| Clone Name | baet112e06 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_464478.1| Oryza sativa (japonica cultivar-group), mRNA Length = 988 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507457.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1078 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507456.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1121 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507455.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1112 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 48 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 107 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 108 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 167 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 168 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 227 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 228 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 287 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 288 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 347 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 348 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 390
>ref|XM_507454.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1121 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 57 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 116 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 117 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 176 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 177 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 236 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 237 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 296 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 297 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 356 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 357 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 399
>ref|XM_507453.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1127 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 63 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 123 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 182 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 183 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 242 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 243 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 302 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 303 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 362 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 363 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 405
>ref|XM_507452.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1127 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 63 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 123 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 182 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 183 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 242 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 243 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 302 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 303 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 362 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 363 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 405
>ref|XM_507451.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507450.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507449.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_507448.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>ref|XM_464480.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1017 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 80 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 139 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 140 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 199 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 200 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 259 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 260 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 319 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 320 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 379 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 380 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 422
>ref|XM_507447.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1145 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 81 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 141 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 200 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 201 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 260 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 261 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 320 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 321 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 380 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 381 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 423
>ref|XM_507446.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1145 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 81 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 141 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 200 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 201 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 260 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 261 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 320 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 321 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 380 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 381 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 423
>ref|XM_507445.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1148 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 84 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 144 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 203 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 204 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 263 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 264 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 323 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 324 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 383 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 384 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 426
>ref|XM_507444.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1148 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 84 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 144 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 203 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 204 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 263 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 264 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 323 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 324 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 383 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 384 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 426
>ref|XM_507443.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1151 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 87 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 146 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 147 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 206 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 207 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 266 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 267 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 326 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 327 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 386 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 387 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 429
