-27
68dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
69dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 131 2e-27
70dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
71dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
72dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
73dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
74dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
75dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
76dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
77dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
78dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
79dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 131 2e-27
80gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 127 3e-26
81gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 125 1e-25
82gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 125 1e-25
83gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 125 1e-25
84emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 123 5e-25
85dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
86emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 119 8e-24
87gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 119 8e-24
88gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 117 3e-23
89gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 115 1e-22
90emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 115 1e-22
91gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 115 1e-22
92gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 115 1e-22
93gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 115 1e-22
94dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 113 5e-22
95emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 113 5e-22
96gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 111 2e-21
97emb|X61915.1|PTCABP P.thunbergii cab gene 109 8e-21
98gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 109 8e-21
99gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 107 3e-20
100dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 107 3e-20
101dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 107 3e-20
102ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 105 1e-19
103gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 105 1e-19
104gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 105 1e-19
105emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
106emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
107emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
108emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
109emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
110emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
111emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
112emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
113emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
114dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 105 1e-19
115gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 105 1e-19
116gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 105 1e-19
117emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 105 1e-19
118gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 105 1e-19
119gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 105 1e-19
120gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 103 5e-19
121emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 103 5e-19
122emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 103 5e-19
123dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 103 5e-19
124dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 103 5e-19
125gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 101 2e-18
126gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 101 2e-18
127gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 101 2e-18
128gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 101 2e-18
129gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 101 2e-18
130gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 101 2e-18
131dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 100 8e-18
132dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 100 8e-18
133dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 98 3e-17
134emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 96 1e-16
135emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 96 1e-16
136gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 96 1e-16
137dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 96 1e-16
138dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 96 1e-16
139ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 94 5e-16
140emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 94 5e-16
141gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 94 5e-16
142gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 94 5e-16
143gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 94 5e-16
144gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 94 5e-16
145gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 94 5e-16
146gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 94 5e-16
147emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
148emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
149emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
150emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
151emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
152gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 94 5e-16
153emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 94 5e-16
154emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 94 5e-16
155gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 94 5e-16
156gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 92 2e-15
157gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 92 2e-15
158emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 92 2e-15
159emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 90 8e-15
160emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 90 8e-15
161gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 88 3e-14
162gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 88 3e-14
163gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 88 3e-14
164ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 86 1e-13
165ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 86 1e-13
166ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 86 1e-13
167ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 86 1e-13
168gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 86 1e-13
169gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 86 1e-13
170gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 86 1e-13
171gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 86 1e-13
172gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 86 1e-13
173gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 86 1e-13
174gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 1e-13
175gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 1e-13
176gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 86 1e-13
177gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 1e-13
178gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 1e-13
179gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 1e-13
180gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 86 1e-13
181gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 86 1e-13
182emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
183emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
184emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
185emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 86 1e-13
186emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 84 5e-13
187gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 84 5e-13
188gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 82 2e-12
189ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 80 7e-12
190gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 80 7e-12
191gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 80 7e-12
192emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 80 7e-12
193gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 80 7e-12
194gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 80 7e-12
195gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 80 7e-12
196emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 80 7e-12
197gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 80 7e-12
198emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 80 7e-12
199gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 80 7e-12
200dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 80 7e-12
201dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 80 7e-12
202ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 78 3e-11
203ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 78 3e-11
204gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 78 3e-11
205gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 78 3e-11
206gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 78 3e-11
207gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 78 3e-11
208gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 78 3e-11
209gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 78 3e-11
210gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 78 3e-11
211gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 3e-11
212gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 78 3e-11
213gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 3e-11
214emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
215emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
216emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
217emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
218gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 78 3e-11
219emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 78 3e-11
220gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 76 1e-10
221emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 76 1e-10
222emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 76 1e-10
223gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 76 1e-10
224gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 76 1e-10
225gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 76 1e-10
226gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 74 4e-10
227gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 72 2e-09
228gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 72 2e-09
229gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 72 2e-09
230gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 72 2e-09
231emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 72 2e-09
232gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 72 2e-09
233gb|M64619.1|PEACAB66 Pea cab gene, complete cds 72 2e-09
234gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 72 2e-09
235gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 70 7e-09
236gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 70 7e-09
237gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 70 7e-09
238gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 70 7e-09
239gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 70 7e-09
240gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 70 7e-09
241gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 70 7e-09
242emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
243emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
244emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 70 7e-09
245gb|AY112240.1| Zea mays CL187_6 mRNA sequence 70 7e-09
246gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 68 3e-08
247ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 66 1e-07
248gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 66 1e-07
249gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 66 1e-07
250gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 66 1e-07
251gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 66 1e-07
252ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 64 4e-07
253gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 64 4e-07
254gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 64 4e-07
255gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 64 4e-07
256gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 64 4e-07
257gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 64 4e-07
258gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 64 4e-07
259gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 64 4e-07
260gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 64 4e-07
261emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
262gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 64 4e-07
263emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 64 4e-07
264emb|X76632.1|PPCAB P.patens (Hedw.) B.S.G. partial mRNA for chlo... 64 4e-07
265emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 64 4e-07
266gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 64 4e-07
267dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 64 4e-07
268gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 62 2e-06
269gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 62 2e-06
270emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 62 2e-06
271emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 62 2e-06
272emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 62 2e-06
273gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 62 2e-06
274gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 62 2e-06
275emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 62 2e-06
276gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 62 2e-06
277gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 60 7e-06
278gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 60 7e-06
279dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 58 3e-05
280emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 56 1e-04
281emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 56 1e-04
282gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 56 1e-04
283gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 56 1e-04
284dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 56 1e-04
285emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 54 4e-04
286gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 54 4e-04
287emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 54 4e-04
288emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 54 4e-04
289gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 54 4e-04
290dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 54 4e-04
291gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, par... 52 0.002
292emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 52 0.002
293gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 52 0.002
294gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 50 0.006
295emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 50 0.006
296gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 50 0.006
297emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 50 0.006
298emb|X16535.1|GMCAB4 G.max DNA for Cab4 50 0.006
299emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 50 0.006
300dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 50 0.006
301gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 48 0.026
302gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 48 0.026
303gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 48 0.026
304emb|X16536.1|GMCAB5 G.max DNA for Cab5 48 0.026
305gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 48 0.026
306emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 48 0.026
307dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 48 0.026
308ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 46 0.10
309gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence 46 0.10
310gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 46 0.10
311gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 46 0.10
312gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 46 0.10
313gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 46 0.10
314gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 46 0.10
315gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 46 0.10
316emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 46 0.10
317emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 46 0.10
318gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 46 0.10
319gb|M30396.1|PMJCABF7 Polystichum munitum chlorophyll a/b-binding... 46 0.10
320gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 44 0.40
321emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 44 0.40
322emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 44 0.40
323emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 44 0.40
324gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 44 0.40
325gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding... 44 0.40
326dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 44 0.40
327ref|XM_419622.1| PREDICTED: Gallus gallus similar to solute carr... 42 1.6
328gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-b... 42 1.6
329gb|AE005806.1| Caulobacter crescentus CB15 section 132 of 359 of... 42 1.6
330emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 42 1.6
331gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 42 1.6
332gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 42 1.6
333gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 42 1.6
334dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro... 42 1.6
335gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 6.3
336gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi... 40 6.3
337gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 40 6.3
338emb|BX640437.1| Bordetella bronchiseptica strain RB50, complete ... 40 6.3
339emb|BX640423.1| Bordetella parapertussis strain 12822, complete ... 40 6.3
340emb|BX640413.1| Bordetella pertussis strain Tohama I, complete g... 40 6.3
341emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 6.3
342emb|BX294149.1| Pirellula sp. strain 1 complete genome; segment ... 40 6.3
343gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.3
344gb|AC158513.2| Mus musculus BAC clone RP24-404N1 from chromosome... 40 6.3
345gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 6.3
346gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 6.3
347dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 6.3
348emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 40 6.3
349emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 40 6.3
350emb|CT486009.11| Mouse DNA sequence from clone RP24-160E3 on chr... 40 6.3
351emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 6.3
352emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20... 40 6.3
353dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 40 6.3

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  458 bits (231), Expect = e-126
 Identities = 348/387 (89%)
 Strand = Plus / Plus

                                                                       
Query: 78  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 41  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 100

                                                                       
Query: 138 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
           || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 101 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 160

                                                                       
Query: 198 agcgcgccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctcc 257
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| 
Sbjct: 161 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 220

                                                                       
Query: 258 gagcagaccccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcg 317
           |||||||| || |||||||||||||| |||||||| || ||||||||||||||||| |||
Sbjct: 221 gagcagacgccatcgtacctgaccggagagttcccgggagactacgggtgggacacggcg 280

                                                                       
Query: 318 ggattgtcggctgacccagagaccttcgccaagaacagggagctggaggtgatccactcg 377
           ||  | ||||| ||||| ||||| ||||| | ||||||||||||||||||||||||||||
Sbjct: 281 gggctatcggccgacccggagacgttcgcgaggaacagggagctggaggtgatccactcg 340

                                                                       
Query: 378 cggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggc 437
           |||||||||||||| || || || || ||||| ||||| |||||||||||||||||||| 
Sbjct: 341 cggtgggcgatgctgggggcgctgggctgcgtcttcccggagatcctgtccaagaacggg 400

                                      
Query: 438 atcaagttcggcgaggctgtctggttc 464
            | |||||||| ||||| || ||||||
Sbjct: 401 gtgaagttcggggaggcggtgtggttc 427



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  450 bits (227), Expect = e-123
 Identities = 347/387 (89%)
 Strand = Plus / Plus

                                                                       
Query: 78  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 52  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 111

                                                                       
Query: 138 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
           || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 112 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 171

                                                                       
Query: 198 agcgcgccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctcc 257
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| 
Sbjct: 172 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 231

                                                                       
Query: 258 gagcagaccccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcg 317
           |||||||| || |||||||||||||| |||||||| || |||||| |||||||||| |||
Sbjct: 232 gagcagacgccatcgtacctgaccggagagttcccgggagactacaggtgggacacggcg 291

                                                                       
Query: 318 ggattgtcggctgacccagagaccttcgccaagaacagggagctggaggtgatccactcg 377
           ||  | ||||| ||||| ||||| ||||| | ||||||||||||||||||||||||||||
Sbjct: 292 gggctatcggccgacccggagacgttcgcgaggaacagggagctggaggtgatccactcg 351

                                                                       
Query: 378 cggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggc 437
           |||||||||||||| || || || || ||||| ||||| |||||||||||||||||||| 
Sbjct: 352 cggtgggcgatgctgggggcgctgggctgcgtcttcccggagatcctgtccaagaacggg 411

                                      
Query: 438 atcaagttcggcgaggctgtctggttc 464
            | |||||||| ||||| || ||||||
Sbjct: 412 gtgaagttcggggaggcggtgtggttc 438



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  450 bits (227), Expect = e-123
 Identities = 347/387 (89%)
 Strand = Plus / Plus

                                                                       
Query: 78  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
           |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 33  atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 92

                                                                       
Query: 138 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
           ||| |||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 93  gacgtcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 152

                                                                       
Query: 198 agcgcgccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctcc 257
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| 
Sbjct: 153 agcgcgccccagagcatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 212

                                                                       
Query: 258 gagcagaccccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcg 317
           |||||||| || |||||||||||||| |||||||| || ||||||||||||||||| |||
Sbjct: 213 gagcagacgccatcgtacctgaccggagagttcccgggagactacgggtgggacacggcg 272

                                                                       
Query: 318 ggattgtcggctgacccagagaccttcgccaagaacagggagctggaggtgatccactcg 377
           ||  | ||||| ||||| ||||| ||||| | |||||||||||||||| |||||||||||
Sbjct: 273 gggctatcggccgacccggagacgttcgcgaggaacagggagctggagttgatccactcg 332

                                                                       
Query: 378 cggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggc 437
           |||||||||||||| || || || || ||||| ||||| |||||||||||||||||||| 
Sbjct: 333 cggtgggcgatgctgggggcgctgggctgcgtcttcccggagatcctgtccaagaacggg 392

                                      
Query: 438 atcaagttcggcgaggctgtctggttc 464
            | |||||||| ||||| || ||||||
Sbjct: 393 gtgaagttcggggaggcggtgtggttc 419



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  379 bits (191), Expect = e-102
 Identities = 317/359 (88%)
 Strand = Plus / Plus

                                                                       
Query: 78  atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
           ||||||||||||||||||||||| || ||||||||||||||||||||||| || || |||
Sbjct: 48  atggccgcgtcggcgctgcaccaaaccaccagcttcctcggcaccgcccctcgccgggat 107

                                                                       
Query: 138 gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
           || ||||||||| |||||||| ||| ||| |||||||||||||||||||| |||||||||
Sbjct: 108 gagctcgtccgccgcgtcggcaactccggtggccgcatcaccatgcgccgcaccgtcaag 167

                                                                       
Query: 198 agcgcgccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctcc 257
           ||||||||||| | ||||||||| || |||||||||||||||||||||||||||||||| 
Sbjct: 168 agcgcgccccaaaacatctggtatggacctgaccgtcccaagtacctgggcccgttctcg 227

                                                                       
Query: 258 gagcagaccccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcg 317
           || || || || ||||||||||||||  ||||||| || ||||||||||||||||| |||
Sbjct: 228 gaacaaacgccatcgtacctgaccggaaagttcccgggagactacgggtgggacacggcg 287

                                                                       
Query: 318 ggattgtcggctgacccagagaccttcgccaagaacagggagctggaggtgatccactcg 377
           ||  | ||||| ||||| ||||| ||||| | ||||||||||||||||||||||||||| 
Sbjct: 288 gggctatcggccgacccggagacgttcgcgaggaacagggagctggaggtgatccactcc 347

                                                                      
Query: 378 cggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacgg 436
           |||||||| ||||| || || || || ||| | ||||||||||||||||||||||||||
Sbjct: 348 cggtgggcaatgctgggggcgctgggctgcttcttccccgagatcctgtccaagaacgg 406



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  335 bits (169), Expect = 8e-89
 Identities = 268/301 (89%)
 Strand = Plus / Plus

                                                                       
Query: 164 cggcggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacgg 223
           |||||||||||||||||||||||| |||||||||||||  ||||||||||| ||||||||
Sbjct: 123 cggcggccgcatcaccatgcgccgcaccgtcaagagcgttccccagagcatatggtacgg 182

