ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet102e03 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1280 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 93 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 393 cacgccattgctggtaggcacactcct 419 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74
>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1298 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 95 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 395 cacgccattgctggtaggcacactcct 421 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76
>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1310 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 96 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 396 cacgccattgctggtaggcacactcct 422 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77
>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA Length = 1343 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 98 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 157 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 158 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 217 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 218 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 277 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 278 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 337 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 338 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 397 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 398 cacgccattgctggtaggcacactcct 424 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 39 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 79
>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full insert sequence Length = 1298 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 95 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 154 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 155 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 214 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 215 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 274 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 275 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 334 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 335 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 394 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 395 cacgccattgctggtaggcacactcct 421 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 36 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 76
>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full insert sequence Length = 1280 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 93 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 152 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 153 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 212 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 213 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 272 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 273 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 332 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 333 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 392 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 393 cacgccattgctggtaggcacactcct 419 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 34 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 74
>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full insert sequence Length = 1342 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 97 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 156 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 157 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 216 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 217 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 276 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 277 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 336 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 337 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 396 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 397 cacgccattgctggtaggcacactcct 423 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 38 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 78
>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full insert sequence Length = 1310 Score = 470 bits (237), Expect = e-129 Identities = 305/327 (93%), Gaps = 3/327 (0%) Strand = Plus / Plus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 96 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 155 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 156 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 215 Query: 281 tacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctgggag 340 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct: 216 tacgtctacaagcgccgcactgacggtatctacattattaaccttggcaagacctgggag 275 Query: 341 aagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgtg 400 ||||| ||| |||| || |||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 276 aagctccagttggctgcgagggtcattgttgcaattgaaaaccctcaggacatcattgtg 335 Query: 401 caatctgctaggccctatggacagagggctgttctcaagtttgcccagtacactggtgct 460 || ||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 336 cagtctgcgaggccctatggccagagggctgttctcaagtttgctcagtacactggtgct 395 Query: 461 aacgccattgctggtaggcacactcct 487 |||||||||||||||||||||||||| Sbjct: 396 cacgccattgctggtaggcacactcct 422 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 113 cctccgctctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||||||||||| || |||| ||||| ||||| Sbjct: 37 cctccgctctctcgcgcacggcgcacgcgcccgaagcccta 77
>gb|AY105034.1| Zea mays PCO130341 mRNA sequence Length = 1213 Score = 367 bits (185), Expect = 2e-98 Identities = 266/293 (90%) Strand = Plus / Plus Query: 195 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 254 |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 76 tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135 Query: 255 agaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatttaca 314 |||||||||| |||||| ||||||||||||| ||||||||||||||||| ||||| |||| Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195 Query: 315 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 374 |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| | Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255 Query: 375 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 434 |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| | Sbjct: 256 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 315 Query: 435 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 |||||||||| |||||||||||||| | ||||||||||| |||||||||||| Sbjct: 316 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcct 368
>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence Length = 1208 Score = 359 bits (181), Expect = 6e-96 Identities = 265/293 (90%) Strand = Plus / Plus Query: 195 tgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggcacca 254 |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 73 tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132 Query: 255 agaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatttaca 314 |||||||||| |||||| ||||||||||||| ||||||||||||||||| ||||| || | Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192 Query: 315 ttatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcga 374 |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||| ||||| | Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252 Query: 375 ttgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggctgttc 434 |||| || || |||||||| || ||||| ||||||||||||||||| ||||||||||| | Sbjct: 253 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 312 Query: 435 tcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 |||||||||| |||||||||||||| | ||||||||||| |||||||||||| Sbjct: 313 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcct 365
>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full insert sequence Length = 1264 Score = 341 bits (172), Expect = 1e-90 Identities = 268/300 (89%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 121 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 180 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||| Sbjct: 181 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 240 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 241 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 300 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 301 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 360 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 361 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 420