>ref|XM_507442.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1168 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 104 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 163 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 164 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 223 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 224 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 283 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 284 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 343 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 344 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 403 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 404 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 446
>ref|XM_507441.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1198 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 134 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 193 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 194 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 253 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 254 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 313 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 314 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 373 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 374 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 433 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 434 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 476
>ref|XM_506748.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2 mRNA Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 64 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 124 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 183 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 184 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 243 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 244 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 303 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 304 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 363 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 364 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 406
>dbj|AK119554.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-208-E06, full insert sequence Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK104557.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-G04, full insert sequence Length = 1112 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 48 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 107 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 108 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 167 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 168 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 227 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 228 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 287 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 288 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 347 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 348 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 390
>dbj|AK104535.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-E04, full insert sequence Length = 1148 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 84 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 144 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 203 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 204 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 263 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 264 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 323 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 324 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 383 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 384 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 426
>dbj|AK104522.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-E10, full insert sequence Length = 1078 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK104734.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-C11, full insert sequence Length = 1121 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 57 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 116 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 117 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 176 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 177 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 236 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 237 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 296 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 297 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 356 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 357 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 399
>dbj|AK104646.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H01, full insert sequence Length = 1127 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 63 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 123 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 182 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 183 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 242 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 243 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 302 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 303 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 362 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 363 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 405
>dbj|AK104636.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-D09, full insert sequence Length = 1126 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 63 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 123 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 182 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 183 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 242 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 243 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 302 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 303 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 362 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 363 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 405
>dbj|AK104469.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D06, full insert sequence Length = 1145 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 81 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 141 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 200 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 201 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 260 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 261 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 320 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 321 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 380 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 381 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 423
>dbj|AK104458.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-B05, full insert sequence Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK104446.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-B11, full insert sequence Length = 1148 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 84 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 144 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 203 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 204 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 263 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 264 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 323 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 324 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 383 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 384 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 426