                                                                       
Query: 224 ccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccgg 283
           |||||| || |||||||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 183 ccctgatcgccccaagtatcttggcccgttctccgagcagacgccgtcgtacctgaccgg 242

                                                                       
Query: 284 cgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagacctt 343
           ||||||||||||||||||||||||||| ||||| ||  | ||||| ||||| ||||| ||
Sbjct: 243 cgagttccccggcgactacgggtgggagaccgccggcgtctcggccgacccggagacatt 302

                                                                       
Query: 344 cgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcgg 403
           |||    ||| |||||||||||||||||||||| |||||||||||||| || || || ||
Sbjct: 303 cgcgcgcaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgctggg 362

                                                                       
Query: 404 gtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggtt 463
            ||||||||||| ||||||||| ||||||||||| |||||||||||||||| || |||||
Sbjct: 363 ctgcgtgttcccggagatcctggccaagaacggcgtcaagttcggcgaggcggtgtggtt 422

            
Query: 464 c 464
           |
Sbjct: 423 c 423



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 78  atggccgcgtcggcgctgcaccagacgaccagcttcctcgg 118
           ||||||||||||  |||||||||||| ||||||||||||||
Sbjct: 46  atggccgcgtcgcggctgcaccagaccaccagcttcctcgg 86



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  289 bits (146), Expect = 4e-75
 Identities = 251/286 (87%)
 Strand = Plus / Plus

                                                                       
Query: 179 catgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgtcccaa 238
           |||||||||||| ||||||||||| ||||||||||||||||| || || |||||||||||
Sbjct: 159 catgcgccggactgtcaagagcgctccccagagcatctggtatgggccagaccgtcccaa 218

                                                                       
Query: 239 gtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcga 298
           |||  ||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 219 gtatttgggcccattctccgagcagaccccatcgtacctgaccggagagttccccggcga 278

                                                                       
Query: 299 ctacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacaggga 358
           |||||| |||||||| || ||  ||||||| ||||||||||| ||||||| |||| | ||
Sbjct: 279 ctacggatgggacactgctgggctgtcggcggacccagagactttcgccaggaaccgtga 338

                                                                       
Query: 359 gctggaggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgttccccga 418
           ||||||||||||||||||| ||||||| |||||||| || ||||| ||||| ||||| ||
Sbjct: 339 gctggaggtgatccactcgaggtgggccatgctcggcgctctcggttgcgtcttcccgga 398

                                                         
Query: 419 gatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           | ||||||| ||||||||  || ||||||| ||||| || ||||||
Sbjct: 399 gctcctgtcgaagaacggggtccagttcggggaggcggtgtggttc 444



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  254 bits (128), Expect = 2e-64
 Identities = 212/240 (88%)
 Strand = Plus / Minus

                                                                         
Query: 225   cctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggc 284
             |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| 
Sbjct: 79616 cctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacctgaccgga 79557

                                                                         
Query: 285   gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
             |||||||| || ||||||||||||||||| |||||  | ||||| ||||| ||||| |||
Sbjct: 79556 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 79497

                                                                         
Query: 345   gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
             || | |||||||||||||||||||||||||||||||||||||||||| || || || || 
Sbjct: 79496 gcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggc 79437

                                                                         
Query: 405   tgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
             ||||| ||||| ||||||||||||||||||||  | |||||||| ||||| || ||||||
Sbjct: 79436 tgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggaggcggtgtggttc 79377



 Score =  216 bits (109), Expect = 5e-53
 Identities = 136/145 (93%)
 Strand = Plus / Minus

                                                                         
Query: 78    atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
             |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 79852 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 79793

                                                                         
Query: 138   gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
             || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 79792 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 79733

                                      
Query: 198   agcgcgccccagagcatctggtacg 222
             |||||||||||||||||||||||||
Sbjct: 79732 agcgcgccccagagcatctggtacg 79708



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  254 bits (128), Expect = 2e-64
 Identities = 212/240 (88%)
 Strand = Plus / Plus

                                                                            
Query: 225      cctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggc 284
                |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| 
Sbjct: 21808200 cctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacctgaccgga 21808259

                                                                            
Query: 285      gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
                |||||||| || ||||||||||||||||| |||||  | ||||| ||||| ||||| |||
Sbjct: 21808260 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21808319

                                                                            
Query: 345      gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
                || | |||||||||||||||||||||||||||||||||||||||||| || || || || 
Sbjct: 21808320 gcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggc 21808379

                                                                            
Query: 405      tgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
                ||||| ||||| ||||||||||||||||||||  | |||||||| ||||| || ||||||
Sbjct: 21808380 tgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggaggcggtgtggttc 21808439



 Score =  216 bits (109), Expect = 5e-53
 Identities = 136/145 (93%)
 Strand = Plus / Plus

                                                                            
Query: 78       atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
                |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 21807964 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 21808023

                                                                            
Query: 138      gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
                || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 21808024 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 21808083

                                         
Query: 198      agcgcgccccagagcatctggtacg 222
                |||||||||||||||||||||||||
Sbjct: 21808084 agcgcgccccagagcatctggtacg 21808108



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  254 bits (128), Expect = 2e-64
 Identities = 212/240 (88%)
 Strand = Plus / Plus

                                                                            
Query: 225      cctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggc 284
                |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| 
Sbjct: 21801229 cctgaccgtcccaagtacctgggcccgttctcggagcagacgccatcgtacctgaccgga 21801288

                                                                            
Query: 285      gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
                |||||||| || ||||||||||||||||| |||||  | ||||| ||||| ||||| |||
Sbjct: 21801289 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21801348

                                                                            
Query: 345      gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
                || | |||||||||||||||||||||||||||||||||||||||||| || || || || 
Sbjct: 21801349 gcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggc 21801408

                                                                            
Query: 405      tgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
                ||||| ||||| ||||||||||||||||||||  | |||||||| ||||| || ||||||
Sbjct: 21801409 tgcgtcttcccggagatcctgtccaagaacggggtgaagttcggggaggcggtgtggttc 21801468



 Score =  216 bits (109), Expect = 5e-53
 Identities = 136/145 (93%)
 Strand = Plus / Plus

                                                                            
Query: 78       atggccgcgtcggcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgat 137
                |||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||
Sbjct: 21800993 atggccgcgtcggcgctgcaccagaccaccagcttcctcggcaccgcccctcgccgggat 21801052

                                                                            
Query: 138      gacctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaag 197
                || ||||||||| |||||||||||| ||| |||||||||||||||||||| |||||||||
Sbjct: 21801053 gagctcgtccgccgcgtcggcgactccggtggccgcatcaccatgcgccgcaccgtcaag 21801112

                                         
Query: 198      agcgcgccccagagcatctggtacg 222
                |||||||||||||||||||||||||
Sbjct: 21801113 agcgcgccccagagcatctggtacg 21801137



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 190 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 249

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 250 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 309

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||||||||||| ||| ||||  ||   |||||| ||||||||||||||
Sbjct: 310 ggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggcgag 369

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 370 gcggtgtggttc 381



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 651 tacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 710

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 711 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 770

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 771 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 830

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 831 gccgtgtggttc 842



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||||||||||||||||||||||||||||||  ||||||| |||
Sbjct: 268 tacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctgtcggccgac 327

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||||||||||| |||||||||||||||||||||  |||||||| ||||| 
Sbjct: 328 cccgagaccttcgccaagaaccgggagctggaggtgatccactgccggtgggccatgctg 387

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||||||| | ||  ||   |||||| ||||||||||||||
Sbjct: 388 ggcgcgctcggctgcgtcttccccgagctgctcgcccgcaacggcgtcaagttcggcgag 447

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 448 gccgtgtggttc 459



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                            
Query: 273      tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
                |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 23603733 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 23603792

                                                                            
Query: 333      ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
                || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 23603793 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 23603852

                                                                            
Query: 393      ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
                || || || || ||||||||||| ||| ||||  ||   |||||| ||||||||||||||
Sbjct: 23603853 ggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggcgag 23603912

                            
Query: 453      gctgtctggttc 464
                || || ||||||
Sbjct: 23603913 gcggtgtggttc 23603924



 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                            
Query: 267      ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
                ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 30024533 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 30024592

                                                                            
Query: 327      gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
                || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 30024593 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 30024652

                                                                            
Query: 387      atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
                ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 30024653 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 30024712

                                  
Query: 447      ggcgaggctgtctggttc 464
                |||||||| || ||||||
Sbjct: 30024713 ggcgaggccgtgtggttc 30024730



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 66432 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 66491

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 66492 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 66551

                                                                         
Query: 393   ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
             || || || || ||||||||||| ||| ||||  ||   |||||| ||||||||||||||
Sbjct: 66552 ggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggcgag 66611

                         
Query: 453   gctgtctggttc 464
             || || ||||||
Sbjct: 66612 gcggtgtggttc 66623



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 261 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 320

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 321 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 380

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||||||||||| ||| ||||  ||   |||||| ||||||||||||||
Sbjct: 381 ggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggcgag 440

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 441 gcggtgtggttc 452



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  190 bits (96), Expect = 3e-45
 Identities = 168/192 (87%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 260 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 319

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 320 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 379

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||||||||||| ||| ||||  ||   |||||| ||||||||||||||
Sbjct: 380 ggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggcgag 439

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 440 gcggtgtggttc 451



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  186 bits (94), Expect = 4e-44
 Identities = 211/250 (84%)
 Strand = Plus / Plus

                                                                        
Query: 215  ctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgta 274
            |||||||||||| |||||   ||||||||| ||||| |||||||   || |||||   ||
Sbjct: 1026 ctggtacggccccgaccgcgtcaagtacctcggccccttctccggcgagcccccgagcta 1085

                                                                        
Query: 275  cctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccc 334
            ||| |||||||||||||||||||||||||| ||||||||||| ||  |||| || |||||
Sbjct: 1086 cctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtccgccgaccc 1145

                                                                        
Query: 335  agagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
             ||||| |||||||||||| | |||||||||||||||||||| || ||||| ||||||||
Sbjct: 1146 cgagacattcgccaagaaccgcgagctggaggtgatccactcccgctgggccatgctcgg 1205

                                                                        
Query: 395  agccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggc 454
             || ||||| ||||| ||||||||| | || |||   |||||| ||||||||||||||||
Sbjct: 1206 cgcgctcggctgcgtcttccccgagctgctctcccgcaacggcgtcaagttcggcgaggc 1265

                      
Query: 455  tgtctggttc 464
             |||||||||
Sbjct: 1266 cgtctggttc 1275



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  184 bits (93), Expect = 2e-43
 Identities = 210/249 (84%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||  ||||||||| |||||||||||||   || |||| || |||
Sbjct: 202 tggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcatac 261

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || |||||||| ||||||||||||||||||||||||||||| ||  | || || ||||| 
Sbjct: 262 ctcaccggcgaattccccggcgactacgggtgggacaccgccgggctctccgccgacccc 321

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           ||||||||| |||||||| ||||||| |||||||||||||  |||||||| ||||| || 
Sbjct: 322 gagaccttctccaagaaccgggagctcgaggtgatccactgccggtgggccatgctgggt 381

                                                                       
Query: 396 gccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggct 455
           || ||||| ||||| ||||||||| ||||  ||   |||||| | |||||||||||||| 
Sbjct: 382 gctctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgaggcg 441

                    
Query: 456 gtctggttc 464
           |||||||||
Sbjct: 442 gtctggttc 450



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score =  184 bits (93), Expect = 2e-43
 Identities = 153/173 (88%)
 Strand = Plus / Plus

                                                                       
Query: 292 ccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaaga 351
           |||||||||||||||||||||| |||||  ||||||| ||||| ||||| |||||   ||
Sbjct: 1   ccggcgactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgcgga 60

                                                                       
Query: 352 acagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgt 411
           || | ||||||||||||||||||||||||||||||||||| || || || ||||||||||
Sbjct: 61  accgcgagctggaggtgatccactcgcggtgggcgatgctgggcgcgctggggtgcgtgt 120

                                                                
Query: 412 tccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           |||| ||||||||| ||||||||||| |||||||||||||||| || ||||||
Sbjct: 121 tcccggagatcctggccaagaacggcgtcaagttcggcgaggcggtgtggttc 173



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  184 bits (93), Expect = 2e-43
 Identities = 174/201 (86%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgta 274
           ||||||||| || |||||   ||||||||| |||||||||||||   || | ||||| ||
Sbjct: 541 ctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggcgaggcgccgtccta 600

                                                                       
Query: 275 cctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccc 334
           |||||||||||||||| ||||||||||||| ||||||||||| ||  | ||||| |||||
Sbjct: 601 cctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcggccgaccc 660

                                                                       
Query: 335 agagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
            |||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||
Sbjct: 661 cgagaccttcgccaagaaccgggagctggaggtgatccacgcgcggtgggccatgctcgg 720

                                
Query: 395 agccctcgggtgcgtgttccc 415
            || || || |||||||||||
Sbjct: 721 cgcgctgggctgcgtgttccc 741



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                            
Query: 273      tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
                ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 10793186 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 10793245

                                                                            
Query: 333      ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
                || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 10793246 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 10793305

                                                                            
Query: 393      ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
                || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 10793306 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 10793365

                            
Query: 453      gctgtctggttc 464
                || || ||||||
Sbjct: 10793366 gccgtgtggttc 10793377



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 16909 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 16968

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 16969 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 17028

                                                                         
Query: 393   ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
             || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 17029 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 17088

                         
Query: 453   gctgtctggttc 464
             || || ||||||
Sbjct: 17089 gccgtgtggttc 17100



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                          
Query: 273    tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
              ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 129804 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 129863

                                                                          
Query: 333    ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
              || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 129864 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 129923

                                                                          
Query: 393    ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
              || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 129924 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 129983

                          
Query: 453    gctgtctggttc 464
              || || ||||||
Sbjct: 129984 gccgtgtggttc 129995



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 254 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 313

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 314 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 373

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 374 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 433

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 434 gccgtgtggttc 445



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 318

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 319 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 378

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 379 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 438

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 439 gccgtgtggttc 450



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 261 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 320

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 321 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 380

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 381 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 440

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 441 gccgtgtggttc 452



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 318

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 319 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 378

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 379 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 438

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 439 gccgtgtggttc 450



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score =  176 bits (89), Expect = 4e-41
 Identities = 173/201 (86%)
 Strand = Plus / Plus

