Clone Name	baet102d04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT016485.1| Zea mays clone Contig318 mRNA sequence	428	e-117
2	gb|BT016521.1| Zea mays clone Contig354 mRNA sequence	416	e-113
3	gb|AY103617.1| Zea mays PCO143386 mRNA sequence	416	e-113
4	dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clon...	402	e-109
5	dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clon...	402	e-109
6	dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clon...	402	e-109
7	dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clon...	402	e-109
8	ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predic...	396	e-107
9	gb|BT016624.1| Zea mays clone Contig457 mRNA sequence	383	e-103
10	dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clon...	325	7e-86
11	ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA	270	4e-69
12	ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group...	270	4e-69
13	ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group...	270	4e-69
14	ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group...	270	4e-69
15	dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clon...	270	4e-69
16	dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clon...	270	4e-69
17	dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clon...	270	4e-69
18	dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clon...	270	4e-69
19	dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clon...	252	9e-64
20	dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clon...	252	9e-64
21	dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clon...	252	9e-64
22	gb|AY105034.1| Zea mays PCO130341 mRNA sequence	234	2e-58
23	gb|BT016512.1| Zea mays clone Contig345 mRNA sequence	226	5e-56
24	dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clon...	224	2e-55
25	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	208	1e-50
26	gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon...	208	1e-50
27	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	208	1e-50
28	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	172	7e-40
29	dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic D...	172	7e-40
30	gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p...	133	6e-28
31	ref|NM_001036190.1| Arabidopsis thaliana P40; structural constit...	100	8e-18
32	ref|NM_105896.2| Arabidopsis thaliana P40; structural constituen...	100	8e-18
33	gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal prote...	100	8e-18
34	emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue	100	8e-18
35	gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal prote...	100	8e-18
36	gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal prote...	100	8e-18
37	gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	100	8e-18
38	gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal prote...	100	8e-18
39	gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	100	8e-18
40	gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co...	100	8e-18
41	emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Co...	100	8e-18
42	emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Co...	100	8e-18
43	gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete s...	100	8e-18
44	gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin recep...	100	8e-18
45	emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40	92	2e-15
46	emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene	92	2e-15
47	gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10...	92	2e-15
48	gb|AF097522.1|AF097522 Brassica napus laminin receptor-like prot...	86	1e-13
49	gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA	82	2e-12
50	gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence	82	2e-12
51	gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence	82	2e-12
52	emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7	82	2e-12
53	gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ...	82	2e-12
54	gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA	82	2e-12
55	gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA	82	2e-12
56	ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, ...	82	2e-12
57	ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, ...	82	2e-12
58	gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end	82	2e-12
59	ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, ...	82	2e-12
60	gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o...	82	2e-12
61	gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k1...	82	2e-12
62	dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, parti...	82	2e-12
63	dbj|AB032438.1| Drosophila erecta sta gene for stubarista, parti...	80	7e-12
64	dbj|AB032439.1| Drosophila orena sta gene for stubarista, partia...	72	2e-09
65	dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complet...	66	1e-07
66	emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Co...	64	4e-07
67	gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associate...	62	2e-06