>dbj|AK104392.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-H10, full insert sequence Length = 1151 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 87 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 146 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 147 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 206 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 207 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 266 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 267 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 326 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 327 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 386 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 387 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 429
>dbj|AK104385.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-E04, full insert sequence Length = 1121 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK104348.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-F11, full insert sequence Length = 1145 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 81 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 141 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 200 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 201 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 260 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 261 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 320 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 321 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 380 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 381 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 423
>dbj|AK104215.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-H02, full insert sequence Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK104096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-B04, full insert sequence Length = 1129 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK060970.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D07, full insert sequence Length = 1168 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 104 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 163 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 164 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 223 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 224 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 283 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 284 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 343 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 344 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 403 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 404 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 446
>dbj|AK060143.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-A02, full insert sequence Length = 988 Score = 291 bits (147), Expect = 9e-76 Identities = 294/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 65 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 125 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 184 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 185 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 244 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 245 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 304 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 305 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 364 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 365 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 407
>dbj|AK109398.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A11, full insert sequence Length = 1128 Score = 283 bits (143), Expect = 2e-73 Identities = 293/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 64 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 124 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 183 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 184 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 243 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| | |||||||| ||||||| || ||||| Sbjct: 244 ctacctggatggcacgcttccgggagacttcaggttcgacccgctggggctatcggaccc 303 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 304 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 363 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 364 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 406
>dbj|AK106085.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-207-B02, full insert sequence Length = 1198 Score = 283 bits (143), Expect = 2e-73 Identities = 293/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 134 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 193 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| |||||| || ||||| | |||||| | ||||||||| | ||| Sbjct: 194 ttcagtctccaggtcttcttcccccaggaaggcacccttcatggtcagggcagaggccac 253 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||||||||| |||||||||||||| | Sbjct: 254 tccccctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgag 313 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 314 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 373 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 374 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 433 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 434 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 476
>dbj|AK068102.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013130I24, full insert sequence Length = 1017 Score = 283 bits (143), Expect = 2e-73 Identities = 293/343 (85%) Strand = Plus / Plus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 80 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 139 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 140 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 199 Query: 198 cccccctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcac 257 ||||||||||||||| || ||||||||||||| ||||| |||||||||||||| | Sbjct: 200 tccccctgccaagcaaggtgctgacaggcagctgtgtttcgcatccaagcagtccctgag 259 Query: 258 ctacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgtccgaccc 317 |||||| || |||||||| || || ||||| || |||||||| ||||||| || ||||| Sbjct: 260 ctacctggatggcacgcttccgggagacttcgggttcgacccgctggggctatcggaccc 319 Query: 318 ggagggcaccggcgggttcatcgagcccaggtggctggcctacggcgagatcttcaacgg 377 |||||| ||||| |||||||||||||| |||||||||||||||||||| | |||||||| Sbjct: 320 ggaggggaccggtgggttcatcgagccacggtggctggcctacggcgaggtgttcaacgg 379 Query: 378 ccggacggcgatgatgggggtggtgggcatgatcgccccggag 420 |||||||||||||||||| || || |||||| ||||||||||| Sbjct: 380 ccggacggcgatgatgggcgtcgtcggcatggtcgccccggag 422
>gb|AY104614.1| Zea mays PCO084486 mRNA sequence Length = 1214 Score = 200 bits (101), Expect = 3e-48 Identities = 182/209 (87%) Strand = Plus / Plus Query: 172 cccttcgtcgtcagggcatcgtccagcccccctgccaagcaaaatgacaacaggcagctg 231 ||||||||||||||||| |||||||| || ||||||||| || | ||||||||||| Sbjct: 265 cccttcgtcgtcagggccagctccagccctccagccaagcaaggtgccgacaggcagctg 324 Query: 232 tggttcgcgtccaagcagtccctcacctacctcgacggcacgctgcctggtgactttggc 291 |||||||||||||||||||||||| |||||||||| ||||||||||| || |||| |||| Sbjct: 325 tggttcgcgtccaagcagtccctctcctacctcgatggcacgctgcccggcgactatggc 384 Query: 292 ttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgagcccaggtgg 351 |||||||| |||| || || ||||||||||||||||| || ||||||||||||| |||| Sbjct: 385 ttcgacccgctgggcctctcggacccggagggcaccgggggcttcatcgagcccaagtgg 444 Query: 352 ctggcctacggcgagatcttcaacggccg 380 |||||||| |||||| | |||||||||| Sbjct: 445 ctggcctatggcgaggtgatcaacggccg 473
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 147 bits (74), Expect = 3e-32 Identities = 122/138 (88%) Strand = Plus / Minus Query: 283 gactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgag 342 ||||| || |||||||| ||||||| || ||||||||||| ||||| |||||||||||| Sbjct: 5469507 gacttcgggttcgacccgctggggctatcggacccggaggggaccggtgggttcatcgag 5469448 Query: 343 cccaggtggctggcctacggcgagatcttcaacggccggacggcgatgatgggggtggtg 402 || |||||||||||||||||||| | |||||||||||||||||||||||||| || || Sbjct: 5469447 ccacggtggctggcctacggcgaggtgttcaacggccggacggcgatgatgggcgtcgtc 5469388 Query: 403 ggcatgatcgccccggag 420 |||||| ||||||||||| Sbjct: 5469387 ggcatggtcgccccggag 5469370 Score = 105 bits (53), Expect = 1e-19 Identities = 113/133 (84%) Strand = Plus / Minus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 5470357 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 5470298 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 5470297 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 5470238 Query: 198 cccccctgccaag 210 |||||||||||| Sbjct: 5470237 tccccctgccaag 5470225 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 221 acaggcagctgtggttcgcgtccaagcagtccctcacctacctcgacggcacg 273 ||||||||||||||||||| |||||||||||||| | |||||| || |||||| Sbjct: 5470117 acaggcagctgtggttcgcatccaagcagtccctgagctacctggatggcacg 5470065 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 cgagatcttcaacggccggac 383 ||||||||||||||||||||| Sbjct: 2971063 cgagatcttcaacggccggac 2971043