                                                                       
Query: 174 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgt 233
           |||||||||||  | ||||||| |||||| ||  ||||||| ||||| || |||||||| 
Sbjct: 180 atcaccatgcgaagaaccgtcaggagcgcccctgagagcatttggtatggacctgaccgc 239

                                                                       
Query: 234 cccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttcccc 293
           ||||||||||||||||| ||||| || ||||| |||||||| || |||||||| || |||
Sbjct: 240 cccaagtacctgggccccttctcggaacagacgccgtcgtatctcaccggcgaatttccc 299

                                                                       
Query: 294 ggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaac 353
           ||||||||||||||||||||||| ||  | || || ||||| |||||||||||||| |||
Sbjct: 300 ggcgactacgggtgggacaccgccgggctctctgccgaccctgagaccttcgccaaaaac 359

                                
Query: 354 agggagctggaggtgatccac 374
           || ||||||||||||||||||
Sbjct: 360 agagagctggaggtgatccac 380



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  174 bits (88), Expect = 2e-40
 Identities = 166/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||||||||||||||||||||||||||||||||||||||||||  | || || |||
Sbjct: 690 tacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgac 749

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||||||||||||||  ||||||||||||||
Sbjct: 750 ccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctc 809

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || |  || || ||||||||||| ||| ||||  ||   |||||| |||||||||| |||
Sbjct: 810 ggcgggctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggggag 869

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 870 gcggtgtggttc 881



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  174 bits (88), Expect = 2e-40
 Identities = 166/192 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 259 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 318

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||  ||||||||||| |||||||||||||||||||||| |||||||||||||| 
Sbjct: 319 ccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctg 378

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 379 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 438

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 439 gccgtgtggttc 450



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  172 bits (87), Expect = 7e-40
 Identities = 195/231 (84%)
 Strand = Plus / Plus

                                                                        
Query: 234  cccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttcccc 293
            ||||||| |||||| || ||||| |||||||| |||||||||||||| ||||||||||||
Sbjct: 899  cccaagttcctggggcccttctcggagcagacgccgtcgtacctgacgggcgagttcccc 958

                                                                        
Query: 294  ggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaac 353
            |||||||||||||||||||| || ||  | || || ||||| ||||||||||||||||||
Sbjct: 959  ggcgactacgggtgggacacggccggcctctccgccgacccggagaccttcgccaagaac 1018

                                                                        
Query: 354  agggagctggaggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgttc 413
             | ||||||||||| ||||||   |||||||| |||||||| || ||||| ||| | |||
Sbjct: 1019 cgcgagctggaggtcatccacagccggtgggccatgctcggcgcgctcggctgcatcttc 1078

                                                               
Query: 414  cccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
            || ||| | || |||||||||||  |  ||||||| ||||| |||||||||
Sbjct: 1079 ccggagctgctctccaagaacggggtgcagttcggggaggccgtctggttc 1129



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 141 ctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccggaccgtcaagagc 200
           ||||||||||  ||||||| || || ||||||| || |||||||||| |||||||||  |
Sbjct: 722 ctcgtccgcaaggtcggcgtctccgacggccgcttctccatgcgccgcaccgtcaaggcc 781

                              
Query: 201 gcgccccagagcatctggt 219
           |  ||||||||||||||||
Sbjct: 782 gtcccccagagcatctggt 800



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  170 bits (86), Expect = 3e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgta 274
           |||||||||||| ||| |   ||||||||| ||||| |||||||   || |||| || ||
Sbjct: 55  ctggtacggccccgacagagtcaagtacctcggccccttctccggcgaggccccctcata 114

                                                                       
Query: 275 cctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccc 334
           ||| |||||||||||| ||||||||||||| ||||||||||| ||  | || || |||||
Sbjct: 115 cctcaccggcgagttcgccggcgactacggctgggacaccgccgggctctccgccgaccc 174

                                                                       
Query: 335 agagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
            |||||||||||||||||| | |||||||||||||||||| || ||||||| ||||||||
Sbjct: 175 cgagaccttcgccaagaaccgcgagctggaggtgatccacgcgaggtgggccatgctcgg 234

                                                                       
Query: 395 agccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggc 454
            || ||||| ||||| ||||||||| | ||  ||   |||||| ||||||||||||||||
Sbjct: 235 cgcgctcggctgcgtcttccccgagctgctcgcccgcaacggcgtcaagttcggcgaggc 294

                     
Query: 455 tgtctggttc 464
            |||||||||
Sbjct: 295 cgtctggttc 304



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score =  167 bits (84), Expect = 4e-38
 Identities = 174/204 (85%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| |||||   ||||||||||||||| ||||||| |||||| |||||||||
Sbjct: 178 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 237

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || | |||||||||||||||||||||||| ||||||||||| ||  | || || ||||| 
Sbjct: 238 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 297

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           ||| | ||||| | |||||||| ||| ||||||||||||   ||||||||||||||||| 
Sbjct: 298 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 357

                                   
Query: 396 gccctcgggtgcgtgttccccgag 419
           || || |||||||| |||||||||
Sbjct: 358 gctcttgggtgcgtcttccccgag 381



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score =  167 bits (84), Expect = 4e-38
 Identities = 147/168 (87%)
 Strand = Plus / Plus

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  ||||||| ||||| ||||| ||||| |||||||| 
Sbjct: 299 gactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgaagaacaga 358

                                                                       
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgttcccc 416
           ||||||||||||||||||||||||||||||||| | |||||||| || ||||| ||||| 
Sbjct: 359 gagctggaggtgatccactcgcggtgggcgatgttgggagccctgggctgcgtcttcccg 418

                                                           
Query: 417 gagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           ||| | || |||   |||||| ||||||||||||||||||||||||||
Sbjct: 419 gagctgctctcccgcaacggcgtcaagttcggcgaggctgtctggttc 466



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  167 bits (84), Expect = 4e-38
 Identities = 165/192 (85%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| |||||||||||||| ||||||||||||||||||||||||||  | || || |||
Sbjct: 240 tacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgac 299

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||| |||||||||| || ||||||||||| 
Sbjct: 300 ccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatgctg 359

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| ||||  ||  ||||||| ||||||||||||||
Sbjct: 360 ggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggcgag 419

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 420 gccgtgtggttc 431



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 196 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 255

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 256 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 315

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 316 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 375

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 376 ggcgaggccgtgtggttc 393



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Minus

                                                                         
Query: 267   ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
             ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 14478 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 14419

                                                                         
Query: 327   gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
             || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 14418 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 14359

                                                                         
Query: 387   atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
             ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 14358 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 14299

                               
Query: 447   ggcgaggctgtctggttc 464
             |||||||| || ||||||
Sbjct: 14298 ggcgaggccgtgtggttc 14281



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                         
Query: 267   ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
             ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 20523 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 20582

                                                                         
Query: 327   gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
             || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 20583 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 20642

                                                                         
Query: 387   atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
             ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 20643 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 20702

                               
Query: 447   ggcgaggctgtctggttc 464
             |||||||| || ||||||
Sbjct: 20703 ggcgaggccgtgtggttc 20720



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  163 bits (82), Expect = 6e-37
 Identities = 208/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgta 274
           |||||||||||| |||||   ||||||||||||||| ||   || | || ||||||| ||
Sbjct: 321 ctggtacggcccggaccgggtcaagtacctgggcccctttagcggggagtccccgtccta 380

                                                                       
Query: 275 cctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccc 334
           ||||||||||||||||||||| ||||||||||||||||| || ||  |    || |||||
Sbjct: 381 cctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccgaccc 440

                                                                       
Query: 335 agagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
            |||||||||||||||||| | ||||||||||||||||||  ||| ||||||||||| ||
Sbjct: 441 cgagaccttcgccaagaaccgcgagctggaggtgatccacgggcgctgggcgatgctggg 500

                                                                       
Query: 395 agccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggc 454
            || ||||||||||| ||||| ||| ||||  ||  ||||||| ||||||| ||||||||
Sbjct: 501 ggcgctcgggtgcgtcttcccggagctcctcgcccggaacggcgtcaagtttggcgaggc 560

                     
Query: 455 tgtctggttc 464
            || ||||||
Sbjct: 561 cgtgtggttc 570



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 277 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 336

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 337 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 396

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 397 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 456

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 457 ggcgaggccgtgtggttc 474



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 277 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 336

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 337 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 396

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 397 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 456

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 457 ggcgaggccgtgtggttc 474



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 279 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 338

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 339 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 398

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 399 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 458

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 459 ggcgaggccgtgtggttc 476



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  163 bits (82), Expect = 6e-37
 Identities = 169/198 (85%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||||||||||||||||| ||||||||||| ||  |||||
Sbjct: 279 ccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcg 338

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 339 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 398

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 399 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 458

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 459 ggcgaggccgtgtggttc 476



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score =  159 bits (80), Expect = 1e-35
 Identities = 224/272 (82%)
 Strand = Plus / Plus

                                                                       
Query: 192 gtcaagagcgcgccccagagcatctggtacggccctgaccgtcccaagtacctgggcccg 251
           ||||||||||| || || ||||| |||||||| |||||||||||||||||  |||| || 
Sbjct: 196 gtcaagagcgcccctcaaagcatatggtacggtcctgaccgtcccaagtatttgggtccc 255

                                                                       
Query: 252 ttctccgagcagaccccgtcgtacctgaccggcgagttccccggcgactacgggtgggac 311
           ||||| ||||||||||| || ||||| || || |||||||| || |||||||| ||||||
Sbjct: 256 ttctcagagcagaccccatcataccttactggagagttccctggtgactacggttgggac 315

                                                                       
Query: 312 accgcgggattgtcggctgacccagagaccttcgccaagaacagggagctggaggtgatc 371
           || || ||| | || || ||||| || |||||||| |||||| | ||||| |||||||||
Sbjct: 316 actgctggactatcagcagaccctgaaaccttcgctaagaaccgtgagctcgaggtgatc 375

                                                                       
Query: 372 cactcgcggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcctgtccaag 431
           |||||  ||||||| ||||| || ||||| || || || ||||| || |||||||| || 
Sbjct: 376 cactctaggtgggcaatgcttggtgccctgggatgtgtattccctgaaatcctgtctaaa 435

                                           
Query: 432 aacggcatcaagttcggcgaggctgtctggtt 463
           |||||  |||| |||||||| ||||| |||||
Sbjct: 436 aacggtgtcaaattcggcgaagctgtgtggtt 467



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            |||||||| ||||||||||| ||||||||||| ||||||||||||||  ||||||| |||
Sbjct: 1214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggac 1273

                                                                        
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
            || ||||| |||||||||||| |||||||||||||||||||||| || ||||| ||||| 
Sbjct: 1274 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgggccatgctg 1333

                                                                        
Query: 393  ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
            || || ||||| ||||| ||||| ||| | ||  ||   |||||| ||||||||||||||
Sbjct: 1334 ggcgcgctcggttgcgtcttcccggagctgctcgcccgcaacggcgtcaagttcggcgag 1393

              
Query: 453  gc 454
            ||
Sbjct: 1394 gc 1395



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            |||||||| ||||||||||| ||||||||||| ||||||||||||||  ||||||| |||
Sbjct: 1214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggac 1273

                                                                        
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
            || ||||| |||||||||||| |||||||||||||||||||||| || ||||| ||||| 
Sbjct: 1274 ccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgggccatgctg 1333

                                                                        
Query: 393  ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
            || || ||||| ||||| ||||| ||| | ||  ||   |||||| ||||||||||||||
Sbjct: 1334 ggcgcgctcggctgcgtcttcccggagctgctcgcccgcaacggcgtcaagttcggcgag 1393

              
Query: 453  gc 454
            ||
Sbjct: 1394 gc 1395



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  155 bits (78), Expect = 2e-34
 Identities = 168/198 (84%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||| |||||||||||| ||||||||||||| ||||||||||| ||  |||||
Sbjct: 238 ccgtcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcg 297

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || ||||| ||||| |||||||||||| |||||||||||||||||||||  |||||||| 
Sbjct: 298 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggcc 357

                                                                       
Query: 387 atgctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttc 446
           ||||| || || ||||| ||||| ||||| ||| ||||  ||   |||||| | ||||||
Sbjct: 358 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaacggcgtgaagttc 417

                             
Query: 447 ggcgaggctgtctggttc 464
           |||||||| || ||||||
Sbjct: 418 ggcgaggccgtgtggttc 435



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  153 bits (77), Expect = 6e-34
 Identities = 206/249 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| || |||  ||||||||| |||||||||||||   || | || || |||
Sbjct: 186 tggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcatac 245

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || ||||| |||||||||||||||||||| ||||||||||| ||  | || || ||||| 
Sbjct: 246 ctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggacccc 305

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           ||||| |||||||||||| ||||||| |||||||||||||   ||||||| ||||| || 
Sbjct: 306 gagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctgggc 365

                                                                       
Query: 396 gccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggct 455
           || ||||| ||||| ||||||||| ||||  ||   |||||| | |||||||||||||| 
Sbjct: 366 gctctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgaggcg 425

                    
Query: 456 gtctggttc 464
           |||||||||
Sbjct: 426 gtctggttc 434



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  153 bits (77), Expect = 6e-34
 Identities = 206/249 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| || |||  ||||||||| |||||||||||||   || | || || |||
Sbjct: 21  tggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcatac 80

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || ||||| |||||||||||||||||||| ||||||||||| ||  | || || ||||| 
Sbjct: 81  ctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggacccc 140

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           ||||| |||||||||||| ||||||| |||||||||||||   ||||||| ||||| || 
Sbjct: 141 gagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctgggc 200

                                                                       
Query: 396 gccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggct 455
           || ||||| ||||| ||||||||| ||||  ||   |||||| | |||||||||||||| 
Sbjct: 201 gctctcggctgcgtcttccccgagctcctcgcccgcaacggcgtgaagttcggcgaggcg 260

                    
Query: 456 gtctggttc 464
           |||||||||
Sbjct: 261 gtctggttc 269



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  153 bits (77), Expect = 6e-34
 Identities = 206/249 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           |||||||||||||||||    |||||| |||| || |||||||   || |||||   |||
Sbjct: 37  tggtacggccctgaccgcgttaagtacttggggccattctccggtgagtccccgagctac 96

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
            ||||||| ||||||||||| |||||||| |||||||| || ||| | || |||||||||
Sbjct: 97  ttgaccggtgagttccccggtgactacggctgggacactgctggactctcagctgaccca 156