>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full insert sequence Length = 1176 Score = 341 bits (172), Expect = 1e-90 Identities = 268/300 (89%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 124 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 183 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||| Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 243 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 244 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 303 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 304 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 363 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 364 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 423
>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full insert sequence Length = 1245 Score = 341 bits (172), Expect = 1e-90 Identities = 268/300 (89%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 |||||||| |||||||| |||||||||||||||||||||||||| || |||||||||||| Sbjct: 127 cgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtccacctc 186 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||| Sbjct: 187 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatccgacggc 246 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 |||| ||| || ||||||||||| |||||||||||||||||| |||| || || || ||| Sbjct: 247 attttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccagagtgatt 306 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| ||||| ||||||||||| ||||| ||||||||||| ||||| |||||| Sbjct: 307 gttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggtcagagg 366 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 ||||| ||||||||||| |||||||| || ||| | ||||||||||| |||||||||||| Sbjct: 367 gctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcacactcct 426
>ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 918 Score = 264 bits (133), Expect = 2e-67 Identities = 253/293 (86%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 28 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 87 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 88 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 147 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 148 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 207 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 208 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 267 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 268 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 320
>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full insert sequence Length = 1310 Score = 264 bits (133), Expect = 2e-67 Identities = 253/293 (86%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 404
>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full insert sequence Length = 1276 Score = 264 bits (133), Expect = 2e-67 Identities = 253/293 (86%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 404
>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full insert sequence Length = 1223 Score = 264 bits (133), Expect = 2e-67 Identities = 253/293 (86%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 112 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 171 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 172 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 231 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 232 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 291 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 292 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 351 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 352 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 404
>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full insert sequence Length = 1320 Score = 264 bits (133), Expect = 2e-67 Identities = 253/293 (86%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 122 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 181 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 241 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 242 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 301 Query: 368 gttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagg 427 ||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| | Sbjct: 302 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 361 Query: 428 gctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 362 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 414
>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds Length = 1141 Score = 262 bits (132), Expect = 1e-66 Identities = 240/276 (86%) Strand = Plus / Plus Query: 212 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 271 ||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 118 gacatccagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaa 177 Query: 272 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 331 ||||| || ||| ||| ||||||||||| ||||| ||||||||||| |||||||| ||| Sbjct: 178 atggaacgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaag 237 Query: 332 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 391 || ||||||||||||||| | || || ||||| || ||||| ||||| ||||||||||| Sbjct: 238 acgtgggagaagcttcagctagcagctagggttatagttgcaattgagaacccccaggat 297 Query: 392 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 451 |||||||| |||||||| ||||| ||||| || || || ||||| |||||||| |||||| Sbjct: 298 atcattgttcaatctgcaaggccttatgggcaaagagcggttctgaagtttgctcagtac 357 Query: 452 actggtgctaacgccattgctggtaggcacactcct 487 ||||||||| | || |||||||| |||||||||||| Sbjct: 358 actggtgctcatgctattgctggaaggcacactcct 393
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 260 bits (131), Expect = 4e-66 Identities = 170/183 (92%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || |||||| Sbjct: 25361297 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 25361238 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 25361237 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 25361178 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 25361177 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 25361118 Query: 485 cct 487 ||| Sbjct: 25361117 cct 25361115 Score = 218 bits (110), Expect = 1e-53 Identities = 139/148 (93%), Gaps = 3/148 (2%) Strand = Plus / Minus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 25362009 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 25361950 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 25361949 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 25361890 Query: 281 tacgtctacaagcgccgcactgacggta 308 |||||||||||||||||||||||||||| Sbjct: 25361889 tacgtctacaagcgccgcactgacggta 25361862 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/93 (86%), Gaps = 3/93 (3%) Strand = Plus / Minus Query: 62 ccccaacccgtcgcgacctctcccgccgccaccacccgtgccttctcttcc-cctccgct 120 ||||||||| |||||||||||||||||||| || |||| ||| ||| || |||||||| Sbjct: 25362118 ccccaacccctcgcgacctctcccgccgccgcc-gccgt-cctcctccacctcctccgct 25362061 Query: 121 ctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||| || |||| ||||| ||||| Sbjct: 25362060 ctctcgcgcacggcgcacgcgcccgaagcccta 25362028 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 5 agatcccgagctagggttttatccca 30 |||||| ||||||||||||||||||| Sbjct: 25362184 agatccggagctagggttttatccca 25362159