68	emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associa...	60	7e-06
69	gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein m...	54	4e-04
70	ref|XM_749197.1| Aspergillus fumigatus Af293 40S ribosomal prote...	54	4e-04
71	gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ...	54	4e-04
72	gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se...	54	4e-04
73	ref|XM_322650.1| Neurospora crassa OR74A hypothetical protein (N...	52	0.002
74	ref|XM_951747.1| Neurospora crassa OR74A hypothetical protein (N...	52	0.002
75	gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein...	52	0.002
76	ref|XM_391081.1| Gibberella zeae PH-1 chromosome 3 conserved hyp...	52	0.002
77	ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predi...	52	0.002
78	emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II B...	52	0.002
79	emb|CR938589.1| Single read from an extremity of a full-length c...	52	0.002
80	emb|CR938120.1| Single read from an extremity of a full-length c...	52	0.002
81	emb|CR938108.1| Single read from an extremity of a full-length c...	52	0.002
82	emb|CR937995.1| Single read from an extremity of a full-length c...	52	0.002
83	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	52	0.002
84	emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-...	50	0.006
85	emb|BX053371.1|CNS09DCF Single read from an extremity of a full-...	50	0.006
86	emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-...	50	0.006
87	emb|BX071531.1|CNS09RCV Single read from an extremity of a full-...	50	0.006
88	emb|BX071203.1|CNS09R3R Single read from an extremity of a full-...	50	0.006
89	emb|BX071128.1|CNS09R1O Single read from an extremity of a full-...	50	0.006
90	emb|BX071053.1|CNS09QZL Single read from an extremity of a full-...	50	0.006
91	emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-...	50	0.006
92	emb|BX070730.1|CNS09QQM Single read from an extremity of a full-...	50	0.006
93	emb|BX070261.1|CNS09QDL Single read from an extremity of a full-...	50	0.006
94	emb|BX070237.1|CNS09QCX Single read from an extremity of a full-...	50	0.006
95	emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-...	50	0.006
96	emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-...	50	0.006
97	emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-...	50	0.006
98	emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-...	50	0.006
99	emb|BX068381.1|CNS09OXD Single read from an extremity of a full-...	50	0.006
100	emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-...	50	0.006
101	emb|BX067522.1|CNS09O9I Single read from an extremity of a full-...	50	0.006
102	emb|BX067353.1|CNS09O4T Single read from an extremity of a full-...	50	0.006
103	emb|BX067352.1|CNS09O4S Single read from an extremity of a full-...	50	0.006
104	emb|BX067347.1|CNS09O4N Single read from an extremity of a full-...	50	0.006
105	emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-...	50	0.006
106	emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-...	50	0.006
107	emb|BX067213.1|CNS09O0X Single read from an extremity of a full-...	50	0.006
108	emb|BX066172.1|CNS09N80 Single read from an extremity of a full-...	50	0.006
109	emb|BX065840.1|CNS09MYS Single read from an extremity of a full-...	50	0.006
110	emb|BX065656.1|CNS09MTO Single read from an extremity of a full-...	50	0.006
111	emb|BX065484.1|CNS09MOW Single read from an extremity of a full-...	50	0.006
112	emb|BX065339.1|CNS09MKV Single read from an extremity of a full-...	50	0.006
113	emb|BX064723.1|CNS09M3R Single read from an extremity of a full-...	50	0.006
114	emb|BX064630.1|CNS09M16 Single read from an extremity of a full-...	50	0.006
115	emb|BX064621.1|CNS09M0X Single read from an extremity of a full-...	50	0.006
116	emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-...	50	0.006
117	emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-...	50	0.006
118	emb|BX063172.1|CNS09KWO Single read from an extremity of a full-...	50	0.006
119	emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-...	50	0.006
120	emb|BX062255.1|CNS09K77 Single read from an extremity of a full-...	50	0.006
121	emb|BX062254.1|CNS09K76 Single read from an extremity of a full-...	50	0.006
122	emb|BX062187.1|CNS09K5B Single read from an extremity of a full-...	50	0.006
123	emb|BX061828.1|CNS09JVC Single read from an extremity of a full-...	50	0.006
124	emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-...	50	0.006
125	emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-...	50	0.006
126	emb|BX061413.1|CNS09JJT Single read from an extremity of a full-...	50	0.006
127	emb|BX061395.1|CNS09JJB Single read from an extremity of a full-...	50	0.006
128	emb|BX060764.1|CNS09J1S Single read from an extremity of a full-...	50	0.006
129	emb|BX060566.1|CNS09IWA Single read from an extremity of a full-...	50	0.006
130	emb|BX060291.1|CNS09ION Single read from an extremity of a full-...	50	0.006
131	emb|BX060009.1|CNS09IGT Single read from an extremity of a full-...	50	0.006