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           |||||||||||||||||| | ||||| ||||||||||||||  | ||||| ||||| |||
Sbjct: 157 gagaccttcgccaagaaccgtgagcttgaggtgatccactcaagatgggccatgcttgga 216

                                                                       
Query: 396 gccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggct 455
           || ||||| ||||| ||||||||| || || ||   |||||  |||||||||||||||||
Sbjct: 217 gcactcggatgcgtattccccgagctcttggcccgtaacggtgtcaagttcggcgaggct 276

                    
Query: 456 gtctggttc 464
           || ||||||
Sbjct: 277 gtttggttc 285



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  151 bits (76), Expect = 2e-33
 Identities = 163/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||| ||||||||||| ||||||||||||||  ||||||| |||
Sbjct: 266 tacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggac 325

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| |||||||||||||||||||||  || ||||| ||||| 
Sbjct: 326 ccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgggccatgctg 385

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || ||||| ||||| ||||| ||| | ||  ||   |||||| ||||||||||||||
Sbjct: 386 ggcgcgctcggttgcgtcttcccggagcttctcgcccgcaacggcgtcaagttcggcgag 445

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 446 gccgtgtggttc 457



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  149 bits (75), Expect = 9e-33
 Identities = 96/103 (93%)
 Strand = Plus / Plus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            ||||||||||||||||||||||||||||||||||||||||||| |||  ||||||| |||
Sbjct: 2125 tacctgaccggcgagttccccggcgactacgggtgggacaccgaggggctgtcggcggac 2184

                                                       
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccact 375
            || |||||||||||||||||| | |||||||||||||||||||
Sbjct: 2185 ccggagaccttcgccaagaaccgcgagctggaggtgatccact 2227



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  147 bits (74), Expect = 4e-32
 Identities = 176/210 (83%)
 Strand = Plus / Plus

                                                                       
Query: 215 ctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgta 274
           |||||||||||| ||||||  ||||||||| |||||||||||||   || | || || ||
Sbjct: 105 ctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgaggcaccatcata 164

                                                                       
Query: 275 cctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccc 334
           ||| ||||| |||||||||||||||||||| ||||||||||| ||  | || || |||||
Sbjct: 165 cctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggaccc 224

                                                                       
Query: 335 agagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
            ||||| || ||||||||| ||||||| |||||||||||||  |||||||| ||||| ||
Sbjct: 225 cgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgggcaatgctggg 284

                                         
Query: 395 agccctcgggtgcgtgttccccgagatcct 424
            || ||||| ||||| ||||||||| ||||
Sbjct: 285 tgctctcggctgcgtcttccccgagctcct 314



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||||||||| || |||||||| ||||||||||||||||| |||||  |||||
Sbjct: 290 ccgtcatacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcg 349

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || || || ||||| ||||| |||||||| |||||||| ||||||||||| |||||||||
Sbjct: 350 gcggatccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcg 409

                                        
Query: 387 atgctcggagccctcgggtgcgtgttccc 415
           ||||| || || ||||||||||| |||||
Sbjct: 410 atgctgggcgctctcgggtgcgtattccc 438



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  143 bits (72), Expect = 6e-31
 Identities = 162/192 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||| ||||||||||| ||||||||||||||  ||||||| |||
Sbjct: 214 tacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggac 273

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| |||||||||||| ||||||||||||| |||||||| || ||||| ||||| 
Sbjct: 274 ccggagacgttcgccaagaaccgggagctggaggtcatccactcccgctgggccatgctg 333

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || ||  | || ||||||||||| ||| | ||  ||   |||||| ||||||||||||||
Sbjct: 334 ggcgcgttgggctgcgtgttcccggagctgctcgcccgcaacggcgtcaagttcggcgag 393

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 394 gccgtgtggttc 405



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score =  141 bits (71), Expect = 2e-30
 Identities = 143/167 (85%)
 Strand = Plus / Plus

                                                                       
Query: 208 agagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccc 267
           ||||||| ||||| || ||||| || ||||||||||||||||| || || || ||||| |
Sbjct: 46  agagcatttggtatggacctgatcgccccaagtacctgggccccttttcggaacagacgc 105

                                                                       
Query: 268 cgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcgg 327
           ||||||| || ||||| || || ||||| || ||||||||||||||||| ||| | ||||
Sbjct: 106 cgtcgtatctcaccggagaatttcccggggattacgggtgggacaccgccggactctcgg 165

                                                          
Query: 328 ctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           | |||||||||||||||||||| || || ||||||||||||||||||
Sbjct: 166 ccgacccagagaccttcgccaaaaatagagagctggaggtgatccac 212



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score =  139 bits (70), Expect = 9e-30
 Identities = 133/154 (86%)
 Strand = Plus / Plus

                                                                       
Query: 217 ggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacc 276
           |||| |||||||| ||||||||||||||||| || ||||| |||||||  ||||| ||||
Sbjct: 461 ggtatggccctgatcgtcccaagtacctgggtccattctcagagcagattccgtcatacc 520

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| || |||||||| |||||||| |||||||| || ||| | || |||||||| |
Sbjct: 521 tgaccggagaattccccggtgactacggatgggacactgctggactatcagctgacccgg 580

                                             
Query: 337 agaccttcgccaagaacagggagctggaggtgat 370
           | |||||||||| |||| ||||||||||||||||
Sbjct: 581 aaaccttcgccaggaaccgggagctggaggtgat 614



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 171 cgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggta 220
           |||| |||||||||||| ||||||||||| || || |||||||| |||||
Sbjct: 335 cgcaccaccatgcgccgtaccgtcaagagtgctcctcagagcatttggta 384



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score =  137 bits (69), Expect = 4e-29
 Identities = 129/149 (86%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||| ||||||||||| || |||||||| ||||||||||||||||| |||||  | |||
Sbjct: 297 ccgtcatacctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcg 356

                                                                       
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcg 386
           || || || ||||| ||||| |||||||| |||||||| ||||||||||| |||||||||
Sbjct: 357 gcggatccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcg 416

                                        
Query: 387 atgctcggagccctcgggtgcgtgttccc 415
           ||||| || || ||||||||||| |||||
Sbjct: 417 atgctgggcgctctcgggtgcgtattccc 445



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  133 bits (67), Expect = 6e-28
 Identities = 172/207 (83%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccct 227
           ||||||||||||||| | || |||||||  || || ||  ||||||| |||||||| |||
Sbjct: 119 ggccgcatcaccatgaggcgtaccgtcagaagtgctccagagagcatatggtacggacct 178

                                                                       
Query: 228 gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
           ||||| || |||||| ||||||| ||||||||||| || || || ||||||||||| || 
Sbjct: 179 gaccgcccaaagtacttgggcccattctccgagcaaactccatcatacctgaccggtgaa 238

                                                                       
Query: 288 ttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgcc 347
           ||||| || ||||| ||||||||||| || ||| | || |||||||||||||| || |||
Sbjct: 239 ttccctggagactatgggtgggacactgctggactttcagctgacccagagacatttgcc 298

                                      
Query: 348 aagaacagggagctggaggtgatccac 374
           |||||| | ||||| || |||||||||
Sbjct: 299 aagaaccgtgagctcgaagtgatccac 325



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 197 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 256

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 257 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 316

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 317 gcgctggaggtgatccacggccggtgggcgatgctcgg 354



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 281 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 340

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 341 gcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 281 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 340

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 341 gcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 223 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 282

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 283 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 342

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 343 gcgctggaggtgatccacggccggtgggcgatgctcgg 380



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 228 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 287

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 288 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 347

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 348 gcgctggaggtgatccacggccggtgggcgatgctcgg 385



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 261 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 320

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 321 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 380

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 381 gcgctggaggtgatccacggccggtgggcgatgctcgg 418



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                            
Query: 237      aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
                ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 22434234 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 22434293

                                                                            
Query: 297      gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
                ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 22434294 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 22434353

                                                      
Query: 357      gagctggaggtgatccactcgcggtgggcgatgctcgg 394
                | ||||||||||||||||   |||||||||||||||||
Sbjct: 22434354 gcgctggaggtgatccacggccggtgggcgatgctcgg 22434391



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                         
Query: 237   aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
             ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 95301 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 95360

                                                                         
Query: 297   gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
             ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 95361 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 95420

                                                   
Query: 357   gagctggaggtgatccactcgcggtgggcgatgctcgg 394
             | ||||||||||||||||   |||||||||||||||||
Sbjct: 95421 gcgctggaggtgatccacggccggtgggcgatgctcgg 95458



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 197 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 256

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 257 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 316

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 317 gcgctggaggtgatccacggccggtgggcgatgctcgg 354



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 281 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 340

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 341 gcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 221 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 280

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 281 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 340

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 341 gcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 222 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 281

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 282 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 341

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 342 gcgctggaggtgatccacggccggtgggcgatgctcgg 379



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  131 bits (66), Expect = 2e-27
 Identities = 135/158 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 228 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 287

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 288 gactacgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 347

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 348 gcgctggaggtgatccacggccggtgggcgatgctcgg 385



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score =  127 bits (64), Expect = 3e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||||||||||||||||||||| |||||||| ||||||||||| ||  |||||||||||
Sbjct: 190 tacctgaccggcgagttccccggtgactacggctgggacaccgccggcctgtcggctgac 249

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 250 ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctg 309

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || ||||| || ||| ||  ||||||| | ||| |||||||||||| | |||||||||||
Sbjct: 310 ggcgccctgggctgcctgacccccgagctgctggccaagaacggcacccagttcggcgag 369

                       
Query: 453 gctgtctggttc 464
           ||||||||||||
Sbjct: 370 gctgtctggttc 381



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  125 bits (63), Expect = 1e-25
 Identities = 153/183 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||  ||||||| ||||||| |||||||   || ||||||| |||
Sbjct: 197 tggtacggcccagaccgtgtcaagtacttgggcccattctccggcgagcccccgtcctac 256

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || |||||||||||||| || |||||||| |||||||| || ||  | || |||||||||
Sbjct: 257 ctcaccggcgagttcccaggtgactacggttgggacactgctgggctttccgctgaccca 316

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           ||||||||||||| |||| | ||| |||| || ||||||||  ||||||| ||||| |||
Sbjct: 317 gagaccttcgccaggaaccgtgagttggaagtcatccactccaggtgggccatgctggga 376

              
Query: 396 gcc 398
           |||
Sbjct: 377 gcc 379



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score =  125 bits (63), Expect = 1e-25
 Identities = 186/227 (81%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           ||||||||||| || || ||||||||||||||| | ||||| ||||| ||||| ||||| 
Sbjct: 163 agcatctggtatggtccagaccgtcccaagtacttaggccccttctcagagcaaacccca 222

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| || || || |||||||| || ||||| |||||||| || ||| | || |||
Sbjct: 223 tcataccttacaggtgaattccccggtgattacggttgggacactgctggactctcagct 282

                                                                       
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatg 389
           |||||||| || ||||| |||||| | ||||| |||||||||||||   | ||||| |||
Sbjct: 283 gacccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatg 342

                                                          
Query: 390 ctcggagccctcgggtgcgtgttccccgagatcctgtccaagaacgg 436
           || || ||||| || ||||| ||||||||| ||||| | ||||||||
Sbjct: 343 cttggtgcccttggatgcgttttccccgagctcctggctaagaacgg 389



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  125 bits (63), Expect = 1e-25
 Identities = 93/103 (90%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||||||||| |||||||| |||||||| ||||||||||| || ||| | |||||||||
Sbjct: 214 tacctgaccggtgagttccctggcgactatgggtgggacactgctggactttcggctgac 273

                                                      
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccact 375
           || ||||||||| |||||||| |||||||||||||||||||||
Sbjct: 274 ccggagaccttctccaagaaccgggagctggaggtgatccact 316



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score =  123 bits (62), Expect = 5e-25
 Identities = 167/202 (82%)
 Strand = Plus / Plus

                                                                       
Query: 174 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgt 233
           |||||||||||  | ||||| | |||||| ||| ||||||| ||||| || |||||||| 
Sbjct: 155 atcaccatgcgaagaaccgtaaggagcgcccccgagagcatttggtatggacctgaccgc 214

                                                                       
Query: 234 cccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttcccc 293
           ||||||||||| ||||| ||||| ||   ||| ||||| || || ||||| || || |||
Sbjct: 215 cccaagtacctaggccccttctcggaagggacgccgtcatatctcaccggagaatttccc 274

                                                                       
Query: 294 ggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaac 353
           |||||||||||||||||||| || |   | ||||| || |||||||||||||| || |||
Sbjct: 275 ggcgactacgggtgggacactgccgccgtctcggcggatccagagaccttcgcaaaaaac 334

                                 
Query: 354 agggagctggaggtgatccact 375
           || |||||||||||||||||||
Sbjct: 335 agagagctggaggtgatccact 356



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  123 bits (62), Expect = 5e-25
 Identities = 134/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
           ||||||||||| || ||||| | |||||| |||||||||||||  ||||||||||| |||
Sbjct: 226 aagtacctggggccattctcggcgcagacgccgtcgtacctgaggggcgagttcccgggc 285

                                                                       
Query: 297 gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
           ||||| ||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||
Sbjct: 286 gactatgggtgggacacggcggggctctccgcggacccggaggcgttcgcgaggaacagg 345

                                                 
Query: 357 gagctggaggtgatccactcgcggtgggcgatgctcgg 394
           | ||||||||||||||||   |||||||||||||||||
Sbjct: 346 gcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score =  119 bits (60), Expect = 8e-24
 Identities = 201/248 (81%)
 Strand = Plus / Plus

                                                                       
Query: 217 ggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacc 276
           |||| ||||||||||| || |||||| |||| || ||||| || || | ||| || ||||
Sbjct: 689 ggtatggccctgaccgcccaaagtacttgggtccattctctgaccaaatcccatcatacc 748

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| || ||||| || |||||||||||||| || || ||||| || ||||||||||
Sbjct: 749 tgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgacccag 808

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || ||||||||| | ||||| |||||||||||||   ||||||| ||||| || |
Sbjct: 809 agacatttgccaagaaccgtgagcttgaggtgatccactgtaggtgggctatgcttggtg 868

                                                                       
Query: 397 ccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctg 456
           |||| || || || ||||| || || || || ||||| ||  |||||||||| ||||| |
Sbjct: 869 cccttggctgtgttttccctgaaattctttcaaagaatggtgtcaagttcggagaggcgg 928