>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1056G08 Length = 168173 Score = 260 bits (131), Expect = 4e-66 Identities = 170/183 (92%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||| |||||||| |||||||||||||||||||||||||| ||| |||| || |||||| Sbjct: 54387 ggtatctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtc 54328 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||||||||| ||||||||||||||||| ||||| ||||||||||| ||| Sbjct: 54327 attgttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccag 54268 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 54267 agggctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacact 54208 Query: 485 cct 487 ||| Sbjct: 54207 cct 54205 Score = 218 bits (110), Expect = 1e-53 Identities = 139/148 (93%), Gaps = 3/148 (2%) Strand = Plus / Minus Query: 164 atggcggctgaaggcggtggcgtc---cgggcgctgtcccagcgcgagcaggacatccag 220 |||||||| |||||||||| || | ||||||||||||||||| ||||||||||||||| Sbjct: 55099 atggcggcggaaggcggtgccgccgctcgggcgctgtcccagcgggagcaggacatccag 55040 Query: 221 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccagatggagcgc 280 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 55039 atgatgctcgccgcggacgtccacctcggcaccaagaactgcgacttccagatggagcgc 54980 Query: 281 tacgtctacaagcgccgcactgacggta 308 |||||||||||||||||||||||||||| Sbjct: 54979 tacgtctacaagcgccgcactgacggta 54952 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/93 (86%), Gaps = 3/93 (3%) Strand = Plus / Minus Query: 62 ccccaacccgtcgcgacctctcccgccgccaccacccgtgccttctcttcc-cctccgct 120 ||||||||| |||||||||||||||||||| || |||| ||| ||| || |||||||| Sbjct: 55208 ccccaacccctcgcgacctctcccgccgccgcc-gccgt-cctcctccacctcctccgct 55151 Query: 121 ctctcgcgcacggggctcgcgtccgaaacccta 153 ||||||||||||| || |||| ||||| ||||| Sbjct: 55150 ctctcgcgcacggcgcacgcgcccgaagcccta 55118 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 5 agatcccgagctagggttttatccca 30 |||||| ||||||||||||||||||| Sbjct: 55274 agatccggagctagggttttatccca 55249
>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full insert sequence Length = 1182 Score = 246 bits (124), Expect = 6e-62 Identities = 190/212 (89%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 113 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 172 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggt 307 ||||||||||||||||| ||||||||||||||||||||||||||||||||| | || ||| Sbjct: 173 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgctccgatggt 232 Query: 308 atttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcatt 367 || ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| ||| Sbjct: 233 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 292 Query: 368 gttgcgattgaaaacccccaggacatcattgt 399 ||||| ||||| |||||||||||||||||||| Sbjct: 293 gttgccattgagaacccccaggacatcattgt 324
>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence Length = 1267 Score = 232 bits (117), Expect = 9e-58 Identities = 249/293 (84%) Strand = Plus / Plus Query: 191 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 250 |||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||| Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198 Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||||||||||||||||||||||||||| | || ||||||||||| ||||| || Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||||||| |||||||| || ||| | || || ||||| || ||| Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || || || ||||| ||||||||||| || || || || | |||||||| ||| | ||| Sbjct: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctatggccagcgtgct 378 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacac 483 || |||||||| || ||||||||||| ||| | ||||| ||||| |||||||| Sbjct: 379 gtcctcaagttcgctcagtacactggcgctcatgccatcgctgggaggcacac 431
>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence Length = 1275 Score = 208 bits (105), Expect = 1e-50 Identities = 246/293 (83%) Strand = Plus / Plus Query: 191 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 250 |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237 Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 ||||||||||||||||||||||||||||| || |||| ||||| ||||| ||||| || Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| |||||| Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| || |||||||| || || || || | ||||| || ||| | ||| Sbjct: 358 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 417 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacac 483 || |||||||| || ||||||||||| || | ||||| ||||| |||||||| Sbjct: 418 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacac 470
>gb|AY103617.1| Zea mays PCO143386 mRNA sequence Length = 1516 Score = 208 bits (105), Expect = 1e-50 Identities = 246/293 (83%) Strand = Plus / Plus Query: 191 gcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctcggc 250 |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276 Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 ||||||||||||||||||||||||||||| || |||| ||||| ||||| ||||| || Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| |||||||| |||||||| ||||| ||||| ||| | || || ||||| |||||| Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| || |||||||| || || || || | ||||| || ||| | ||| Sbjct: 397 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 456 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacac 483 || |||||||| || ||||||||||| || | ||||| ||||| |||||||| Sbjct: 457 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacac 509
>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence Length = 1418 Score = 186 bits (94), Expect = 5e-44 Identities = 232/278 (83%) Strand = Plus / Plus Query: 206 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 265 ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 145 gagcaggacatacagatgatgctcgccgccgacgtccaccttggcaccaagaactgcgat 204 Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||| ||||||||| |||| |||||||| | ||||| || ||||| ||||| ||| Sbjct: 205 ttccagacggagcgctatgtctttaagcgccgttccgacggcatctacatcatcaatctt 264 Query: 326 ggcaagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccc 385 |||||||| ||||| || || ||| | || || ||||| || ||||| || || ||||| Sbjct: 265 ggcaagacatgggataaactccagcttgcagcgagggttatcgttgccatcgagaacccg 324 Query: 386 caggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcc 445 ||||||||||| || || ||||| | || ||||| ||| | ||||| |||||||| || Sbjct: 325 caggacatcatcgtccagtctgcccgcccatatggccagcgtgctgtcctcaagttcgct 384 Query: 446 cagtacactggtgctaacgccattgctggtaggcacac 483 ||||||||||| || | ||||| ||||| |||||||| Sbjct: 385 cagtacactggcgcccatgccatcgctgggaggcacac 422
>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete cds Length = 1138 Score = 182 bits (92), Expect = 7e-43 Identities = 230/276 (83%) Strand = Plus / Plus Query: 212 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 271 |||||| |||||||| ||| || || || |||||||| |||||||||||| | | ||| Sbjct: 88 gacatcaagatgatgtgcgctgctgaggttcacctcggaaccaagaactgcaactaccaa 147 Query: 272 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 331 |||||||| ||||||| |||| | |||| |||||||||||||| | |||||||| ||| Sbjct: 148 atggagcgttacgtcttcaagagacgcaacgacggtatttacatctttaaccttggaaag 207 Query: 332 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 391 || ||||||||||| |||||| ||| | ||||| ||||| || || ||||| || ||| Sbjct: 208 acatgggagaagctgatgatggctgcacgagtcatcgttgctatcgagaacccacaagac 267 Query: 392 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 451 ||||||||||| || |||||||||||||| ||||| |||||| | ||||| || |||||| Sbjct: 268 atcattgtgcagtcagctaggccctatggtcagagagctgttttgaagttcgctcagtac 327 Query: 452 actggtgctaacgccattgctggtaggcacactcct 487 ||||| ||||| ||||||||||| |||||||||||| Sbjct: 328 actggagctaatgccattgctggaaggcacactcct 363
>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome AT1G72370 (P40) transcript variant AT1G72370.2 mRNA, complete cds Length = 1173 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 412
>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome AT1G72370 (P40) transcript variant AT1G72370.1 mRNA, complete cds Length = 1185 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 412
>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1032 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 327
>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue Length = 1073 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 96 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 216 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 275 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 276 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 332
>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1103 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 273 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 332 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 333 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 389
>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370) mRNA, complete cds Length = 1042 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 327
>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 897 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 91 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 327
>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin receptor-like protein) (At1g72370; T10D10.16) mRNA, complete cds Length = 1151 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 409