132	emb|BX059650.1|CNS09I6U Single read from an extremity of a full-...	50	0.006
133	emb|BX059559.1|CNS09I4B Single read from an extremity of a full-...	50	0.006
134	emb|BX059479.1|CNS09I23 Single read from an extremity of a full-...	50	0.006
135	emb|BX059203.1|CNS09HUF Single read from an extremity of a full-...	50	0.006
136	emb|BX059202.1|CNS09HUE Single read from an extremity of a full-...	50	0.006
137	emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-...	50	0.006
138	emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-...	50	0.006
139	emb|BX058368.1|CNS09H78 Single read from an extremity of a full-...	50	0.006
140	emb|BX058299.1|CNS09H5B Single read from an extremity of a full-...	50	0.006
141	emb|BX058273.1|CNS09H4L Single read from an extremity of a full-...	50	0.006
142	emb|BX058144.1|CNS09H10 Single read from an extremity of a full-...	50	0.006
143	emb|BX058069.1|CNS09GYX Single read from an extremity of a full-...	50	0.006
144	emb|BX056716.1|CNS09FXC Single read from an extremity of a full-...	50	0.006
145	emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-...	50	0.006
146	emb|BX057691.1|CNS09GOF Single read from an extremity of a full-...	50	0.006
147	emb|BX057689.1|CNS09GOD Single read from an extremity of a full-...	50	0.006
148	emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-...	50	0.006
149	emb|BX057084.1|CNS09G7K Single read from an extremity of a full-...	50	0.006
150	emb|BX056920.1|CNS09G30 Single read from an extremity of a full-...	50	0.006
151	emb|BX056570.1|CNS09FTA Single read from an extremity of a full-...	50	0.006
152	emb|BX056337.1|CNS09FMT Single read from an extremity of a full-...	50	0.006
153	emb|BX056336.1|CNS09FMS Single read from an extremity of a full-...	50	0.006
154	emb|BX056269.1|CNS09FKX Single read from an extremity of a full-...	50	0.006
155	emb|BX056116.1|CNS09FGO Single read from an extremity of a full-...	50	0.006
156	emb|BX056090.1|CNS09FFY Single read from an extremity of a full-...	50	0.006
157	emb|BX055751.1|CNS09F6J Single read from an extremity of a full-...	50	0.006
158	emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-...	50	0.006
159	emb|BX054928.1|CNS09EJO Single read from an extremity of a full-...	50	0.006
160	emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-...	50	0.006
161	emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-...	50	0.006
162	emb|BX053590.1|CNS09DII Single read from an extremity of a full-...	50	0.006
163	emb|BX052800.1|CNS09CWK Single read from an extremity of a full-...	50	0.006
164	emb|BX052798.1|CNS09CWI Single read from an extremity of a full-...	50	0.006
165	emb|BX052551.1|CNS09CPN Single read from an extremity of a full-...	50	0.006
166	emb|BX052477.1|CNS09CNL Single read from an extremity of a full-...	50	0.006
167	emb|BX052476.1|CNS09CNK Single read from an extremity of a full-...	50	0.006
168	emb|BX051837.1|CNS09C5T Single read from an extremity of a full-...	50	0.006
169	emb|BX051209.1|CNS09BOD Single read from an extremity of a full-...	50	0.006
170	emb|BX049918.1|CNS09AOI Single read from an extremity of a full-...	50	0.006
171	emb|BX049879.1|CNS09ANF Single read from an extremity of a full-...	50	0.006
172	emb|BX049604.1|CNS09AFS Single read from an extremity of a full-...	50	0.006
173	emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-...	50	0.006
174	emb|BX049364.1|CNS09A94 Single read from an extremity of a full-...	50	0.006
175	emb|BX049219.1|CNS09A53 Single read from an extremity of a full-...	50	0.006
176	emb|BX049063.1|CNS09A0R Single read from an extremity of a full-...	50	0.006
177	emb|BX048945.1|CNS099XH Single read from an extremity of a full-...	50	0.006
178	emb|BX048268.1|CNS099EO Single read from an extremity of a full-...	50	0.006
179	emb|BX047396.1|CNS098QG Single read from an extremity of a full-...	50	0.006
180	emb|BX046740.1|CNS09888 Single read from an extremity of a full-...	50	0.006
181	emb|BX046217.1|CNS097TP Single read from an extremity of a full-...	50	0.006
182	emb|BX046120.1|CNS097R0 Single read from an extremity of a full-...	50	0.006
183	emb|BX045820.1|CNS097IO Single read from an extremity of a full-...	50	0.006
184	emb|BX045707.1|CNS097FJ Single read from an extremity of a full-...	50	0.006
185	emb|BX044948.1|CNS096UG Single read from an extremity of a full-...	50	0.006
186	emb|BX044495.1|CNS096HV Single read from an extremity of a full-...	50	0.006
187	emb|BX043740.1|CNS095WW Single read from an extremity of a full-...	50	0.006
188	emb|BX043445.1|CNS095OP Single read from an extremity of a full-...	50	0.006
189	emb|BX043330.1|CNS095LI Single read from an extremity of a full-...	50	0.006
190	emb|BX042876.1|CNS0958W Single read from an extremity of a full-...	50	0.006
191	emb|BX042850.1|CNS09586 Single read from an extremity of a full-...	50	0.006
192	emb|BX042652.1|CNS0952O Single read from an extremity of a full-...	50	0.006