                   
Query: 457 tctggttc 464
           | ||||||
Sbjct: 929 tttggttc 936



to top

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score =  119 bits (60), Expect = 8e-24
 Identities = 159/192 (82%)
 Strand = Plus / Plus

                                                                       
Query: 179 catgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgtcccaa 238
           ||||||||| |||||||| || || || |||||||| ||||| |||||||||||||||||
Sbjct: 164 catgcgccgcaccgtcaaaagtgctcctcagagcatttggtatggccctgaccgtcccaa 223

                                                                       
Query: 239 gtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcga 298
           |||| |||| || || || || ||||  || || ||||||||||| || ||||| || ||
Sbjct: 224 gtacttgggtccattttctgaccagattccatcatacctgaccggtgaattccctggtga 283

                                                                       
Query: 299 ctacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacaggga 358
           |||||| |||||||| || ||||| || |||||||| || ||||| |||| |||| | ||
Sbjct: 284 ctacggatgggacacagctggattatcagctgaccctgaaacctttgccaggaaccgtga 343

                       
Query: 359 gctggaggtgat 370
           | ||||||||||
Sbjct: 344 gttggaggtgat 355



to top

>gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1105

 Score =  117 bits (59), Expect = 3e-23
 Identities = 131/155 (84%)
 Strand = Plus / Plus

                                                                       
Query: 240 tacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcgac 299
           |||||||| || ||||| | ||| || |||||||||||||  ||||||||||| ||||||
Sbjct: 205 tacctggggccattctcggcgcaaacgccgtcgtacctgaggggcgagttcccgggcgac 264

                                                                       
Query: 300 tacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagggag 359
           |||||||||||||| |||||  | || || ||||| ||| | ||||| | |||||||| |
Sbjct: 265 tacgggtgggacacggcggggctctccgcggacccggaggcgttcgcaaggaacagggcg 324

                                              
Query: 360 ctggaggtgatccactcgcggtgggcgatgctcgg 394
           |||||||||||||||   |||||||||||||||||
Sbjct: 325 ctggaggtgatccacggccggtgggcgatgctcgg 359



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 271 cgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctg 330
           |||||||||| ||||||||||||||||||||||| ||||||||||| ||  |||| ||||
Sbjct: 203 cgtacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctg 262

                                                                       
Query: 331 acccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgc 390
           |||| |||||||||       || | ||||||||| |||||||| | || ||||| ||||
Sbjct: 263 acccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggctatgc 322

                                                                       
Query: 391 tcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcg 450
           | || ||||| || |||  |  ||||||| | ||| |||||| ||||| |||||||||||
Sbjct: 323 tgggcgccctgggctgccagacccccgagctgctggccaagagcggcaccaagttcggcg 382

                         
Query: 451 aggctgtctggttc 464
           ||||||||||||||
Sbjct: 383 aggctgtctggttc 396



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           ||||||||||| ||||| |||||||||||||| ||  | ||||||||||| |||||||||
Sbjct: 212 gagttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttc 271

                                                             
Query: 345 gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
           ||||||||| ||||||| |||||||||||||  || ||||| ||||||||
Sbjct: 272 gccaagaaccgggagctcgaggtgatccactgccgatgggccatgctcgg 321



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 441 aagttcggcgaggctgtctggttc 464
           |||||||||||||| |||||||||
Sbjct: 368 aagttcggcgaggccgtctggttc 391



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           ||||||||||| ||||| |||||||||||||| ||  | ||||||||||| |||||||||
Sbjct: 417 gagttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttc 476

                                                             
Query: 345 gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgg 394
           ||||||||| ||||||| |||||||||||||  || ||||| ||||||||
Sbjct: 477 gccaagaaccgggagctcgaggtgatccactgccgatgggccatgctcgg 526



to top

>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score =  115 bits (58), Expect = 1e-22
 Identities = 124/146 (84%)
 Strand = Plus / Plus

                                                                        
Query: 244  tgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcgactacg 303
            ||||||| |||||||   |||||||||| || ||||  ||||||||| ||||||||||||
Sbjct: 1818 tgggcccattctccggcgagaccccgtcatatctgaatggcgagttcgccggcgactacg 1877

                                                                        
Query: 304  ggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagggagctgg 363
            | ||||||||||| ||| ||||| | ||||| ||||| ||||||  ||||||||||||||
Sbjct: 1878 gatgggacaccgctggactgtcgtcagacccggagacgttcgcccggaacagggagctgg 1937

                                      
Query: 364  aggtgatccactcgcggtgggcgatg 389
            |||| |||||| | || |||||||||
Sbjct: 1938 aggtcatccacgcccgttgggcgatg 1963



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                        
Query: 271  cgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctg 330
            |||||||||| ||||||||||||||||||||||| ||||||||||| ||  |||| ||||
Sbjct: 978  cgtacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctg 1037

                                                                        
Query: 331  acccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgc 390
            |||| |||||||||       || | ||||||||| |||||||| | || ||||| ||||
Sbjct: 1038 acccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggctatgc 1097

                                                                        
Query: 391  tcggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcg 450
            | || ||||| || |||  |  ||||||| | ||| |||||| ||||| |||||||||||
Sbjct: 1098 tgggcgccctgggctgccagacccccgagctgctggccaagagcggcaccaagttcggcg 1157

                          
Query: 451  aggctgtctggttc 464
            ||||||||||||||
Sbjct: 1158 aggctgtctggttc 1171



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score =  113 bits (57), Expect = 5e-22
 Identities = 180/221 (81%)
 Strand = Plus / Plus

                                                                        
Query: 244  tgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcgactacg 303
            ||||||| |||||||   ||||||| |||||||||| ||| |||||| | || |||||||
Sbjct: 1227 tgggccctttctccggtgagaccccctcgtacctgaacggtgagttcgctggagactacg 1286

                                                                        
Query: 304  ggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagggagctgg 363
            | ||||||||||| ||| | ||| | ||||| ||||||||||||   ||||||||| |||
Sbjct: 1287 gctgggacaccgccggactctcgtcggaccccgagaccttcgcccgcaacagggagttgg 1346

                                                                        
Query: 364  aggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgttccccgagatcc 423
            |||| |||||| | || ||||| ||||||||||| || |||||| ||  ||| ||| | |
Sbjct: 1347 aggtcatccacgcccgctgggccatgctcggagctctggggtgcctgacccctgagctgc 1406

                                                     
Query: 424  tgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
            || |||||| |||  | |||||||||||||| || ||||||
Sbjct: 1407 tggccaagagcggtgtgaagttcggcgaggccgtgtggttc 1447



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  113 bits (57), Expect = 5e-22
 Identities = 174/213 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| |||||   ||||||| ||||||| ||||| |   || ||||||| |||
Sbjct: 389 tggtacggcccagaccgagtcaagtacttgggcccattctctggcgagcccccgtcctac 448

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || ||||| |||||||| ||||||||||| |||||||| || ||  | || || ||||||
Sbjct: 449 ctaaccggtgagttcccaggcgactacggctgggacactgctgggctttccgcagaccca 508

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           || ||||||||||||||| | || || || |||||||||||  ||||||| |||||||||
Sbjct: 509 gaaaccttcgccaagaaccgtgaactcgaagtgatccactccaggtgggccatgctcgga 568

                                            
Query: 396 gccctcgggtgcgtgttccccgagatcctgtcc 428
           ||| | || ||||| ||||| ||| | ||||||
Sbjct: 569 gccttgggctgcgtcttcccggagttgctgtcc 601



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score =  111 bits (56), Expect = 2e-21
 Identities = 239/300 (79%)
 Strand = Plus / Plus

                                                                       
Query: 165 ggcggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggc 224
           |||||||||||||||||| | || |||||||| ||| | ||||| ||||| ||||| |||
Sbjct: 94  ggcggccgcatcaccatgaggcgcaccgtcaaaagcaccccccaaagcatatggtatggc 153

                                                                       
Query: 225 cctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggc 284
           || ||||| || || ||| |||| || ||||| ||||| || || || ||| |||| || 
Sbjct: 154 ccagaccgcccaaaatacttgggaccattctctgagcaaactccatcatacttgactggt 213

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           || ||||| || |||||||| |||||||| || ||| | || || ||||| ||||| || 
Sbjct: 214 gaattccctggtgactacggatgggacactgctggactatccgcagaccctgagacattt 273

                                                                       
Query: 345 gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
           || || ||| | ||||| ||||||||||||   || ||||| ||||| || || || || 
Sbjct: 274 gcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtgcactggga 333

                                                                       
Query: 405 tgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           || || ||||| || |||||||| ||||| ||  ||||||||||||||||||| ||||||
Sbjct: 334 tgtgtcttcccagaaatcctgtcaaagaatggtgtcaagttcggcgaggctgtttggttc 393



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score =  109 bits (55), Expect = 8e-21
 Identities = 127/151 (84%)
 Strand = Plus / Plus

                                                                        
Query: 225  cctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggc 284
            |||||||| ||||||||||| ||||| ||||| ||   ||| ||||| || || ||||| 
Sbjct: 2425 cctgaccgccccaagtacctaggccccttctcggaagggacgccgtcatatctcaccgga 2484

                                                                        
Query: 285  gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
            || || ||||||||||||||||||||||| || ||  | ||||| || ||||||||||||
Sbjct: 2485 gaatttcccggcgactacgggtgggacactgccggcctctcggcggatccagagaccttc 2544

                                           
Query: 345  gccaagaacagggagctggaggtgatccact 375
            || || ||||| |||||||||||||||||||
Sbjct: 2545 gcaaaaaacagagagctggaggtgatccact 2575



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score =  109 bits (55), Expect = 8e-21
 Identities = 166/203 (81%)
 Strand = Plus / Plus

                                                                       
Query: 174 atcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgt 233
           |||||||||||  | ||||| | ||| || ||| ||||||| ||||| || || ||||| 
Sbjct: 46  atcaccatgcgtagaaccgtaaggagtgcccccgagagcatttggtatggacccgaccgc 105

                                                                       
Query: 234 cccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttcccc 293
           ||||||||||| ||||| ||||| || ||||| || ||||| || || || || || |||
Sbjct: 106 cccaagtacctcggccccttctcggaacagacgccctcgtatctcacgggagaatttccc 165

                                                                       
Query: 294 ggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaac 353
           || ||||||||||||||||| || ||  | || || || || |||||||||||||| |||
Sbjct: 166 ggagactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaac 225

                                  
Query: 354 agggagctggaggtgatccactc 376
           || ||||||||||||||||||||
Sbjct: 226 agagagctggaggtgatccactc 248



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score =  107 bits (54), Expect = 3e-20
 Identities = 203/252 (80%), Gaps = 3/252 (1%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagc---agaccccgtcg 272
           ||||||||||| ||||| || |||| ||||||||| ||||| |||    | |||||  | 
Sbjct: 118 tggtacggccccgaccgcccgaagttcctgggccccttctcggagggcgacacccccgcc 177

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||||||||||
Sbjct: 178 tacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgac 237

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 238 ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctg 297

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||| |   ||||||| | ||| ||||||||||||||  |||||| |||
Sbjct: 298 ggcgctctgggctgcatcacccccgagctgctggccaagaacggcatcccgttcggtgag 357

                       
Query: 453 gctgtctggttc 464
           ||||||||||||
Sbjct: 358 gctgtctggttc 369



to top

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score =  107 bits (54), Expect = 3e-20
 Identities = 129/154 (83%)
 Strand = Plus / Plus

                                                                         
Query: 217   ggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacc 276
             |||| ||||||||||||||||||||| |||| || ||||| ||||| |  || || ||||
Sbjct: 40051 ggtatggccctgaccgtcccaagtacttgggtcctttctctgagcaaattccatcatacc 40110

                                                                         
Query: 277   tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
             |||| || || ||||| || |||||||| |||||||| || ||||| || |||||||| |
Sbjct: 40111 tgactggtgaattccctggtgactacggatgggacacagctggattatcagctgaccccg 40170

                                               
Query: 337   agaccttcgccaagaacagggagctggaggtgat 370
             | ||||||||||||||| | ||||| ||||||||
Sbjct: 40171 aaaccttcgccaagaaccgtgagctcgaggtgat 40204



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  107 bits (54), Expect = 3e-20
 Identities = 141/170 (82%)
 Strand = Plus / Minus

                                                                         
Query: 216   tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
             ||||||||||| |||||   ||| ||| ||||||| |||||||   || ||||||| |||
Sbjct: 66212 tggtacggcccagaccgcgtcaaatacttgggcccattctccggtgagcccccgtcctac 66153

                                                                         
Query: 276   ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
              ||||||| ||||||||||| |||||||| |||||||| || ||  | || |||||||| 
Sbjct: 66152 ttgaccggtgagttccccggtgactacggctgggacactgctgggctttctgctgacccc 66093

                                                               
Query: 336   gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggc 385
             ||||| |||||||||||| | ||||| ||||||||||||||  |||||||
Sbjct: 66092 gagacattcgccaagaaccgtgagcttgaggtgatccactctaggtgggc 66043



to top

>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100
           (LHCB2.1) mRNA, complete cds
          Length = 1068

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 200 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 259

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 260 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 319

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 320 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 364



to top

>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 1001

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 198 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 257

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 258 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 317

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 318 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 362



to top

>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 943

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 193 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 252

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 253 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 312

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 313 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 357



to top

>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS37ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 980

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 178 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 237

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 238 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 297

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 298 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 342



to top

>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS18ZH11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 912

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 280

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 281 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 325



to top

>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 859

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 176 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 235

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 236 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 295

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 296 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 340



to top

>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 941

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 176 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 235

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 236 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 295

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 296 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 340



to top

>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZD09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 964

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 190 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 249

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 250 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 309

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 310 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 354



to top

>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 914

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 159 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 218

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 219 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 278

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 279 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 323



to top

>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 917

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 280

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 281 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 325



to top

>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 922

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 161 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 220

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 221 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 280

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 281 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 325



to top

>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 181 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 240

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 241 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 300

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 301 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 345



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score =  105 bits (53), Expect = 1e-19
 Identities = 80/89 (89%)
 Strand = Plus / Plus

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           |||||||| || ||||| ||||||||||| || ||  |||| || |||||||||||||||
Sbjct: 735 gagttccctggtgactatgggtgggacacagctggtctgtccgcagacccagagaccttc 794