>dbj|AP004191.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1524_D08 Length = 143046 Score = 147 bits (74), Expect = 3e-32 Identities = 122/138 (88%) Strand = Plus / Minus Query: 283 gactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgag 342 ||||| || |||||||| ||||||| || ||||||||||| ||||| |||||||||||| Sbjct: 123088 gacttcgggttcgacccgctggggctatcggacccggaggggaccggtgggttcatcgag 123029 Query: 343 cccaggtggctggcctacggcgagatcttcaacggccggacggcgatgatgggggtggtg 402 || |||||||||||||||||||| | |||||||||||||||||||||||||| || || Sbjct: 123028 ccacggtggctggcctacggcgaggtgttcaacggccggacggcgatgatgggcgtcgtc 122969 Query: 403 ggcatgatcgccccggag 420 |||||| ||||||||||| Sbjct: 122968 ggcatggtcgccccggag 122951 Score = 105 bits (53), Expect = 1e-19 Identities = 113/133 (84%) Strand = Plus / Minus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 123938 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123879 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 123878 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 123819 Query: 198 cccccctgccaag 210 |||||||||||| Sbjct: 123818 tccccctgccaag 123806 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 221 acaggcagctgtggttcgcgtccaagcagtccctcacctacctcgacggcacg 273 ||||||||||||||||||| |||||||||||||| | |||||| || |||||| Sbjct: 123698 acaggcagctgtggttcgcatccaagcagtccctgagctacctggatggcacg 123646
>dbj|AP004812.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0026H03 Length = 151827 Score = 147 bits (74), Expect = 3e-32 Identities = 122/138 (88%) Strand = Plus / Minus Query: 283 gactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgag 342 ||||| || |||||||| ||||||| || ||||||||||| ||||| |||||||||||| Sbjct: 14242 gacttcgggttcgacccgctggggctatcggacccggaggggaccggtgggttcatcgag 14183 Query: 343 cccaggtggctggcctacggcgagatcttcaacggccggacggcgatgatgggggtggtg 402 || |||||||||||||||||||| | |||||||||||||||||||||||||| || || Sbjct: 14182 ccacggtggctggcctacggcgaggtgttcaacggccggacggcgatgatgggcgtcgtc 14123 Query: 403 ggcatgatcgccccggag 420 |||||| ||||||||||| Sbjct: 14122 ggcatggtcgccccggag 14105 Score = 105 bits (53), Expect = 1e-19 Identities = 113/133 (84%) Strand = Plus / Minus Query: 78 aacaatggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 137 ||||||||||| |||| ||||||||||||||||||||||||||| ||||| |||| || Sbjct: 15092 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 15033 Query: 138 ttccttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccag 197 ||| |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| Sbjct: 15032 ttcagtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccac 14973 Query: 198 cccccctgccaag 210 |||||||||||| Sbjct: 14972 tccccctgccaag 14960 Score = 65.9 bits (33), Expect = 1e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 221 acaggcagctgtggttcgcgtccaagcagtccctcacctacctcgacggcacg 273 ||||||||||||||||||| |||||||||||||| | |||||| || |||||| Sbjct: 14852 acaggcagctgtggttcgcatccaagcagtccctgagctacctggatggcacg 14800
>ref|XM_464479.1| Oryza sativa (japonica cultivar-group), mRNA Length = 675 Score = 141 bits (71), Expect = 2e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 82 atggcggtccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtcttcc 141 ||||||| |||| ||||||||||||||||||||||||||| ||||| |||| ||||| Sbjct: 1 atggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatcttca 60 Query: 142 ttctccaggtcgtcttcctcccggaagtcccccttcgtcgtcagggcatcgtccagcccc 201 |||||||||| ||||||||| ||||| | |||||| | ||||||||| | ||| ||| Sbjct: 61 gtctccaggtcttcttcctccaggaaggcacccttcatggtcagggcagaggccactccc 120 Query: 202 cctgccaagcaaaatgacaacaggcagctgtggttcgcgtccaagcagtccctcacctac 261 |||||||||||| || ||||||||||||||||||| |||||||||||||| | |||| Sbjct: 121 cctgccaagcaaggtgctgacaggcagctgtggttcgcatccaagcagtccctgagctac 180 Query: 262 ctcgacggcac 272 || || ||||| Sbjct: 181 ctggatggcac 191 Score = 89.7 bits (45), Expect = 7e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 352 ctggcctacggcgagatcttcaacggccggacggcgatgatgggggtggtgggcatgatc 411 ||||||||||||||| | |||||||||||||||||||||||||| || || |||||| || Sbjct: 191 ctggcctacggcgaggtgttcaacggccggacggcgatgatgggcgtcgtcggcatggtc 250 Query: 412 gccccggag 420 ||||||||| Sbjct: 251 gccccggag 259
>gb|AF241525.1|AF241525 Alonsoa meridionalis chlorophyll a/b-binding protein type III mRNA, partial cds Length = 579 Score = 69.9 bits (35), Expect = 6e-09 Identities = 80/95 (84%) Strand = Plus / Plus Query: 283 gactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgag 342 |||||||| || ||||||||||| | |||||||| || |||||||| ||||||||||| Sbjct: 4 gactttgggtttgaccccttgggcttatccgaccccgaaggcaccggagggttcatcgaa 63 Query: 343 cccaggtggctggcctacggcgagatcttcaacgg 377 |||| ||||| |||||||| || ||| ||||||| Sbjct: 64 cccaaatggctagcctacggagaaatcatcaacgg 98
>gb|AY104104.1| Zea mays PCO079073 mRNA sequence Length = 867 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 259 tacctcgacggcacgctgcctggtgactttggcttcgaccccttggg 305 |||||||||||||| || || |||||||| |||||||||||| |||| Sbjct: 295 tacctcgacggcacactaccaggtgacttcggcttcgaccccctggg 341
>gb|AY954734.1| Ostreococcus tauri chloroplast light-harvesting complex I protein precursor Lhca2 gene, complete cds; nuclear gene for chloroplast product Length = 729 Score = 48.1 bits (24), Expect = 0.023 Identities = 36/40 (90%) Strand = Plus / Plus Query: 260 acctcgacggcacgctgcctggtgactttggcttcgaccc 299 ||||||||||| |||| || || ||||||||||||||||| Sbjct: 152 acctcgacggctcgctcccgggcgactttggcttcgaccc 191
>dbj|AK110432.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-B10, full insert sequence Length = 2794 Score = 48.1 bits (24), Expect = 0.023 Identities = 45/52 (86%) Strand = Plus / Plus Query: 259 tacctcgacggcacgctgcctggtgactttggcttcgaccccttggggctgt 310 ||||| || ||| ||||||||||||| ||||| || ||||| |||||||||| Sbjct: 1645 tacctggatggctcgctgcctggtgattttgggtttgacccgttggggctgt 1696
>ref|NM_137518.2| Drosophila melanogaster CG15073-RA (CG15073), mRNA Length = 2046 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggaggagc 70 ||||||||||||||||||||||| Sbjct: 387 ctcggagcagcaggaggaggagc 409
>gb|AY071304.1| Drosophila melanogaster RE33093 full length cDNA Length = 2066 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggaggagc 70 ||||||||||||||||||||||| Sbjct: 387 ctcggagcagcaggaggaggagc 409
>gb|AC099028.1| Drosophila melanogaster, chromosome 2R, region 55F-56X, BAC clone BACR08F09, complete sequence Length = 192358 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggaggagc 70 ||||||||||||||||||||||| Sbjct: 80628 ctcggagcagcaggaggaggagc 80650
>gb|AE003798.3| Drosophila melanogaster chromosome 2R, section 52 of 73 of the complete sequence Length = 242365 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggaggagc 70 ||||||||||||||||||||||| Sbjct: 77092 ctcggagcagcaggaggaggagc 77114
>gb|AC004657.1|AC004657 Drosophila melanogaster DNA sequence (P1s DS08204 (D183) and DS09119 (D236)), complete sequence Length = 76618 Score = 46.1 bits (23), Expect = 0.091 Identities = 23/23 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggaggagc 70 ||||||||||||||||||||||| Sbjct: 26148 ctcggagcagcaggaggaggagc 26170
>gb|AC017000.5| Homo sapiens BAC clone RP11-42B7 from 7, complete sequence Length = 154844 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 124 aggcctctgcagtcttccttct 145 |||||||||||||||||||||| Sbjct: 48369 aggcctctgcagtcttccttct 48390
>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a novel gene, complete sequence Length = 154687 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ctctcggagcagcaggaggagg 67 |||||||||||||||||||||| Sbjct: 50301 ctctcggagcagcaggaggagg 50322