>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 1182 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 412
>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds Length = 1168 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 276 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 335 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 336 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 392
>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1096 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 280 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 339 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 340 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 396
>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS23ZA01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1126 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 266 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 325 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 326 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 382
>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence Length = 1177 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 409
>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA, complete cds Length = 1137 Score = 176 bits (89), Expect = 4e-41 Identities = 200/237 (84%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgacggtatt 310 |||||||| ||| ||| |||||||||||| ||||||| |||| | |||| || |||||| Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204 Query: 311 tacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtcattgtt 370 ||||| ||||||||||||| || ||||| ||||| |||||||| || || || |||||| Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264 Query: 371 gcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacagagggct 430 || ||||| ||||| ||||||||||| || || || |||||||||||||||||||| ||| Sbjct: 265 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 324 Query: 431 gttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacactcct 487 || | |||||||| ||||||||||| || || ||||||||||| || ||||||||| Sbjct: 325 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcct 381
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 165 bits (83), Expect = 2e-37 Identities = 104/111 (93%) Strand = Plus / Minus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 4320455 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320396 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 298 ||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 4320395 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320345 Score = 111 bits (56), Expect = 2e-21 Identities = 146/176 (82%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 4319939 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319880 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 4319879 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319820 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 4319819 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 4319764 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 225 tgctcgccgccgacgtccacctcg 248 ||||||||||||||||| |||||| Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027
>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0032G08, from Chromosome 3, complete sequence Length = 122052 Score = 165 bits (83), Expect = 2e-37 Identities = 104/111 (93%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 106042 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 106101 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 298 ||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 106102 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 106152 Score = 111 bits (56), Expect = 2e-21 Identities = 146/176 (82%) Strand = Plus / Plus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 106558 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 106617 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 106618 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 106677 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 106678 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 106733
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 165 bits (83), Expect = 2e-37 Identities = 104/111 (93%) Strand = Plus / Minus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtccacctc 247 ||||||||||| ||| ||||||||| | |||||||||||||||||||||||||||||| Sbjct: 4320570 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgccgacgtccacctc 4320511 Query: 248 ggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 298 ||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 4320510 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 4320460 Score = 111 bits (56), Expect = 2e-21 Identities = 146/176 (82%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||| ||||| |||||||| |||||||| ||||||||||| ||| | || || ||||| Sbjct: 4320054 ggtatctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtg 4319995 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| |||||||||||||||||||| || || || | ||||| || ||| Sbjct: 4319994 attgttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccag 4319935 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggca 480 | || || |||||||| || ||||||||||| || ||||||||||||| ||||| Sbjct: 4319934 cgcgccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggca 4319879 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 225 tgctcgccgccgacgtccacctcg 248 ||||||||||||||||| |||||| Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660
>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40 Length = 1169 Score = 151 bits (76), Expect = 3e-33 Identities = 226/276 (81%) Strand = Plus / Plus Query: 212 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 271 ||||||||||||||| | || ||||| || |||||||| ||||||||||| | |||||| Sbjct: 114 gacatccagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccag 173 Query: 272 atggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaag 331 |||||||| ||| | | || ||||||| ||| |||||||| || || || ||||| ||| Sbjct: 174 atggagcgttacatttttaaacgccgcaatgatggtatttatatcataaatcttggaaag 233 Query: 332 acctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggac 391 || ||||| || ||| | | || || ||| |||||||||| ||||| || | |||||| Sbjct: 234 acatgggataaacttaaccttgctgctaggatcattgttgccattgagaattctcaggac 293 Query: 392 atcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagtac 451 |||||||| |||||||| || || |||||||| || ||||||||||| ||||| |||||| Sbjct: 294 atcattgttcaatctgcaagaccttatggacaaagagctgttctcaaatttgctcagtac 353 Query: 452 actggtgctaacgccattgctggtaggcacactcct 487 ||||| ||| | || |||||||| |||||||||||| Sbjct: 354 actggagctcatgctattgctggaaggcacactcct 389
>emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40 Length = 3690 Score = 149 bits (75), Expect = 1e-32 Identities = 156/183 (85%) Strand = Plus / Plus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 2279 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 2338 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 2339 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 2398 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 2399 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 2458 Query: 485 cct 487 ||| Sbjct: 2459 cct 2461 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaag 292 |||||||| ||| ||| |||||||||||| ||||||| |||| Sbjct: 1688 accaagaattgcaattaccagatggagcgttacgtcttcaag 1729
>emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene Length = 2049 Score = 149 bits (75), Expect = 1e-32 Identities = 156/183 (85%) Strand = Plus / Plus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 768 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 827 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 828 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 887 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 888 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 947 Query: 485 cct 487 ||| Sbjct: 948 cct 950 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaag 292 |||||||| ||| ||| |||||||||||| ||||||| |||| Sbjct: 177 accaagaattgcaattaccagatggagcgttacgtcttcaag 218