                                        
Query: 345 gccaagaacagggagctggaggtgatcca 373
           |||||||||||||||||||||||||||||
Sbjct: 795 gccaagaacagggagctggaggtgatcca 823



to top

>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds
          Length = 967

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 188 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 247

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 248 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 307

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 308 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 352



to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           ||||| |||||||| || ||||||||||||||| |||| || ||||| ||| | || |||
Sbjct: 197 agcatttggtacggaccagaccgtcccaagtacttgggaccattctcggagaacacaccg 256

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 257 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 316

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 317 gacccggagacattcgctaagaaccgtgagcttgaagtaatccac 361



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score =  105 bits (53), Expect = 1e-19
 Identities = 161/197 (81%)
 Strand = Plus / Plus

                                                                       
Query: 178 ccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgtccca 237
           |||||||||| || ||||||||||| || || ||||| ||||| || |||||||||||||
Sbjct: 273 ccatgcgccgcacagtcaagagcgctcctcaaagcatttggtatggtcctgaccgtccca 332

                                                                       
Query: 238 agtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcg 297
           ||||  ||||||| ||||| || |||||||| || ||||| || || || ||||| || |
Sbjct: 333 agtatttgggccccttctcagaacagaccccatcataccttacaggagaattccctggtg 392

                                                                       
Query: 298 actacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacaggg 357
           |||| || |||||||| || ||| | || || |||||||| ||||| ||||  ||| | |
Sbjct: 393 actatggttgggacactgctggactttcagcagacccagaaacctttgccagaaaccgtg 452

                            
Query: 358 agctggaggtgatccac 374
           |||| ||||||||||||
Sbjct: 453 agcttgaggtgatccac 469



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| || |||||||||||||| || ||||| |||||||| || || |||||||| |||
Sbjct: 291 tacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcggac 350

                                                                
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggc 385
           ||||| |||||||| |||||  ||||||||||||| |||||||| ||||||||
Sbjct: 351 ccagaaaccttcgctaagaatcgggagctggaggtcatccactcacggtgggc 403



to top

>gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlorophyll a/b binding
           protein (At2g05100) mRNA, complete cds
          Length = 829

 Score =  105 bits (53), Expect = 1e-19
 Identities = 137/165 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           |||||||||||||| || ||||||||||||||| | || || ||||| ||| | || |||
Sbjct: 139 agcatctggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccg 198

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||
Sbjct: 199 tcctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggct 258

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 259 gacccggagacattcgctaagaaccgcgagcttgaagtaatccac 303



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 285

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || ||||||||||| |||||||| |||||||||   |||||||| ||||| || |
Sbjct: 286 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 345

                                                                       
Query: 397 ccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctg 456
           | || || ||||| ||||| ||| ||||| |||  |||||  |||||||||| ||||| |
Sbjct: 346 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 405

                   
Query: 457 tctggttc 464
           | ||||||
Sbjct: 406 tgtggttc 413



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 260 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 319

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || ||||||||||| |||||||| |||||||||   |||||||| ||||| || |
Sbjct: 320 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 379

                                                                       
Query: 397 ccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctg 456
           | || || ||||| ||||| ||| ||||| |||  |||||  |||||||||| ||||| |
Sbjct: 380 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 439

                   
Query: 457 tctggttc 464
           | ||||||
Sbjct: 440 tgtggttc 447



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 257 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 316

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || ||||||||||| |||||||| |||||||||   |||||||| ||||| || |
Sbjct: 317 agacgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcg 376

                                                                       
Query: 397 ccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctg 456
           | || || ||||| ||||| ||| ||||| |||  |||||  |||||||||| ||||| |
Sbjct: 377 ctctgggctgcgttttcccggagctcctggccagaaacggagtcaagttcggggaggcgg 436

                   
Query: 457 tctggttc 464
           | ||||||
Sbjct: 437 tgtggttc 444



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score =  103 bits (52), Expect = 5e-19
 Identities = 157/192 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||||||||||
Sbjct: 224 tacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgac 283

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 284 ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggctatgctg 343

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||| |   ||||||| | ||| |||||| ||||| | |||||||||||
Sbjct: 344 ggcgctctgggctgcatcacccccgagctgctggccaagagcggcacccagttcggcgag 403

                       
Query: 453 gctgtctggttc 464
           ||||||||||||
Sbjct: 404 gctgtctggttc 415



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score =  103 bits (52), Expect = 5e-19
 Identities = 157/192 (81%)
 Strand = Plus / Plus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||||||||||
Sbjct: 852  tacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgac 911

                                                                        
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
            || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 912  ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggctatgctg 971

                                                                        
Query: 393  ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
            || || || || ||| |   ||||||| | ||| |||||| ||||| | |||||||||||
Sbjct: 972  ggcgctctgggctgcatcacccccgagctgctggccaagagcggcacccagttcggcgag 1031

                        
Query: 453  gctgtctggttc 464
            ||||||||||||
Sbjct: 1032 gctgtctggttc 1043



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score =  101 bits (51), Expect = 2e-18
 Identities = 99/115 (86%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 272 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 331

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 332 agacttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386



to top

>dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M26
          Length = 476

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||| |||||||  || ||||| |||| | || | || |||||||||
Sbjct: 196 tggtacggccccgaccgccccaagtggctcggccccttcttccagaacacgccgtcgtac 255

                                                 
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacac 313
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 256 ctgaccggcgagttccccggcgactacggctgggacac 293



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 112/132 (84%), Gaps = 3/132 (2%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagc---agaccccgtcg 272
           ||||||||||| ||||| || |||| ||||||||| ||||| |||    | |||||  | 
Sbjct: 134 tggtacggccccgaccgcccgaagttcctgggccccttctcggagggcgacacccccgcc 193

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||||||||||
Sbjct: 194 tacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgac 253

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 254 ccggagaccttc 265



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 413 ccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           ||||||| | ||| ||||||||||||||  |||||| |||||||||||||||
Sbjct: 334 ccccgagctgctggccaagaacggcatcccgttcggtgaggctgtctggttc 385



to top

>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M27
          Length = 687

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 106/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 219 tacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctg 278
           |||||||| |||||  ||||||  |||||||| ||||| ||  | |||||||||||||||
Sbjct: 119 tacggccccgaccgcgccaagtggctgggccccttctcggatgacaccccgtcgtacctg 178

                                                                       
Query: 279 accggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagag 338
           ||||||||||| || ||||||||||| |||||||| || ||  ||||||| ||||| |||
Sbjct: 179 accggcgagtttccgggcgactacggctgggacactgctggcctgtcggccgacccggag 238

                
Query: 339 acctt 343
           |||||
Sbjct: 239 acctt 243



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 156/192 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| || |||||||| ||||||||||||||||| || ||| | || ||||||
Sbjct: 223 tacctcaccggtgatttccccggtgactacgggtgggacacggctggactctctgctgac 282

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||||||| | |||||| | ||| |||||||||| ||||  || ||||| ||||| 
Sbjct: 283 cccgagaccttctcgaagaaccgcgagttggaggtgatacactgccgctgggctatgctt 342

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||||||||||| ||| | ||  ||   || ||| | ||||||||||||
Sbjct: 343 ggtgcactgggttgcgtgttccctgagttgcttgcccgcaatggcgtgaagttcggcgag 402

                       
Query: 453 gctgtctggttc 464
           ||||||||||||
Sbjct: 403 gctgtctggttc 414



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Plus

                                                                       
Query: 267 ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
           ||||||||||| ||||| || ||||| || ||||||||||||||||| |||||  |||||
Sbjct: 236 ccgtcgtacctaaccggtgaattcccgggtgactacgggtgggacacggcggggctgtcg 295

                                                           
Query: 327 gctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           || || || ||||| ||||| |||||||| |||||||| |||||||||
Sbjct: 296 gcagatccggagacgttcgcgaagaacagagagctggaagtgatccac 343



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 156/192 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| |||||||| || ||  |||||||||||
Sbjct: 202 tacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctgac 261

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 262 ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggctatgctg 321

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || ||||| || ||| ||  ||||||| | ||| |||||| ||||| ||||||||| |||
Sbjct: 322 ggcgccctgggctgcctgacccccgagctgctggccaagagcggcaccaagttcggtgag 381

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 382 gccgtgtggttc 393



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 132/160 (82%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||||||||||  ||||||||| ||||| |||||||   || | || || |||
Sbjct: 192 tggtacggccctgaccgtgtcaagtacctaggcccattctccggcgaggctccatcatac 251

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           |||||||| || ||||| || |||||||| ||||||||||| ||| | || ||||| |||
Sbjct: 252 ctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgatcca 311

                                                   
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccact 375
           ||||| ||  |||||||| | ||||| ||||| |||||||
Sbjct: 312 gagacattttccaagaaccgtgagcttgaggtcatccact 351



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1508

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 66/72 (91%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| ||||||||||| ||  |||||||||||
Sbjct: 642 tacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgac 701

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 702 ccggagaccttc 713



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 413 ccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           ||||||| | ||| ||||||||||||||  |||||| |||||||||||||||
Sbjct: 782 ccccgagctgctggccaagaacggcatcccgttcggtgaggctgtctggttc 833



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 193 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 252

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 253 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 312

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 313 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 363



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 296 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 355

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| |||||||||   |||||||| |||||
Sbjct: 356 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 410



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 226 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| |||||||| |||||||||   |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 133 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 192

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 193 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 252

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 253 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 303



to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 133 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 192

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 193 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 252

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 253 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 303



to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 193 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 252

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 253 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 312

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 313 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 363



to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 191 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 250

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 251 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 310

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 311 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 361



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || ||||||
Sbjct: 19  tacctcaccggagagttccccggagactacggatgggacaccgccggtctctccgctgac 78

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||||||||||| |||| | ||||| || || |||||||   | ||||| ||||||
Sbjct: 79  cccgagaccttcgccaggaaccgtgagctagaagttatccactgcagatgggccatgctc 138

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 139 ggagccctaggctgcgttttccc 161



to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 174 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 233

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 234 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 293

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 294 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 344



to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 182 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 241

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 242 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 301

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 302 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 352



to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 176 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 235

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 236 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 295

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 296 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 346



to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 181 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 240

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 241 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 300

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 301 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 351



to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 169 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 228

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 229 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 288

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 289 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 339



to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||||||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 183 ccccaaagcatctggtatggaccagaccgtcccaagtacttgggaccattctcggagaac 242

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 243 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 302

                                                              
Query: 324 tcggctgacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||||||||| ||||| ||||| |||||| | ||||| || || ||||||
Sbjct: 303 tcggctgacccggagacattcgctaagaaccgtgagcttgaagtaatccac 353



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                        
Query: 277  tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
            ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 1374 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 1433

                                                                   
Query: 337  agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
            |||| || || |||||||| |||||||| |||||||||   |||||||| |||||
Sbjct: 1434 agacttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 1488



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| ||||||||||| ||||||||||||||||| |||||  | ||||| || ||||
Sbjct: 281 tgaccggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccag 340

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||  || || |||||||| |||||||| ||||||||||  |||||||| |||||
Sbjct: 341 agaattttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 164/203 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| |||||   ||||||| ||||||| ||||| |   || ||||||| |||
Sbjct: 170 tggtacggcccagaccgcgtcaagtacttgggcccattctctggcgagcccccgtcctac 229

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || || ||||||||||| || |||||||| |||||||| || ||  | ||||| ||||||
Sbjct: 230 ctcactggcgagttcccaggtgactacggctgggacactgctgggctttcggccgaccca 289

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           || ||||||||||  |||   ||||| || |||||||||||  ||||||| |||||||| 
Sbjct: 290 gaaaccttcgccagaaaccctgagctcgaagtgatccactccaggtgggccatgctcggg 349

                                  
Query: 396 gccctcgggtgcgtgttccccga 418
           ||| | || ||||| ||||||||
Sbjct: 350 gccttgggctgcgtcttccccga 372



to top

>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence
          Length = 1047

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 217 ggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacc 276
           ||||||| || ||||||||||||||| | || || ||||| ||| | || ||||| ||||
Sbjct: 292 ggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccgtcctacc 351

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           | ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||||||| |
Sbjct: 352 taaccggagaataccccggagactacggctgggacaccgctggactctcggctgacccgg 411

                                                 
Query: 337 agaccttcgccaagaacagggagctggaggtgatccac 374
           |||| ||||| |||||| | ||||| || || ||||||
Sbjct: 412 agacattcgctaagaaccgtgagcttgaagtaatccac 449



to top

>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete
            sequence
          Length = 13145

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 217  ggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacc 276
            ||||||| || ||||||||||||||| | || || ||||| ||| | || ||||| ||||
Sbjct: 5655 ggtacggaccagaccgtcccaagtacttaggaccattctcggagaatacaccgtcctacc 5596

                                                                        
Query: 277  tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
            | ||||| || | |||||| |||||||| ||||||||||| ||| | ||||||||||| |
Sbjct: 5595 taaccggagaataccccggagactacggctgggacaccgctggactctcggctgacccgg 5536

                                                  
Query: 337  agaccttcgccaagaacagggagctggaggtgatccac 374
            |||| ||||| |||||| | ||||| || || ||||||
Sbjct: 5535 agacattcgctaagaaccgtgagcttgaagtaatccac 5498



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||||||||||||||||||||| |||||||| |||||||| || ||  |||| ||||||
Sbjct: 204 tacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctgac 263

                                                     
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccac 374
           || |||||||||   ||| || | ||||||||||||||||||
Sbjct: 264 cccgagaccttcaagaagtaccgtgagctggaggtgatccac 305



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                        
Query: 237  aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
            |||||| |||| || ||||||||||| || || |||||| |||| || |||||||| || 
Sbjct: 900  aagtacttgggaccattctccgagcaaactccatcgtacttgactggtgagttcccaggt 959

                                                                        
Query: 297  gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacagg 356
            || |||||||||||||| || ||| | || |||||||||||||| ||||| | |||| | 
Sbjct: 960  gattacgggtgggacactgctggactttcagctgacccagagacattcgctaggaaccgt 1019

                             
Query: 357  gagctggaggtgatcca 373
            ||||| |||||||||||
Sbjct: 1020 gagcttgaggtgatcca 1036



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                       
Query: 291 cccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaag 350
           ||||| |||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 12  cccggagactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaa 71