>gb|AC004952.2|AC004952 Homo sapiens PAC clone RP5-1032D7 from 7p22, complete sequence Length = 137057 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 124 aggcctctgcagtcttccttct 145 |||||||||||||||||||||| Sbjct: 93108 aggcctctgcagtcttccttct 93087
>gb|L20422.1|HUM1433ACT Human 14-3-3n protein mRNA, complete cds Length = 1562 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 383 cggcgatgatgggggtggtggg 404 |||||||||||||||||||||| Sbjct: 803 cggcgatgatgggggtggtggg 782
>emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 366M1 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 111702 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ctctcggagcagcaggaggagg 67 |||||||||||||||||||||| Sbjct: 86798 ctctcggagcagcaggaggagg 86819
>emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 278H24 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 150493 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 46 ctctcggagcagcaggaggagg 67 |||||||||||||||||||||| Sbjct: 135695 ctctcggagcagcaggaggagg 135674
>gb|AY756174.4| Oryza rufipogon putative leucine-rich repeat receptor-like kinases and ternary complex factor MIP1-like genes, complete cds; retrotransposon putative membrane-associated protein and gag-pol precursor, pseudogenes, complete sequence; and unknown genes Length = 102522 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 cgagatcttcaacggccggac 383 ||||||||||||||||||||| Sbjct: 13486 cgagatcttcaacggccggac 13506
>gb|AC146163.3| Pan troglodytes BAC clone RP43-24D16 from 7, complete sequence Length = 162475 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 gcaggaggaggagcttgcagg 77 ||||||||||||||||||||| Sbjct: 31669 gcaggaggaggagcttgcagg 31689
>emb|CR733948.2|CNS0GT3F Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 691 atgggggtggtgggcatgatc 671
>emb|CR732997.2|CNS0GSHS Tetraodon nigroviridis full-length cDNA Length = 1074 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 948 atgggggtggtgggcatgatc 928
>emb|CR732118.2|CNS0GRUJ Tetraodon nigroviridis full-length cDNA Length = 1090 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 946 atgggggtggtgggcatgatc 926
>emb|CR727128.2|CNS0GNZY Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR725578.1|CNS0GMSW Tetraodon nigroviridis full-length cDNA Length = 1071 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 926 atgggggtggtgggcatgatc 906
>emb|CR720047.2|CNS0GIJ9 Tetraodon nigroviridis full-length cDNA Length = 835 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 684 atgggggtggtgggcatgatc 664
>emb|CR722968.2|CNS0GKSE Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 694 atgggggtggtgggcatgatc 674
>emb|CR721986.2|CNS0GK14 Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR721973.2|CNS0GK0R Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR720943.2|CNS0GJ85 Tetraodon nigroviridis full-length cDNA Length = 835 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 690 atgggggtggtgggcatgatc 670
>emb|CR720588.2|CNS0GIYA Tetraodon nigroviridis full-length cDNA Length = 834 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR720528.2|CNS0GIWM Tetraodon nigroviridis full-length cDNA Length = 837 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR718492.2|CNS0GHC2 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR718473.2|CNS0GHBJ Tetraodon nigroviridis full-length cDNA Length = 644 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 497 atgggggtggtgggcatgatc 477
>emb|CR717704.2|CNS0GGQ6 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR717299.2|CNS0GGEX Tetraodon nigroviridis full-length cDNA Length = 662 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 517 atgggggtggtgggcatgatc 497
>emb|CR717118.2|CNS0GG9Z Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR716945.2|CNS0GG56 Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR716173.2|CNS0GFJQ Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR716064.2|CNS0GFGS Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 690 atgggggtggtgggcatgatc 670
>emb|CR715921.2|CNS0GFCT Tetraodon nigroviridis full-length cDNA Length = 841 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR714979.2|CNS0GEMN Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 694 atgggggtggtgggcatgatc 674
>emb|CR714034.2|CNS0GDWE Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR713393.2|CNS0GDEL Tetraodon nigroviridis full-length cDNA Length = 640 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 493 atgggggtggtgggcatgatc 473
>emb|CR710531.2|CNS0GB73 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR710154.2|CNS0GAWM Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 694 atgggggtggtgggcatgatc 674
>emb|CR708944.2|CNS0G9Z0 Tetraodon nigroviridis full-length cDNA Length = 612 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 465 atgggggtggtgggcatgatc 445
>emb|CR705890.2|CNS0G7M6 Tetraodon nigroviridis full-length cDNA Length = 758 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 613 atgggggtggtgggcatgatc 593
>emb|CR707049.2|CNS0G8ID Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR707000.2|CNS0G8H0 Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR705879.2|CNS0G7LV Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR705519.2|CNS0G7BV Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR705142.2|CNS0G71E Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR704822.2|CNS0G6SI Tetraodon nigroviridis full-length cDNA Length = 643 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 497 atgggggtggtgggcatgatc 477
>emb|CR704545.2|CNS0G6KT Tetraodon nigroviridis full-length cDNA Length = 694 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagct 71 ||||||||||||||||||||| Sbjct: 216 ggagcagcaggaggaggagct 236
>emb|CR703509.2|CNS0G5S1 Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR702546.2|CNS0G51A Tetraodon nigroviridis full-length cDNA Length = 837 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 684 atgggggtggtgggcatgatc 664
>emb|CR701940.2|CNS0G4KG Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR701500.2|CNS0G488 Tetraodon nigroviridis full-length cDNA Length = 837 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR701498.2|CNS0G486 Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR691318.2|CNS0FWDE Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR696663.2|CNS0G0HV Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR695909.2|CNS0FZWX Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR695523.2|CNS0FZM7 Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR695491.2|CNS0FZLB Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR693485.2|CNS0FY1L Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR693322.2|CNS0FXX2 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR693236.2|CNS0FXUO Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR692761.2|CNS0FXHH Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR692671.2|CNS0FXEZ Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR690335.2|CNS0FVM3 Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR690227.2|CNS0FVJ3 Tetraodon nigroviridis full-length cDNA Length = 822 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 675 atgggggtggtgggcatgatc 655
>emb|CR687816.2|CNS0FTO4 Tetraodon nigroviridis full-length cDNA Length = 830 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 684 atgggggtggtgggcatgatc 664
>emb|CR685672.2|CNS0FS0K Tetraodon nigroviridis full-length cDNA Length = 1034 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 456 atgggggtggtgggcatgatc 436
>emb|CR684111.2|CNS0FQT7 Tetraodon nigroviridis full-length cDNA Length = 834 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 687 atgggggtggtgggcatgatc 667
>emb|CR683013.2|CNS0FPYP Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR682931.1|CNS0FPWF Tetraodon nigroviridis full-length cDNA Length = 1029 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 456 atgggggtggtgggcatgatc 436
>emb|CR682564.2|CNS0FPM8 Tetraodon nigroviridis full-length cDNA Length = 822 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 675 atgggggtggtgggcatgatc 655
>emb|CR681592.2|CNS0FOV8 Tetraodon nigroviridis full-length cDNA Length = 821 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 675 atgggggtggtgggcatgatc 655