>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete sequence Length = 87039 Score = 149 bits (75), Expect = 1e-32 Identities = 156/183 (85%) Strand = Plus / Plus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||||||||| ||||||||||||| || ||||| ||||| |||||||| || || || Sbjct: 69070 ggtatttacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagtt 69129 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||||| ||||| ||||| ||||||||||| || || || |||||||||||||||||| Sbjct: 69130 attgttgccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacag 69189 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || ||||| | |||||||| ||||||||||| || || ||||||||||| || |||||| Sbjct: 69190 agagctgtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacact 69249 Query: 485 cct 487 ||| Sbjct: 69250 cct 69252 Score = 44.1 bits (22), Expect = 0.42 Identities = 37/42 (88%) Strand = Plus / Plus Query: 251 accaagaactgcgatttccagatggagcgctacgtctacaag 292 |||||||| ||| ||| |||||||||||| ||||||| |||| Sbjct: 68477 accaagaattgcaattaccagatggagcgttacgtcttcaag 68518
>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds Length = 1111 Score = 147 bits (74), Expect = 4e-32 Identities = 200/242 (82%) Strand = Plus / Plus Query: 245 ctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgcactgac 304 ||||||||||| ||||| ||||||||||||||||| || |||| ||||||||| | || Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212 Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 |||||||| || ||||| | || ||||| |||||||||||| | |||| || ||||| Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagcttatgttggctgctagggtt 272 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 |||||| | ||||| || ||||||||||||||||| || ||||||||||| || || ||| Sbjct: 273 attgtttctattgagaatccccaggacatcattgtccagtctgctaggccttacggtcag 332 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || ||||| | |||||||| ||||| ||||||||| | || ||||||||| | |||||| Sbjct: 333 agagctgtcttgaagtttgctcagtatactggtgctcatgctattgctggtcgtcacact 392 Query: 485 cc 486 || Sbjct: 393 cc 394
>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like mRNA, complete cds Length = 1106 Score = 135 bits (68), Expect = 1e-28 Identities = 158/188 (84%) Strand = Plus / Plus Query: 239 gtccacctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 298 ||||||||||| || |||||||| || ||||| ||||| || ||||||| |||||| ||| Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173 Query: 299 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 358 | |||||||| |||||||| ||| ||| ||||| ||||| ||||| || ||||| || Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagctgcatatggcagct 233 Query: 359 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 418 || || |||||| | ||||| || || ||||||||||||||||||||||| ||||||||| Sbjct: 234 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 293 Query: 419 ggacagag 426 |||||||| Sbjct: 294 ggacagag 301
>ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constituent of ribosome AT3G04770 (RPSAB) transcript variant AT3G04770.1 mRNA, complete cds Length = 1200 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 482 actcct 487 |||||| Sbjct: 356 actcct 361
>ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constituent of ribosome AT3G04770 (RPSAB) transcript variant AT3G04770.2 mRNA, complete cds Length = 1124 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 482 actcct 487 |||||| Sbjct: 356 actcct 361
>gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal protein (At3g04770/F7O18_26) mRNA, complete cds Length = 999 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 145 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 204 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 205 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 264 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 265 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 324 Query: 482 actcct 487 |||||| Sbjct: 325 actcct 330
>gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, complete cds Length = 1157 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 176 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 235 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 236 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 295 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 296 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 355 Query: 482 actcct 487 |||||| Sbjct: 356 actcct 361
>gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete sequence Length = 1027 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 178 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 237 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 238 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 297 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 298 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 357 Query: 482 actcct 487 |||||| Sbjct: 358 actcct 363
>gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mRNA, complete cds Length = 1105 Score = 131 bits (66), Expect = 2e-27 Identities = 156/186 (83%) Strand = Plus / Plus Query: 302 gacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagg 361 |||||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||| Sbjct: 157 gacggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagg 216 Query: 362 gtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatgga 421 || ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||| Sbjct: 217 gttattgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatgga 276 Query: 422 cagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcac 481 || || ||||| | |||||||| ||||||||||||| ||| || |||||||| || ||| Sbjct: 277 caaagagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacac 336 Query: 482 actcct 487 |||||| Sbjct: 337 actcct 342
>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds Length = 1061 Score = 127 bits (64), Expect = 4e-26 Identities = 157/188 (83%) Strand = Plus / Plus Query: 239 gtccacctcggcaccaagaactgcgatttccagatggagcgctacgtctacaagcgccgc 298 ||||||||||| || |||||||| || ||||| ||||| || ||||||| |||||| ||| Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162 Query: 299 actgacggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgca 358 | |||||||| || ||||| ||| ||| ||||| ||||| ||||| || ||||| || Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagctgcatatggcagct 222 Query: 359 agggtcattgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctat 418 || || |||||| | ||||| || || ||||||||||||||||||||||| ||||||||| Sbjct: 223 agagttattgtttctattgagaatcctcaggacatcattgtgcaatctgccaggccctat 282 Query: 419 ggacagag 426 |||||||| Sbjct: 283 ggacagag 290
>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence, complete sequence Length = 95310 Score = 125 bits (63), Expect = 1e-25 Identities = 153/183 (83%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 ||||||||||| ||||| ||||| ||||| ||||| |||||||||||||| || ||||| Sbjct: 88836 ggtatttacataatcaatcttggaaagacatgggacaagcttcagatggctgctagggtt 88777 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 ||||| || || |||||||| | ||||| ||||| ||||| || ||||| |||||||| Sbjct: 88776 attgtagcaatcgaaaacccaaaagacataattgttcaatcagccaggccttatggacaa 88717 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || ||||| | |||||||| ||||||||||||| ||| || |||||||| || |||||| Sbjct: 88716 agagctgtcttgaagtttgctcagtacactggtgttaatgcgattgctggaagacacact 88657 Query: 485 cct 487 ||| Sbjct: 88656 cct 88654
>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence Length = 114535 Score = 125 bits (63), Expect = 1e-25 Identities = 153/183 (83%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 |||||||| || || || ||||| || || |||||||| ||||| | || || |||||| Sbjct: 42238 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 42179 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 || ||||| || || |||||||||||||| ||||| |||||||| ||||| ||||||||| Sbjct: 42178 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 42119 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || || ||||| |||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 42118 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 42059 Query: 485 cct 487 ||| Sbjct: 42058 cct 42056 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 212 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 271 ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| Sbjct: 42991 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaa 42932 Query: 272 atgga 276 ||||| Sbjct: 42931 atgga 42927