                                    
Query: 351 aacagggagctggaggtgatccact 375
           || || |||||||||||||||||||
Sbjct: 72  aatagagagctggaggtgatccact 96



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| |||||| |||| ||  |||||||||||
Sbjct: 247 tacctgactggcgagttccccggcgactacggctgggactccgccggtctgtcggctgac 306

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 307 cccgagaccttc 318



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 65/72 (90%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| ||||||||||||||||||||||| |||||||| || ||  |||||||||||
Sbjct: 197 tacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctgac 256

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 257 ccggagaccttc 268



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 155/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| |||||||||||||| |||||||| ||||||||||| ||  |||| ||||||
Sbjct: 196 tacctgactggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgac 255

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || |||||||||       || | ||||||||| |||||||| | || ||||| ||||| 
Sbjct: 256 ccggagaccttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctg 315

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           || || || || ||| |   ||||||| | ||| |||||| ||||| | |||||||||||
Sbjct: 316 ggcgctctgggctgcatcacccccgagctgctggccaagagcggcacccagttcggcgag 375

                       
Query: 453 gctgtctggttc 464
           ||||||||||||
Sbjct: 376 gctgtctggttc 387



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 3045 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 2986

                                                                        
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
            |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 2985 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 2926

                                   
Query: 393  ggagccctcgggtgcgtgttccc 415
            |||||||| || ||||| |||||
Sbjct: 2925 ggagccctaggctgcgttttccc 2903



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                        
Query: 273  tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
            ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 3084 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 3025

                                                                        
Query: 333  ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
            |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 3024 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 2965

                                   
Query: 393  ggagccctcgggtgcgtgttccc 415
            |||||||| || ||||| |||||
Sbjct: 2964 ggagccctaggctgcgttttccc 2942



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 145/179 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 agttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcg 345
           ||||||||||||||||||| ||||||||||| ||  ||||||||||||| ||||||||| 
Sbjct: 205 agttccccggcgactacggctgggacaccgccggtctgtcggctgacccggagaccttca 264

                                                                       
Query: 346 ccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcgggt 405
                 || | ||||||||| |||||||| | || ||||| ||||| || || || || |
Sbjct: 265 agcgctaccgcgagctggagctgatccacgcccgctgggctatgctgggcgctctgggct 324

                                                                      
Query: 406 gcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           || |   ||||||| | ||| |||||| ||||| | |||||||||||||||||||||||
Sbjct: 325 gcatcacccccgagctgctggccaagagcggcacccagttcggcgaggctgtctggttc 383



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 93802 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 93743

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 93742 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 93683

                                    
Query: 393   ggagccctcgggtgcgtgttccc 415
             |||||||| || ||||| |||||
Sbjct: 93682 ggagccctaggctgcgttttccc 93660



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 104/131 (79%)
 Strand = Plus / Plus

                                                                         
Query: 285   gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
             ||||||||||| || |||||||||||||| || ||  | || || || || |||||||||
Sbjct: 95518 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 95577

                                                                         
Query: 345   gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
             || | |||| | ||||| || || ||||||    | ||||| |||||||||||||| || 
Sbjct: 95578 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 95637

                        
Query: 405   tgcgtgttccc 415
             ||||| |||||
Sbjct: 95638 tgcgttttccc 95648



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 80400 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 80459

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 80460 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 80519

                                    
Query: 393   ggagccctcgggtgcgtgttccc 415
             |||||||| || ||||| |||||
Sbjct: 80520 ggagccctaggctgcgttttccc 80542



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 104/131 (79%)
 Strand = Plus / Minus

                                                                         
Query: 285   gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
             ||||||||||| || |||||||||||||| || ||  | || || || || |||||||||
Sbjct: 78684 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 78625

                                                                         
Query: 345   gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccctcggg 404
             || | |||| | ||||| || || ||||||    | ||||| |||||||||||||| || 
Sbjct: 78624 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 78565

                        
Query: 405   tgcgtgttccc 415
             ||||| |||||
Sbjct: 78564 tgcgttttccc 78554



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 219 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 160

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 159 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 100

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 99  ggagccctaggctgcgttttccc 77



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 231 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 290

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 291 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 350

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 351 ggagccctaggctgcgttttccc 373



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 234 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 293

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 294 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 353

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 354 ggagccctaggctgcgttttccc 376



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 499 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 558

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 559 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 618

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 619 ggagccctaggctgcgttttccc 641



to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccccagagcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcag 263
           ||||| ||||||| ||| || || ||||||||||||||| |||| || ||||| ||| | 
Sbjct: 164 ccccaaagcatcttgtatggaccagaccgtcccaagtacttgggaccattctcggagaac 223

                                                                       
Query: 264 accccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattg 323
           || ||||| ||| | || || || | |||||| |||||||| ||||||||||| ||| | 
Sbjct: 224 acaccgtcttacttaactggagaataccccggagactacggctgggacaccgctggactc 283

                                         
Query: 324 tcggctgacccagagaccttcgccaagaac 353
           ||||||||||| ||||| ||||| ||||||
Sbjct: 284 tcggctgacccggagacattcgctaagaac 313



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 147/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||| || |||||||||  ||||||| ||||||| ||||| |   || | || || |||
Sbjct: 115 tggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagccaccatcctac 174

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || ||||| |||||||| || |||||||| |||||||| || ||| | || ||||| || 
Sbjct: 175 cttaccggagagttccctggtgactacggttgggacactgctggactttcagctgatccc 234

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           |||||||||||||||||| | ||| |||| |||||||||||  | ||||| ||||| |||
Sbjct: 235 gagaccttcgccaagaaccgtgagttggaagtgatccactccagatgggccatgcttgga 294

             
Query: 396 gc 397
           ||
Sbjct: 295 gc 296



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||   |||||| | ||||| ||||| |   || ||||||| |||
Sbjct: 200 tggtacggcccagaccgtgttaagtacttaggcccattctctggtgagcccccgtcttac 259

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
            |||| || |||||||| || |||||||| |||||||| || ||| | || |||||||||
Sbjct: 260 ttgactggagagttcccaggtgactacggttgggacactgctggactttctgctgaccca 319

                                                    
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactc 376
           ||||| |||||||||||| | ||||| || || ||||||||
Sbjct: 320 gagacattcgccaagaaccgtgagcttgaagttatccactc 360



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 317

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 377

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || | | ||||||  |||||||||| |||
Sbjct: 378 ggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttcggagag 437

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 438 gcggtttggttc 449



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 163 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 222

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 223 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 282

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || ||| ||||||  ||||||| || |||
Sbjct: 283 ggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttggagag 342

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 343 gcagtttggttc 354



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| |||||||||||||| |||||||| ||||||||||| ||  |||| ||||||
Sbjct: 198 tacctgactggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgac 257

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 258 ccggagaccttc 269



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| |||||||||||||| |||||||| ||||||||||| ||  |||| ||||||
Sbjct: 224 tacctgactggcgagttccccggtgactacggctgggacaccgccggcctgtccgctgac 165

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 164 ccggagaccttc 153



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 264

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 324

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || | | ||||||  |||||||||| |||
Sbjct: 325 ggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttcggagag 384

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 385 gcggtttggttc 396



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 317

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 377

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || | | ||||||  |||||||||| |||
Sbjct: 378 ggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttcggagag 437

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 438 gcggtttggttc 449



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 21943 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 22002

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 22003 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 22062

                                                                         
Query: 393   ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
             |||||||| || ||||| ||||| ||| |  || | | ||||||  |||||||||| |||
Sbjct: 22063 ggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttcggagag 22122

                         
Query: 453   gctgtctggttc 464
             || || ||||||
Sbjct: 22123 gcggtttggttc 22134



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 16710 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 16651

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 16650 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 16591

                                    
Query: 393   ggagccctcgggtgcgtgttccc 415
             |||||||| || ||||| |||||
Sbjct: 16590 ggagccctaggctgcgtcttccc 16568



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 152/192 (79%)
 Strand = Plus / Plus

                                                                         
Query: 273   tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
             ||||| ||||| |||||||| || |||||||| |||||||| || ||  | || ||||||
Sbjct: 19297 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 19356

                                                                         
Query: 333   ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
             || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 19357 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 19416

                                                                         
Query: 393   ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
             |||||||| || ||||| ||||| ||| |  || ||| ||||||  ||||||| || |||
Sbjct: 19417 ggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttggagag 19476

                         
Query: 453   gctgtctggttc 464
             || || ||||||
Sbjct: 19477 gcagtttggttc 19488



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||| 
Sbjct: 411 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 470

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 471 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 530

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || | | ||||||  |||||||||| |||
Sbjct: 531 ggagccctaggctgcgtcttccctgagcttttggctaggaacggagtcaagttcggagag 590

                       
Query: 453 gctgtctggttc 464
           || || ||||||
Sbjct: 591 gcggtttggttc 602



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 219  tacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctg 278
            |||||||| |||||  ||||||  ||||| || ||||||||  | ||||| || ||||| 
Sbjct: 1093 tacggccccgaccgcgccaagtggctgggacccttctccgatgacaccccctcctacctc 1152

                                                                        
Query: 279  accggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagag 338
            || |||||||||||||| |||||||| ||||||||||| ||  |||| || ||||| |||
Sbjct: 1153 actggcgagttccccggtgactacggctgggacaccgccggcctgtccgccgaccccgag 1212

                    
Query: 339  accttcgc 346
            ||||||||
Sbjct: 1213 accttcgc 1220



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 130/160 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||   |||||| ||||||| |||||||   ||| ||| || |||
Sbjct: 200 tggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcccatcatac 259

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || ||||| |||||||| || |||||||| |||||||| || ||  | || |||||||||
Sbjct: 260 ctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgaccca 319

                                                   
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccact 375
           || |||||||| |||||| | ||||| || || |||||||
Sbjct: 320 gaaaccttcgctaagaaccgtgagcttgaagttatccact 359



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| |||||||| || |||||||| |||||||| || ||| | || ||||| 
Sbjct: 27  taccttaccggagagttccctggtgactacggttgggacactgctggactttcagctgat 86

                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactc 376
           || |||||||||||||||||| | ||| |||| |||||||||||
Sbjct: 87  cccgagaccttcgccaagaaccgagagttggaagtgatccactc 130



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 120/144 (83%), Gaps = 2/144 (1%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct-ga 331
           ||||||||||| || ||||| || |||||||||||||||||||| ||  |||| ||  ||
Sbjct: 216 tacctgaccggtgaattccc-ggtgactacgggtgggacaccgccggtctgtcagccaga 274

                                                                       
Query: 332 cccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           ||||||||| || ||||||||||| |||||||| || || ||  | |||||||| ||| |
Sbjct: 275 cccagagacttttgccaagaacagagagctggaagttattcatgcccggtgggcaatgtt 334

                                   
Query: 392 cggagccctcgggtgcgtgttccc 415
            ||||| ||||||||||| |||||
Sbjct: 335 gggagctctcgggtgcgttttccc 358



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           |||||||| |||||||||||||| |||||||| ||||||||||| ||  |||| ||||||
Sbjct: 182 tacctgactggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgac 241

                       
Query: 333 ccagagaccttc 344
           || |||||||||
Sbjct: 242 ccggagaccttc 253



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 120/147 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
            ||||||||||||||| |||| || ||||| ||| | || ||||| ||| | || || || 
Sbjct: 1923 gaccgtcccaagtacttgggaccattctcggagaacacaccgtcttacttaactggagaa 1864

                                                                        
Query: 288  ttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgcc 347
            | |||||| |||||||| ||||||||||| ||| | ||||||||||| ||||| ||||| 
Sbjct: 1863 taccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgct 1804

                                       
Query: 348  aagaacagggagctggaggtgatccac 374
            |||||| | ||||| || || ||||||
Sbjct: 1803 aagaaccgtgagcttgaagtaatccac 1777



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| ||||| || ||||||||||| ||  | || ||||| 
Sbjct: 33  taccttaccggagagttccccggtgactatggatgggacaccgccggtctatccgctgat 92

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 93  ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 152

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 153 ggagccctaggctgcgttttccc 175



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 264

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 324

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 325 ggagccctaggctgcgtcttccc 347



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacagcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| ||||| |||||||| ||  |||| ||||||||||  |||||||| |||||
Sbjct: 286 agactttcgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 215 tgaccggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccgg 274

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| ||||||||||  |||||||| |||||
Sbjct: 275 agacttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 120/147 (81%)
 Strand = Plus / Minus

                                                                         
Query: 228   gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
             ||||||||||||||| |||| || ||||| ||| | || ||||| ||| | || || || 
Sbjct: 81646 gaccgtcccaagtacttgggaccattctcggagaacacaccgtcttacttaactggagaa 81587

                                                                         
Query: 288   ttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgcc 347
             | |||||| |||||||| ||||||||||| ||| | ||||||||||| ||||| ||||| 
Sbjct: 81586 taccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgct 81527

                                        
Query: 348   aagaacagggagctggaggtgatccac 374
             |||||| | ||||| || || ||||||
Sbjct: 81526 aagaaccgtgagcttgaagtaatccac 81500



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 240 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 299

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 300 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 359

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 360 ggagccctaggctgcgtcttccc 382



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 255 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 314

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 315 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 374

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 375 ggagccctaggctgcgtcttccc 397



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 241 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 300

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           ||||| |||||||||| |||| | ||||| || || ||||||    | ||||| ||||||
Sbjct: 301 ccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 360

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 361 ggagccctaggctgcgttttccc 383



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 685 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 626

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| | || | ||||| || || ||||||    | ||||| ||||||
Sbjct: 625 ccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggccatgctc 566

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 565 ggagccctaggctgcgttttccc 543



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 151 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 210

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 211 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 270

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 271 ggagccctaggctgcgtcttccc 293



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||| | || ||||||
Sbjct: 422 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 481

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | || || || || ||||||    ||||||| ||||||
Sbjct: 482 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggctatgctc 541

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 542 ggagccctaggctgcgtcttccc 564



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 146/182 (80%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||   |||||| ||||||| |||||||   || ||||    |||
Sbjct: 154 tggtacggcccagaccgtgttaagtacttgggcccattctccggtgagcccccaagctac 213

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
            ||||||| || |||||||| ||||| || |||||||| || ||| | || |||||||||
Sbjct: 214 ttgaccggtgaattccccggtgactatggctgggacactgccggactctcagctgaccca 273