>emb|CR681108.2|CNS0FOHS Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR681368.2|CNS0FOP0 Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete sequence Length = 97137 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 57 gcaggaggaggagcttgcagg 77 ||||||||||||||||||||| Sbjct: 42910 gcaggaggaggagcttgcagg 42930
>emb|CR680023.2|CNS0FNNN Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR679463.2|CNS0FN83 Tetraodon nigroviridis full-length cDNA Length = 830 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 688 atgggggtggtgggcatgatc 668
>emb|CR678490.1|CNS0FMH2 Tetraodon nigroviridis full-length cDNA Length = 815 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 681 atgggggtggtgggcatgatc 661
>emb|CR676931.2|CNS0FLA7 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR674862.2|CNS0FJP0 Tetraodon nigroviridis full-length cDNA Length = 843 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 691 atgggggtggtgggcatgatc 671
>emb|CR674066.2|CNS0FJ2W Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR670148.2|CNS0FG22 Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR669238.2|CNS0FFCS Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR668609.2|CNS0FEVB Tetraodon nigroviridis full-length cDNA Length = 797 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 675 atgggggtggtgggcatgatc 655
>emb|CR668354.2|CNS0FEO8 Tetraodon nigroviridis full-length cDNA Length = 835 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 689 atgggggtggtgggcatgatc 669
>emb|CR668281.2|CNS0FEM7 Tetraodon nigroviridis full-length cDNA Length = 848 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 699 atgggggtggtgggcatgatc 679
>emb|CR667570.2|CNS0FE2G Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR667442.2|CNS0FDYW Tetraodon nigroviridis full-length cDNA Length = 845 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR662572.2|CNS0FA7M Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR662555.2|CNS0FA75 Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR661602.2|CNS0F9GO Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR658012.2|CNS0F6OY Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR660736.2|CNS0F8SM Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 689 atgggggtggtgggcatgatc 669
>emb|CR659660.2|CNS0F7YQ Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR658791.2|CNS0F7AL Tetraodon nigroviridis full-length cDNA Length = 795 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 675 atgggggtggtgggcatgatc 655
>emb|CR657579.2|CNS0F6CX Tetraodon nigroviridis full-length cDNA Length = 751 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 682 atgggggtggtgggcatgatc 662
>emb|CR653000.2|CNS0F2TQ Tetraodon nigroviridis full-length cDNA Length = 839 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR651572.2|CNS0F1Q2 Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR650942.2|CNS0F18K Tetraodon nigroviridis full-length cDNA Length = 608 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 465 atgggggtggtgggcatgatc 445
>emb|CR649707.2|CNS0F0A9 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR649423.2|CNS0F02D Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR649142.2|CNS0EZUK Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR647678.2|CNS0EYPW Tetraodon nigroviridis full-length cDNA Length = 835 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR643232.2|CNS0EVAE Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR645116.2|CNS0EWQQ Tetraodon nigroviridis full-length cDNA Length = 821 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR645008.2|CNS0EWNQ Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR644758.2|CNS0EWGS Tetraodon nigroviridis full-length cDNA Length = 841 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR642184.2|CNS0EUHA Tetraodon nigroviridis full-length cDNA Length = 1027 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 882 atgggggtggtgggcatgatc 862
>emb|CR642006.2|CNS0EUCC Tetraodon nigroviridis full-length cDNA Length = 836 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR641349.2|CNS0ETU3 Tetraodon nigroviridis full-length cDNA Length = 841 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR641032.2|CNS0ETLA Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR639385.2|CNS0ESBJ Tetraodon nigroviridis full-length cDNA Length = 840 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR638796.2|CNS0ERV6 Tetraodon nigroviridis full-length cDNA Length = 844 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR637247.2|CNS0EQO5 Tetraodon nigroviridis full-length cDNA Length = 842 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR637338.2|CNS0EQQO Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 693 atgggggtggtgggcatgatc 673
>emb|CR637067.2|CNS0EQJ5 Tetraodon nigroviridis full-length cDNA Length = 688 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 542 atgggggtggtgggcatgatc 522
>emb|CR636161.2|CNS0EPTZ Tetraodon nigroviridis full-length cDNA Length = 834 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>emb|CR634367.2|CNS0EOG5 Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 atgggggtggtgggcatgatc 411 ||||||||||||||||||||| Sbjct: 692 atgggggtggtgggcatgatc 672
>dbj|AP005896.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0032C09 Length = 127263 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 cgagatcttcaacggccggac 383 ||||||||||||||||||||| Sbjct: 17174 cgagatcttcaacggccggac 17154
>dbj|AP007224.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0463E12 Length = 161081 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 cgagatcttcaacggccggac 383 ||||||||||||||||||||| Sbjct: 96702 cgagatcttcaacggccggac 96682
>emb|X15258.1|LECAB8 Tomato CAB-8 gene (constucted from mRNA and DNA) for type III chlorophyll a/b binding polypeptide of photosystem I Length = 2659 Score = 42.1 bits (21), Expect = 1.4 Identities = 54/65 (83%) Strand = Plus / Plus Query: 280 ggtgactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatc 339 ||||||||||| || || |||||||| || || ||||| || ||||| || || |||||| Sbjct: 1652 ggtgactttggttttgatcccttgggactctcggaccctgaaggcacaggaggtttcatc 1711 Query: 340 gagcc 344 ||||| Sbjct: 1712 gagcc 1716
>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence Length = 199737 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 182992 ggagcagcaggaggaggagc 182973
>gb|AC164620.5| Mus musculus BAC clone RP23-64H20 from chromosome 18, complete sequence Length = 182838 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 56283 ggagcagcaggaggaggagc 56302
>gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosome 7, complete sequence Length = 163916 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 51980 ggagcagcaggaggaggagc 51999
>gb|AC154521.2| Mus musculus BAC clone RP23-473O6 from chromosome 13, complete sequence Length = 211603 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 121869 ggagcagcaggaggaggagc 121888
>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence Length = 196946 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 96258 ggagcagcaggaggaggagc 96277
>ref|XM_472726.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 40.1 bits (20), Expect = 5.6 Identities = 41/48 (85%) Strand = Plus / Plus Query: 262 ctcgacggcacgctgcctggtgactttggcttcgaccccttggggctg 309 ||||| ||| |||| || |||||||| ||||||||||| |||||||| Sbjct: 199 ctcgatggctcgctccccggtgacttcggcttcgacccgctggggctg 246
>gb|AC154623.2| Mus musculus BAC clone RP23-327K7 from chromosome 13, complete sequence Length = 190884 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 105603 ggagcagcaggaggaggagc 105622
>gb|AC127171.54| Mus musculus strain C57BL/6J clone rp23-202i7 map 10, complete sequence Length = 194193 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 5 tttcatctcagtctctacca 24 |||||||||||||||||||| Sbjct: 32609 tttcatctcagtctctacca 32628
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence Length = 183048 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 159680 ggagcagcaggaggaggagc 159661
>gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome 7, complete sequence Length = 208880 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 186570 ggagcagcaggaggaggagc 186551 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 186348 ggagcagcaggaggaggagc 186329 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 186294 ggagcagcaggaggaggagc 186275