>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence Length = 127701 Score = 125 bits (63), Expect = 1e-25 Identities = 153/183 (83%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggccgcaagggtc 364 |||||||| || || || ||||| || || |||||||| ||||| | || || |||||| Sbjct: 7758 ggtatttatatcattaatcttggaaaaacttgggagaaacttcaactagctgccagggtc 7699 Query: 365 attgttgcgattgaaaacccccaggacatcattgtgcaatctgctaggccctatggacag 424 || ||||| || || |||||||||||||| ||||| |||||||| ||||| ||||||||| Sbjct: 7698 atcgttgcaatcgagaacccccaggacattattgttcaatctgcaaggccttatggacag 7639 Query: 425 agggctgttctcaagtttgcccagtacactggtgctaacgccattgctggtaggcacact 484 || || ||||| |||||||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 7638 agagccgttcttaagtttgctcagtacactggagctaatgctattgctggaagacacact 7579 Query: 485 cct 487 ||| Sbjct: 7578 cct 7576 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 212 gacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgatttccag 271 ||||||||||||||| | || || || ||||||||||| ||||||||||| || ||||| Sbjct: 8511 gacatccagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaa 8452 Query: 272 atgga 276 ||||| Sbjct: 8451 atgga 8447
>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full insert sequence Length = 1144 Score = 119 bits (60), Expect = 9e-24 Identities = 105/120 (87%) Strand = Plus / Plus Query: 280 ctacgtctacaagcgccgcactgacggtatttacattatcaaccttggcaagacctggga 339 ||||||||||||||||||| | || ||||| ||||| |||||||| |||||||| ||||| Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225 Query: 340 gaagcttcagatggccgcaagggtcattgttgcgattgaaaacccccaggacatcattgt 399 |||||| ||| | || || ||||| |||||||| ||||| |||||||||||||||||||| Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgt 285 Score = 52.0 bits (26), Expect = 0.002 Identities = 47/54 (87%) Strand = Plus / Plus Query: 188 cgggcgctgtcccagcgcgagcaggacatccagatgatgctcgccgccgacgtc 241 ||||||||||| ||| ||||||||| | |||||||||||||||||| ||||| Sbjct: 119 cgggcgctgtcgcaggcggagcaggacgtgcagatgatgctcgccgcctacgtc 172
>gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence Length = 405672 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 391 catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 450 |||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |||| Sbjct: 25882 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 25823 Query: 451 cactggtgctaacgccattgctggtaggcacactcct 487 |||||||||| | |||||||| || |||||||||||| Sbjct: 25822 cactggtgctcatgccattgccggcaggcacactcct 25786 Score = 75.8 bits (38), Expect = 1e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 206 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 265 |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| || || Sbjct: 26632 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaattgggac 26573 Query: 266 ttccagatgg 275 ||| |||||| Sbjct: 26572 ttctagatgg 26563 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 354 ||||| |||||||| ||||||||||||||||| |||||||||||| |||| Sbjct: 25949 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 25900
>gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence Length = 323584 Score = 113 bits (57), Expect = 5e-22 Identities = 87/97 (89%) Strand = Plus / Minus Query: 391 catcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgcccagta 450 |||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |||| Sbjct: 6056 catcattgtgcagtctgctaggccctatgtccagagggctgtcctcaagtttgcgtagta 5997 Query: 451 cactggtgctaacgccattgctggtaggcacactcct 487 |||||||||| | |||||||| || |||||||||||| Sbjct: 5996 cactggtgctcatgccattgccggcaggcacactcct 5960 Score = 75.8 bits (38), Expect = 1e-10 Identities = 62/70 (88%) Strand = Plus / Minus Query: 206 gagcaggacatccagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgat 265 |||||||||||||||||||| |||||| ||||||| |||||||| |||||||| || || Sbjct: 6806 gagcaggacatccagatgatcctcgccaccgacgtgcacctcggtaccaagaattgggac 6747 Query: 266 ttccagatgg 275 ||| |||||| Sbjct: 6746 ttctagatgg 6737 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 305 ggtatttacattatcaaccttggcaagacctgggagaagcttcagatggc 354 ||||| |||||||| ||||||||||||||||| |||||||||||| |||| Sbjct: 6123 ggtatctacattattaaccttggcaagacctgtgagaagcttcagttggc 6074
>emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH91ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1125 Score = 101 bits (51), Expect = 2e-18 Identities = 168/207 (81%) Strand = Plus / Plus Query: 268 ccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaaccttgg 327 |||||||||||| ||||||| | || | ||| || ||||||||| | || ||||||| Sbjct: 179 ccagatggagcgttacgtcttcgagagacgcgacgatggtatttacgtcttcgaccttgg 238 Query: 328 caagacctgggagaagcttcagatggccgcaagggtcattgttgcgattgaaaaccccca 387 ||||| ||||| ||||| |||||||| || || || |||||||| ||||| ||||| || Sbjct: 239 caagagatgggaaaagctccagatggctgctagagttattgttgccattgagaacccaca 298 Query: 388 ggacatcattgtgcaatctgctaggccctatggacagagggctgttctcaagtttgccca 447 | ||||||| || || | |||||||||||||||||||| |||||| | |||||||| || Sbjct: 299 gaacatcatcgtccagtgagctaggccctatggacagagagctgttttgaagtttgctca 358 Query: 448 gtacactggtgctaacgccattgctgg 474 ||| ||||| || || |||||| |||| Sbjct: 359 gtagactggagcgaatgccatttctgg 385
>gb|AY262686.1| Glycine max cultivar Williams 82 BAC clone Gm_ISb001_104_J07, complete sequence Length = 103334 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 416 tatggacagagggctgttctcaagtttgcccagtacactggtgctaacgccattgctggt 475 ||||| ||||| || |||||||||||||| ||||||| ||||||| | ||||||||||| Sbjct: 67616 tatgggcagagagcagttctcaagtttgctcagtacattggtgcttatgccattgctgga 67557 Query: 476 aggca 480 ||||| Sbjct: 67556 aggca 67552
>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA Length = 2515 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 1683 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 1742 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 1743 ggcaagacctgggagaagctgcagctggc 1771
>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence Length = 627 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 195 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 196 ggcaagacctgggagaagctgcagctggc 224
>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence Length = 579 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 61 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 120 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 121 ggcaagacctgggagaagctgcagctggc 149
>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7 Length = 45861 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 16963 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 16904 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 16903 ggcaagacctgggagaagctgcagctggc 16875
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181360 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 159534 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 159475 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 159474 ggcaagacctgggagaagctgcagctggc 159446
>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA Length = 1104 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362
>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA Length = 964 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 759 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 700 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 699 ggcaagacctgggagaagctgcagctggc 671
>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D (sta), mRNA Length = 1041 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 223 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 282 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 283 ggcaagacctgggagaagctgcagctggc 311
>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B (sta), mRNA Length = 1089 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 274 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 333 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 334 ggcaagacctgggagaagctgcagctggc 362
>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end Length = 1272 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 176 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 235 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 236 ggcaagacctgggagaagctgcagctggc 264
>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A (sta), mRNA Length = 1236 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 421 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 480 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 481 ggcaagacctgggagaagctgcagctggc 509
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 22118 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 22059 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 22058 ggcaagacctgggagaagctgcagctggc 22030
>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds Length = 902 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| |||| || | |||| ||||||| Sbjct: 93 ttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacctg 152 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 153 ggcaagacctgggagaagctgcagctggc 181