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           || ||||| ||||||||| | ||||| || |||||||||||  | ||||| ||||| |||
Sbjct: 274 gaaacctttgccaagaaccgtgagctcgaagtgatccactcaagatgggctatgcttgga 333

             
Query: 396 gc 397
           ||
Sbjct: 334 gc 335



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                        
Query: 267  ccgtcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcg 326
            ||||| ||| |||| || ||||||||||| |||||||| |||||||| || ||| | || 
Sbjct: 1515 ccgtcctacttgactggagagttccccggtgactacggttgggacactgccggactctct 1574

                                                              
Query: 327  gctgacccagagaccttcgccaagaacagggagctggaggtgatccactc 376
            |||||||||||||| ||| |||||||| | ||||| || || ||||||||
Sbjct: 1575 gctgacccagagacattctccaagaaccgtgagcttgaagtcatccactc 1624



to top

>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein
          Length = 1067

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 271 cgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctg 330
           ||||||||| ||||||||||||||| |||||||| ||||||||||| ||  |||| || |
Sbjct: 177 cgtacctgaacggcgagttccccggtgactacggctgggacaccgccggcctgtccgccg 236

                         
Query: 331 acccagagaccttc 344
           |||| |||||||||
Sbjct: 237 accccgagaccttc 250



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||||||||| | ||||||||| |||||||| |||||||| || ||  | || ||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || || || |||||||||||| | ||||| ||||| ||||||    | ||||| ||||||
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152

                                     
Query: 393 ggagccctcgggtgcgtgttccccga 418
           ||||| || |||||||| ||||||||
Sbjct: 153 ggagctcttgggtgcgtcttccccga 178



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||   |||||| | ||||| ||||| |   || ||||||| |||
Sbjct: 199 tggtacggcccagaccgtgttaagtacttaggcccattctctggtgagcccccgtcttac 258

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
            |||| || |||||||| || |||||||| |||||||| || ||| | || |||||||||
Sbjct: 259 ttgactggagagttcccaggtgactacggatgggacactgctggactttctgctgaccca 318

                             
Query: 336 gagaccttcgccaagaac 353
           ||||| ||||||||||||
Sbjct: 319 gagacattcgccaagaac 336



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 109/132 (82%), Gaps = 3/132 (2%)
 Strand = Plus / Plus

                                                                       
Query: 219 tacggccctgaccgtcccaagtacctgggcccgttctccgagcag---accccgtcgtac 275
           ||||||||||||||  |||||| ||||||||| ||||||||| |    |||||   ||||
Sbjct: 145 tacggccctgaccgcgccaagttcctgggccccttctccgagaacgacacccctgagtac 204

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || || |||||||||||||| |||||||| ||||| ||||| ||  |||| |||||||| 
Sbjct: 205 ctcactggcgagttccccggtgactacggctgggataccgccggtctgtctgctgacccc 264

                       
Query: 336 gagaccttcgcc 347
            |||||||||||
Sbjct: 265 cagaccttcgcc 276



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 113/139 (81%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccgg 285

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || || |||||||| || ||||| |||||||||   |||||||| ||||| || |
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcg 345

                              
Query: 397 ccctcgggtgcgtgttccc 415
           | || || ||||| |||||
Sbjct: 346 cyctgggttgcgttttccc 364



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           ||||||||||| |||||||| |||||||| || ||| | || |||||||||||||| |||
Sbjct: 217 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 276

                                           
Query: 345 gccaagaacagggagctggaggtgatccactc 376
            |||||||| | ||||| || || ||||||||
Sbjct: 277 tccaagaaccgtgagcttgaagtcatccactc 308



to top

>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 224/287 (78%)
 Strand = Plus / Plus

                                                                       
Query: 178 ccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccctgaccgtccca 237
           |||||||| | || |||||||| || || |  ||||| ||||| ||||| ||||||||||
Sbjct: 41  ccatgcgcagaactgtcaagagtgctccnccaagcatatggtatggcccagaccgtccca 100

                                                                       
Query: 238 agtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggcg 297
           ||||  |||| |||||||| ||||| || || || ||||| || || || |||||||| |
Sbjct: 101 agtatttgggtccgttctctgagcaaacaccatcataccttactggtgaattccccggtg 160

                                                                       
Query: 298 actacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacaggg 357
           | || || |||||||| || || || || || || || || || || ||||||||| | |
Sbjct: 161 attatggatgggacactgctggtttatctgcagatcctgaaacatttgccaagaaccgtg 220

                                                                       
Query: 358 agctggaggtgatccactcgcggtgggcgatgctcggagccctcgggtgcgtgttccccg 417
           |||| || ||||||||||   | ||||| ||||| || || || || ||||| ||||| |
Sbjct: 221 agcttgaagtgatccactgcagatgggctatgcttggtgcacttggctgcgtcttccctg 280

                                                          
Query: 418 agatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           |  |||| |||||||| ||  |||| || |||||||| |||||||||
Sbjct: 281 aagtcctttccaagaatggtgtcaaatttggcgaggcagtctggttc 327



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 159/200 (79%)
 Strand = Plus / Plus

                                                                       
Query: 216 tggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtac 275
           ||||||||||| ||||||  ||||||| ||||||| ||||| |   || |||| || |||
Sbjct: 133 tggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagcccccatcttac 192

                                                                       
Query: 276 ctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgaccca 335
           || || || || ||||| || ||||| || |||||||| || ||  | || |||||||||
Sbjct: 193 cttactggtgaattccctggtgactatggctgggacactgctgggctttcagctgaccca 252

                                                                       
Query: 336 gagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcgga 395
           || ||||| ||||||||| | ||||| || |||||||||||  | ||||| ||||| |||
Sbjct: 253 gaaacctttgccaagaaccgtgagcttgaagtgatccactccagatgggccatgcttgga 312

                               
Query: 396 gccctcgggtgcgtgttccc 415
           || || ||||| || |||||
Sbjct: 313 gctcttgggtgtgtcttccc 332



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 96/116 (82%)
 Strand = Plus / Plus

                                                                       
Query: 285 gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
           ||||||||||| |||||||| ||||||||||| ||  | || |||||||| |||||||||
Sbjct: 256 gagttccccggtgactacggatgggacaccgccggtctttccgctgaccccgagaccttc 315

                                                                   
Query: 345 gccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggagccct 400
           |||| |||| | ||||| || || |||||||   | ||||| ||||| ||||||||
Sbjct: 316 gccaggaaccgtgagctagaagttatccactgcagatgggccatgcttggagccct 371



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 153/192 (79%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| |||||||| || |||||||| |||||||| || ||  | || ||||||
Sbjct: 350 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 409

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           || ||||| ||||| | |||| | ||||| || || ||||||    ||||||| ||||||
Sbjct: 410 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 469

                                                                       
Query: 393 ggagccctcgggtgcgtgttccccgagatcctgtccaagaacggcatcaagttcggcgag 452
           |||||||| || ||||| ||||| ||| |  || ||| ||||||  ||||||| || |||
Sbjct: 470 ggagccctaggctgcgtcttccctgagcttttggccaggaacggagtcaagtttggagag 529

                       
Query: 453 gctgtctggttc 464
           ||||| ||||||
Sbjct: 530 gctgtttggttc 541



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 288 ttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgcc 347
           ||||| || ||||||||||||||||| || ||| | || ||||||||||||||||| || 
Sbjct: 247 ttccctggtgactacgggtgggacactgctggactctctgctgacccagagacctttgct 306

                                       
Query: 348 aagaacagggagctggaggtgatccact 375
           |||||| | || || |||||||||||||
Sbjct: 307 aagaaccgcgaacttgaggtgatccact 334



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                        
Query: 285  gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
            ||||||||||| |||||||| |||||||| || ||| | || |||||||||||||| |||
Sbjct: 935  gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 994

                                            
Query: 345  gccaagaacagggagctggaggtgatccactc 376
             |||||||| | ||||| || || ||||||||
Sbjct: 995  tccaagaaccgtgagcttgaagtcatccactc 1026



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                        
Query: 285  gagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagagaccttc 344
            ||||||||||| |||||||| |||||||| || ||| | || |||||||||||||| |||
Sbjct: 1236 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 1295

                                            
Query: 345  gccaagaacagggagctggaggtgatccactc 376
             |||||||| | ||||| || || ||||||||
Sbjct: 1296 tccaagaaccgtgagcttgaagtcatccactc 1327



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 113/139 (81%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 223 tgaccggtgagttcccaggtgactacgggtgggacacggcggggctttcggcggatccgg 282

                                                                       
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctcggag 396
           |||| || || | |||||| || ||||| |||||||||   |||||||| ||||| || |
Sbjct: 283 agacttttgcgaggaacagagaactggaagtgatccacagccggtgggcaatgctgggcg 342

                              
Query: 397 ccctcgggtgcgtgttccc 415
           |||| || ||||| |||||
Sbjct: 343 ccctgggttgcgttttccc 361



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || |||||||||||||| || |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| ||||||||||  |||||||| |||||
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| ||  |||| ||||||||||  |||||||| |||||
Sbjct: 286 agacttttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| |||||||||   |||||||| |||||
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| |||||||||   |||||||| |||||
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| |||||||||   |||||||| |||||
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 95/115 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 tgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccag 336
           ||||||| |||||||| || ||||||||||||||||| |||||  | ||||| || || |
Sbjct: 226 tgaccggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccgg 285

                                                                  
Query: 337 agaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgct 391
           |||| || || |||||||| || ||||| |||||||||   |||||||| |||||
Sbjct: 286 agacatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| |||||||||||  |  | || || |||
Sbjct: 229 taccttaccggtgagttccccggtgactacggatgggacaccgcttgtctatccgccgac 288

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           |||||||||||||||| |||| | ||||| || || ||||||    |  |||| ||||||
Sbjct: 289 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagaagggccatgctc 348

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 349 ggagccctaggctgcgttttccc 371



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 tacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgac 332
           ||||| ||||| ||||||||||| |||||||| ||||||||||| ||  | || || |||
Sbjct: 234 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 293

                                                                       
Query: 333 ccagagaccttcgccaagaacagggagctggaggtgatccactcgcggtgggcgatgctc 392
           ||||| |||||||||| |||| | ||||  || || ||||||    | ||||| ||||||
Sbjct: 294 ccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggccatgctc 353

                                  
Query: 393 ggagccctcgggtgcgtgttccc 415
           |||||||| || ||||| |||||
Sbjct: 354 ggagccctaggctgcgttttccc 376



to top

>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein,
            partial
          Length = 2036

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                        
Query: 237  aagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagttccccggc 296
            |||||||| || ||||| ||||  || |||||||| ||||| ||||| ||||| ||||||
Sbjct: 1532 aagtacctaggaccgttttccgtccaaaccccgtcttacctcaccggagagtttcccggc 1591

                                                                       
Query: 297  gactacgggtgggacaccgcgggattgtcggctgacccagagaccttcgccaagaacag 355
            ||||| || ||||||||||| || || || || ||||| ||  |||| |||||||||||
Sbjct: 1592 gactatggttgggacaccgccggtttatccgcagaccctgaagcctttgccaagaacag 1650



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 410 gttccccgagatcctgtccaagaacggcatcaagttcggcgaggctgtctggttc 464
           |||||| ||||||||| ||||||||||| |||||||||||||||| || ||||||
Sbjct: 17  gttcccggagatcctggccaagaacggcgtcaagttcggcgaggcggtgtggttc 71



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 279 accggcgagttccccggcgactacgggtgggacaccgcgggattgtcggctgacccagag 338
           ||||||||||||||||| |||||||| ||||| ||||| ||  |||| |||||||| |||
Sbjct: 399 accggcgagttccccggtgactacggctgggataccgctggcctgtccgctgaccccgag 458

                 
Query: 339 accttc 344
           ||||||
Sbjct: 459 accttc 464



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccct 227
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 155 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 214

                                                                       
Query: 228 gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
           ||||||||||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 215 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 274

                                        
Query: 288 ttccccggcgactacgggtgggacaccgc 316
           | ||| || |||||||| |||||||||||
Sbjct: 275 taccctggagactacggttgggacaccgc 303



to top

>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 132/165 (80%)
 Strand = Plus / Plus

                                                                       
Query: 210 agcatctggtacggccctgaccgtcccaagtacctgggcccgttctccgagcagaccccg 269
           ||||| ||||| ||||| ||||| || |||||| |||| || ||||| ||||| || || 
Sbjct: 225 agcatatggtatggcccagaccgcccaaagtacttgggaccattctctgagcaaactcca 284

                                                                       
Query: 270 tcgtacctgaccggcgagttccccggcgactacgggtgggacaccgcgggattgtcggct 329
           || ||||| || || || ||||| |  ||||| || |||||||| || ||||| || || 
Sbjct: 285 tcataccttactggtgaattcccggaggactatggctgggacactgctggattatccgca 344

                                                        
Query: 330 gacccagagaccttcgccaagaacagggagctggaggtgatccac 374
           ||||| ||||| || || |||||| | ||||||||||||||||||
Sbjct: 345 gaccctgagacatttgctaagaaccgtgagctggaggtgatccac 389



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccct 227
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 100 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 159

                                                                       
Query: 228 gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
           ||||||||||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 160 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 219

                                        
Query: 288 ttccccggcgactacgggtgggacaccgc 316
           | ||| || |||||||| |||||||||||
Sbjct: 220 taccctggagactacggttgggacaccgc 248



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 168 ggccgcatcaccatgcgccggaccgtcaagagcgcgccccagagcatctggtacggccct 227
           |||||||||| |||||| || |||||||||    | || ||||||||||||||||| || 
Sbjct: 149 ggccgcatcatcatgcgtcgtaccgtcaagtctactcctcagagcatctggtacggacca 208

                                                                       
Query: 228 gaccgtcccaagtacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgag 287
           ||||||||||| ||||| || || || |||||  | || || || ||||| ||||| || 
Sbjct: 209 gaccgtcccaaatacctaggaccattttccgaaaacacaccatcatacctaaccggagaa 268

                                        
Query: 288 ttccccggcgactacgggtgggacaccgc 316
           | ||| || |||||||| |||||||||||
Sbjct: 269 taccctggagactacggttgggacaccgc 297


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,414,787
Number of Sequences: 3902068
Number of extensions: 2414787
Number of successful extensions: 50938
Number of sequences better than 10.0: 353
Number of HSP's better than 10.0 without gapping: 353
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 49850
Number of HSP's gapped (non-prelim): 999
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top