>ref|XM_322263.1| Neurospora crassa OR74A hypothetical protein (NCU00178.1) partial mRNA Length = 1206 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 447 ggagcagcaggaggaggagc 466
>ref|XM_951308.1| Neurospora crassa OR74A hypothetical protein (NCU00178.1) partial mRNA Length = 1206 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 447 ggagcagcaggaggaggagc 466
>gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, complete sequence Length = 218429 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 30112 ggagcagcaggaggaggagc 30131
>gb|AC131690.3| Mus musculus BAC clone RP23-386P10 from chromosome 10, complete sequence Length = 208306 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 115829 ggagcagcaggaggaggagc 115810
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 2643738 ggagcagcaggaggaggagc 2643719
>gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, complete sequence Length = 222820 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 167018 ggagcagcaggaggaggagc 166999
>ref|XM_545636.2| PREDICTED: Canis familiaris similar to membrane-associated ring finger (C3HC4) 4 (LOC488515), mRNA Length = 1572 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 ctcggagcagcaggaggagg 67 |||||||||||||||||||| Sbjct: 141 ctcggagcagcaggaggagg 160
>gb|BC042932.1| Xenopus laevis hypothetical protein LOC398528, mRNA (cDNA clone IMAGE:5570299), partial cds Length = 1310 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 cagcaggaggaggagcttgc 74 |||||||||||||||||||| Sbjct: 660 cagcaggaggaggagcttgc 679
>gb|AC122851.4| Mus musculus BAC clone RP23-171C17 from chromosome 3, complete sequence Length = 203490 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 172207 ggagcagcaggaggaggagc 172188
>gb|AC122232.3| Mus musculus BAC clone RP23-136G1 from chromosome 7, complete sequence Length = 182272 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 46407 ggagcagcaggaggaggagc 46388 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 46311 ggagcagcaggaggaggagc 46292 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 46257 ggagcagcaggaggaggagc 46238 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 46203 ggagcagcaggaggaggagc 46184
>gb|AC084389.1| Mus musculus BAC clone RP23-247A1 from 1, complete sequence Length = 206497 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 76765 ggagcagcaggaggaggagc 76746
>emb|CR716490.2|CNS0GFSJ Tetraodon nigroviridis full-length cDNA Length = 473 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 372 ggagcagcaggaggaggagc 391
>emb|CR710272.2|CNS0GAZW Tetraodon nigroviridis full-length cDNA Length = 550 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 449 ggagcagcaggaggaggagc 468
>emb|CR687164.2|CNS0FT60 Tetraodon nigroviridis full-length cDNA Length = 554 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 444 ggagcagcaggaggaggagc 463
>emb|CR684139.2|CNS0FQTZ Tetraodon nigroviridis full-length cDNA Length = 546 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 436 ggagcagcaggaggaggagc 455
>emb|CR662227.2|CNS0F9Y1 Tetraodon nigroviridis full-length cDNA Length = 559 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 449 ggagcagcaggaggaggagc 468
>emb|CR657246.2|CNS0F63O Tetraodon nigroviridis full-length cDNA Length = 559 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 449 ggagcagcaggaggaggagc 468
>gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, complete sequence Length = 174481 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 104727 ggagcagcaggaggaggagc 104708
>emb|CR650451.2|CNS0F0UX Tetraodon nigroviridis full-length cDNA Length = 542 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 432 ggagcagcaggaggaggagc 451
>gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219585 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 83033 ggagcagcaggaggaggagc 83014
>gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosome 6, complete sequence Length = 208350 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 163539 ggagcagcaggaggaggagc 163558
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 tcgcgtccaagcagtccctc 255 |||||||||||||||||||| Sbjct: 2305124 tcgcgtccaagcagtccctc 2305105 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 ctacggcgagatcttcaacg 376 |||||||||||||||||||| Sbjct: 98453 ctacggcgagatcttcaacg 98472
>emb|AL157398.6| Human DNA sequence from clone RP11-56H7 on chromosome 10 Contains the NEBL gene for the nebulette protein (actin-binding Z-disc protein), a pseudogene similar to part of MTCO3 (COIII)(cytochrome c oxidase III) and a pseudogene similar to part of MTND1 (NADH dehydrogenase 1), complete sequence Length = 172616 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 13 cagtctctaccacacacacc 32 |||||||||||||||||||| Sbjct: 5517 cagtctctaccacacacacc 5536
>emb|AL035694.8|HS33L1 Human DNA sequence from clone RP1-33L1 on chromosome 6q14.1-15 Contains the TBX18 gene for T-box 18 and 2 CpG islands, complete sequence Length = 100209 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 ctcggagcagcaggaggagg 67 |||||||||||||||||||| Sbjct: 42053 ctcggagcagcaggaggagg 42034
>emb|AL022398.1|HS434O14 Human DNA sequence from clone RP3-434O14 on chromosome 1q32.3-41 Contains the 3' end of the HSD11B1 gene for hydroxysteroid (11-beta) dehydrogenase 1, a adenosine A2b receptor (ADORA2B) pseudogene, the T3JAM gene for TRAF3-interacting Jun N-terminal kinase (JNK)-activating modulator, a novel gene (FLJ25078), the IRF6 gene for interferon regulatory factor 6, a novel gene, a novel gene (MGC29875) and the 5' end of a novel gene, complete sequence Length = 135928 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 ctctgggaggcagctgctgg 121 |||||||||||||||||||| Sbjct: 60543 ctctgggaggcagctgctgg 60524
>gb|AC160391.2| Mus musculus BAC clone RP24-235G7 from chromosome 12, complete sequence Length = 186582 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 136607 ggagcagcaggaggaggagc 136626
>emb|AL596444.10| Mouse DNA sequence from clone RP23-354D12 on chromosome 11 Contains the gene for reversion induced LIM protein (Ril), the Slc22a4 and Slc22a9 genes for solute carrier family 22 (organic cation transporter), members 4 and 9, a Sin3-associated polypeptide 18 (Sap18) pseudogene, a pseudogene similar to part of solute carrier family 22 (organic cation transporter), member 4 Slc22a4 and two CpG islands, complete sequence Length = 171301 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 80004 ggagcagcaggaggaggagc 79985
>dbj|AB251575.1| Oryzias latipes gene for mesp, complete cds Length = 153079 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cggagcagcaggaggaggag 69 |||||||||||||||||||| Sbjct: 70788 cggagcagcaggaggaggag 70807
>gb|AC015743.9| Homo sapiens chromosome 8, clone RP11-1G11, complete sequence Length = 193989 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 caggaggaggagcttgcagg 77 |||||||||||||||||||| Sbjct: 32170 caggaggaggagcttgcagg 32189
>gb|AC116427.1| Homo sapiens chromosome 5 clone CTD-2316N20, complete sequence Length = 103938 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 93353 ggagcagcaggaggaggagc 93334
>gb|AC093835.3| Homo sapiens BAC clone RP11-425A23 from 4, complete sequence Length = 197225 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 57 gcaggaggaggagcttgcag 76 |||||||||||||||||||| Sbjct: 96526 gcaggaggaggagcttgcag 96507
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 26356 ggagcagcaggaggaggagc 26375
>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone BACR27L16, complete sequence Length = 182623 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 20634 ggagcagcaggaggaggagc 20615
>gb|AC102038.9| Mus musculus chromosome 19, clone RP23-248G20, complete sequence Length = 159945 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 99 tctctctgggaggcagctgctggg 122 ||||||||| |||||||||||||| Sbjct: 56942 tctctctggaaggcagctgctggg 56919
>gb|AC160402.8| Mus musculus 10 BAC RP23-115L17 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 224566 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 101 tctctgggaggcagctgctg 120 |||||||||||||||||||| Sbjct: 69258 tctctgggaggcagctgctg 69277