>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds Length = 1545 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacctt 325 ||||||||||||| ||||| |||||||||||| | || || || |||| ||||||| Sbjct: 723 ttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacctg 782 Query: 326 ggcaagacctgggagaagcttcagatggc 354 |||||||||||||||||||| ||| |||| Sbjct: 783 ggcaagacctgggagaagctgcagctggc 811
>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 882 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 499 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197
>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 198
>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 886 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215
>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 206
>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 96 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 154
>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 164 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 222
>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 296 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 212
>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 981 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 923
>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1027 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 223
>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 818 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219
>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 219
>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 426 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 228
>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 987 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 957 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 216
>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207
>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 214
>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208
>emb|BX025854.1|CNS08S42 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA39DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 394 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 210
>emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 343 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 195
>emb|BX020718.1|CNS08O5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 207
>emb|BX015795.1|CNS08KCN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 208
>emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 139 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 197
>emb|BX015037.1|CNS08JRL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA22CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 215
>emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA20CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 671 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203
>emb|BX012242.1|CNS08HLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA19BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 359 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 203
>emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 289 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 126 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 184
>emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA13DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226
>ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 (ENSANGG00000017682), partial mRNA Length = 803 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| ||||||||||||||||||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 226
>emb|BX006256.1|CNS08CZO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA10CE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 948 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 264 atttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacc 323 ||||||||||||||| ||||| |||||||||||||| |||||| | |||| ||||||| Sbjct: 134 atttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193 Query: 324 t 324 | Sbjct: 194 t 194
>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 926 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163
>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223
>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198
>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193
>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 99 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 157
>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 260 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 116 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 174
>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 918 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 584 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 582 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 521 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207
>emb|BX069252.1|CNS09PLK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1022 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181
>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 572 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 962 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 904
>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 162 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 220
>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897
>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 510 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 866 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 194
>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 609 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 781 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 963 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196
>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 169 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 227
>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 642 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 959 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| || || ||||||||||||||||||||| | |||| |||||||| Sbjct: 954 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 896
>emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| || || ||||||||||||||||||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtatgtgtacaagcgccgcactgacggtgtgcacatcatcaacct 211
>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 639 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 899 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacct 897
>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 883 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1042 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 457 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198
>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 752 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 319 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 348 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 146 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 204
>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 138 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 196
>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 93 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 151
>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 131 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 189
>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 617 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 979 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 193 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 97 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 155
>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 153 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 211
>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 107 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 165
>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1003 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 977 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 919
>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 794 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187
>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 58 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 116
>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 956 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 285 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 806 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 699 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 170 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 228
>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 123 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 181
>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 715 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 808 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 105 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 163
>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 425 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 121 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 179
>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 163 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 221
>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 141 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 199
>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 338 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186
>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 157 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 215
>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1019 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 166 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 224
>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 128 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 186
>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 509 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 156 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 214
>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 863 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195
>emb|BX041242.1|CNS093ZI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 864 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 806
>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180
>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 168 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 226
>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 343 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 135 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 193
>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 795 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 83 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 141
>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195
>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 122 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 180
>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 158 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 216
>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 82 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 140
>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 850 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 129 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 187
>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 149 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 207
>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1018 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 955 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 897
>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1079 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 930 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 161 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 219
>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 143 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 201
>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 650 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 979 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 921
>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 151 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 209
>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 830 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1027 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 991 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 933
>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1033 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 165 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 223
>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 142 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 200
>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 993 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 984 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 926
>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1025 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 160 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 218
>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 147 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 205
>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 145 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 203
>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 397 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 154 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 212
>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 497 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 155 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 213
>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 159 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 217
>emb|BX031154.1|CNS08W7A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 150 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 208
>emb|BX031118.1|CNS08W6A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46BG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 404 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 152 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 210
>emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45CB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 980 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 137 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 195
>emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1004 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 136 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 194
>emb|BX029939.1|CNS08V9J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44CH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 471 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 144 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 202
>emb|BX029906.1|CNS08V8M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44CG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 759 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 148 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 206
>emb|BX029898.1|CNS08V8E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44CF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 163 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 221
>emb|BX029447.1|CNS08UVV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 994 Score = 54.0 bits (27), Expect = 4e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 266 ttccagatggagcgctacgtctacaagcgccgcactgacggtatttacattatcaacct 324 ||||||||||||| ||||| |||||||||||||| |||||| | |||| |||||||| Sbjct: 140 ttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacct 198 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,195,658 Number of Sequences: 3902068 Number of extensions: 3195658 Number of successful extensions: 74913 Number of sequences better than 10.0: 523 Number of HSP's better than 10.0 without gapping: 462 Number of HSP's successfully gapped in prelim test: 63 Number of HSP's that attempted gapping in prelim test: 73946 Number of HSP's gapped (non-prelim): 940 length of query: 487 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 465 effective length of database: 17,147,199,772 effective search space: 7973447893980 effective search space used: 7973447893980 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