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cggagcagcaggaggaggag 69 |||||||||||||||||||| Sbjct: 21270961 cggagcagcaggaggaggag 21270980
>gb|AC139493.3| Homo sapiens chromosome 5 clone RP11-844P9, complete sequence Length = 173607 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 37108 ggagcagcaggaggaggagc 37127
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 2643848 ggagcagcaggaggaggagc 2643829
>emb|AL928891.20| Mouse DNA sequence from clone RP23-17O9 on chromosome 2, complete sequence Length = 163057 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 1816 ggagcagcaggaggaggagc 1835 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 1696 ggagcagcaggaggaggagc 1715
>emb|AL929550.7| Mouse DNA sequence from clone RP23-77A2 on chromosome 2, complete sequence Length = 80734 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 80550 ggagcagcaggaggaggagc 80569 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 80430 ggagcagcaggaggaggagc 80449
>gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone rp23-362c8, complete sequence Length = 238658 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 160090 ggagcagcaggaggaggagc 160071
>gb|AC122714.2| Homo sapiens chromosome 5 clone RP11-451H23, complete sequence Length = 190024 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 171978 ggagcagcaggaggaggagc 171959
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 348 gtggctggcctacggcgaga 367 |||||||||||||||||||| Sbjct: 768965 gtggctggcctacggcgaga 768946
>gb|AC135608.7| Mus musculus strain C57BL/6J clone rp23-408d14, complete sequence Length = 213801 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 101 tctctgggaggcagctgctg 120 |||||||||||||||||||| Sbjct: 135891 tctctgggaggcagctgctg 135910
>gb|AC122218.4| Mus musculus BAC clone RP23-118J7 from chromosome 16, complete sequence Length = 196599 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 caagcagtccctcacctacc 262 |||||||||||||||||||| Sbjct: 111184 caagcagtccctcacctacc 111203
>gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H24, complete sequence Length = 104325 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 31887 ggagcagcaggaggaggagc 31868
>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting chlorophyll-a/b protein of photosystem I, complete cds Length = 1886 Score = 40.1 bits (20), Expect = 5.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 274 ctgcctggtgactttggcttcgaccccttggg 305 ||||| |||||||| |||||||||||| |||| Sbjct: 393 ctgcccggtgacttcggcttcgaccccctggg 424
>dbj|AB122115.1| Chlamydomonas reinhardtii LhcI-2 gene for light-harvesting chlorophyll-a/b protein of photosystem I (Type III), complete cds Length = 2389 Score = 40.1 bits (20), Expect = 5.6 Identities = 59/72 (81%) Strand = Plus / Plus Query: 283 gactttggcttcgaccccttggggctgtccgacccggagggcaccggcgggttcatcgag 342 ||||| |||||||||||| |||| ||| ||||| | | || |||||| ||||||||| Sbjct: 1056 gacttcggcttcgaccccctgggcctgctggaccccgtgaacagcggcggcttcatcgag 1115 Query: 343 cccaggtggctg 354 |||| ||||||| Sbjct: 1116 cccaagtggctg 1127
>gb|AC153997.3| Mus musculus 6 BAC RP24-571G22 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 150676 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 agcagcaggaggaggagctt 72 |||||||||||||||||||| Sbjct: 97751 agcagcaggaggaggagctt 97770
>dbj|AK110159.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-F03, full insert sequence Length = 3899 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 tacggcgagatcttcaacgg 377 |||||||||||||||||||| Sbjct: 657 tacggcgagatcttcaacgg 638
>dbj|AK104811.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G02, full insert sequence Length = 1138 Score = 40.1 bits (20), Expect = 5.6 Identities = 41/48 (85%) Strand = Plus / Plus Query: 262 ctcgacggcacgctgcctggtgactttggcttcgaccccttggggctg 309 ||||| ||| |||| || |||||||| ||||||||||| |||||||| Sbjct: 261 ctcgatggctcgctccccggtgacttcggcttcgacccgctggggctg 308
>dbj|AK066070.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013055K10, full insert sequence Length = 1144 Score = 40.1 bits (20), Expect = 5.6 Identities = 41/48 (85%) Strand = Plus / Plus Query: 262 ctcgacggcacgctgcctggtgactttggcttcgaccccttggggctg 309 ||||| ||| |||| || |||||||| ||||||||||| |||||||| Sbjct: 262 ctcgatggctcgctccccggtgacttcggcttcgacccgctggggctg 309
>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete sequence Length = 346474 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 64880 ggagcagcaggaggaggagc 64861
>gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 159189 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 14351 ggagcagcaggaggaggagc 14370
>gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, complete sequence Length = 253504 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 201737 ggagcagcaggaggaggagc 201756 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 201674 ggagcagcaggaggaggagc 201693
>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome Length = 2178400 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 384 ggcgatgatgggggtggtgg 403 |||||||||||||||||||| Sbjct: 859922 ggcgatgatgggggtggtgg 859903
>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete sequence Length = 194408 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 110563 ggagcagcaggaggaggagc 110582
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cggagcagcaggaggaggag 69 |||||||||||||||||||| Sbjct: 21197170 cggagcagcaggaggaggag 21197189
>emb|AL844161.18| Mouse DNA sequence from clone RP23-343K11 on chromosome 4, complete sequence Length = 224031 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 112 cagctgctgggtaggcctct 131 |||||||||||||||||||| Sbjct: 174258 cagctgctgggtaggcctct 174239
>emb|AL713932.4|CNS07YPD Oryza sativa chromosome 12, . BAC OSJNBb0094E08 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 137571 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cggagcagcaggaggaggag 69 |||||||||||||||||||| Sbjct: 19239 cggagcagcaggaggaggag 19220
>emb|AL713937.3|CNS07YPI Oryza sativa chromosome 12, . BAC OJ1103_B10 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 95132 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cggagcagcaggaggaggag 69 |||||||||||||||||||| Sbjct: 90317 cggagcagcaggaggaggag 90298
>gb|AC135118.3| Mus musculus BAC clone RP24-450N10 from 3, complete sequence Length = 188353 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 164002 ggagcagcaggaggaggagc 164021
>gb|AC159106.2| Mus musculus chromosome 14 clone RP23-244I11, complete sequence Length = 168884 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 77402 ggagcagcaggaggaggagc 77383
>gb|AC121990.3| Mus musculus BAC clone RP24-298L8 from chromosome 6, complete sequence Length = 173629 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 142522 ggagcagcaggaggaggagc 142503
>emb|AL626773.18| Mouse DNA sequence from clone RP23-273M9 on chromosome 4, complete sequence Length = 193852 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 5 tttcatctcagtctctacca 24 |||||||||||||||||||| Sbjct: 141601 tttcatctcagtctctacca 141620
>emb|AL672119.6| Mouse DNA sequence from clone RP23-437A4 on chromosome X, complete sequence Length = 189703 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 387 gatgatgggggtggtgggca 406 |||||||||||||||||||| Sbjct: 6290 gatgatgggggtggtgggca 6309
>emb|Y14822.1|MMY14822 Mus musculus mRNA containing B1 element, clone 20.1 Length = 631 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 ggagcagcaggaggaggagc 70 |||||||||||||||||||| Sbjct: 515 ggagcagcaggaggaggagc 496 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,458,704 Number of Sequences: 3902068 Number of extensions: 4458704 Number of successful extensions: 123753 Number of sequences better than 10.0: 247 Number of HSP's better than 10.0 without gapping: 248 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 122069 Number of HSP's gapped (non-prelim): 1569 length of query: 420 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 398 effective length of database: 17,147,199,772 effective search space: 6824585509256 effective search space used: 6824585509256 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)