193	emb|BX042358.1|CNS094UI Single read from an extremity of a full-...	50	0.006
194	emb|BX042337.1|CNS094TX Single read from an extremity of a full-...	50	0.006
195	emb|BX041420.1|CNS0944G Single read from an extremity of a full-...	50	0.006
196	emb|BX041297.1|CNS09411 Single read from an extremity of a full-...	50	0.006
197	emb|BX039405.1|CNS092KH Single read from an extremity of a full-...	50	0.006
198	emb|BX039319.1|CNS092I3 Single read from an extremity of a full-...	50	0.006
199	emb|BX037243.1|CNS090WF Single read from an extremity of a full-...	50	0.006
200	emb|BX036479.1|CNS090B7 Single read from an extremity of a full-...	50	0.006
201	emb|BX036426.1|CNS0909Q Single read from an extremity of a full-...	50	0.006
202	emb|BX036415.1|CNS0909F Single read from an extremity of a full-...	50	0.006
203	emb|BX036246.1|CNS0904Q Single read from an extremity of a full-...	50	0.006
204	emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-...	50	0.006
205	emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-...	50	0.006
206	emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-...	50	0.006
207	emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-...	50	0.006
208	emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-...	50	0.006
209	emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-...	50	0.006
210	emb|BX034628.1|CNS08YVS Single read from an extremity of a full-...	50	0.006
211	emb|BX034627.1|CNS08YVR Single read from an extremity of a full-...	50	0.006
212	emb|BX034339.1|CNS08YNR Single read from an extremity of a full-...	50	0.006
213	emb|BX034214.1|CNS08YKA Single read from an extremity of a full-...	50	0.006
214	emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-...	50	0.006
215	emb|BX033175.1|CNS08XRF Single read from an extremity of a full-...	50	0.006
216	emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-...	50	0.006
217	emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-...	50	0.006
218	emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-...	50	0.006
219	emb|BX032290.1|CNS08X2U Single read from an extremity of a full-...	50	0.006
220	emb|BX032289.1|CNS08X2T Single read from an extremity of a full-...	50	0.006
221	emb|BX032041.1|CNS08WVX Single read from an extremity of a full-...	50	0.006
222	emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-...	50	0.006
223	emb|BX031898.1|CNS08WRY Single read from an extremity of a full-...	50	0.006
224	emb|BX031717.1|CNS08WMX Single read from an extremity of a full-...	50	0.006
225	emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-...	50	0.006
226	emb|BX031483.1|CNS08WGF Single read from an extremity of a full-...	50	0.006
227	emb|BX031337.1|CNS08WCD Single read from an extremity of a full-...	50	0.006
228	emb|BX031303.1|CNS08WBF Single read from an extremity of a full-...	50	0.006
229	emb|BX030674.1|CNS08VTY Single read from an extremity of a full-...	50	0.006
230	emb|BX031154.1|CNS08W7A Single read from an extremity of a full-...	50	0.006
231	emb|BX031118.1|CNS08W6A Single read from an extremity of a full-...	50	0.006
232	emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-...	50	0.006
233	emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-...	50	0.006
234	emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-...	50	0.006
235	emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-...	50	0.006
236	emb|BX029939.1|CNS08V9J Single read from an extremity of a full-...	50	0.006
237	emb|BX029906.1|CNS08V8M Single read from an extremity of a full-...	50	0.006
238	emb|BX029898.1|CNS08V8E Single read from an extremity of a full-...	50	0.006
239	emb|BX029447.1|CNS08UVV Single read from an extremity of a full-...	50	0.006
240	emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-...	50	0.006
241	emb|BX028713.1|CNS08UBH Single read from an extremity of a full-...	50	0.006
242	emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-...	50	0.006
243	emb|BX028388.1|CNS08U2G Single read from an extremity of a full-...	50	0.006
244	emb|BX028172.1|CNS08TWG Single read from an extremity of a full-...	50	0.006
245	emb|BX027823.1|CNS08TMR Single read from an extremity of a full-...	50	0.006
246	emb|BX027638.1|CNS08THM Single read from an extremity of a full-...	50	0.006
247	emb|BX027470.1|CNS08TCY Single read from an extremity of a full-...	50	0.006
248	emb|BX026965.1|CNS08SYX Single read from an extremity of a full-...	50	0.006
249	emb|BX026808.1|CNS08SUK Single read from an extremity of a full-...	50	0.006
250	emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-...	50	0.006
251	emb|BX026536.1|CNS08SN0 Single read from an extremity of a full-...	50	0.006
252	emb|BX026482.1|CNS08SLI Single read from an extremity of a full-...	50	0.006
253	emb|BX026481.1|CNS08SLH Single read from an extremity of a full-...	50	0.006
254	emb|BX025854.1|CNS08S42 Single read from an extremity of a full-...	50	0.006
255	emb|BX025749.1|CNS08S15 Single read from an extremity of a full-...	50	0.006
256	emb|BX025670.1|CNS08RYY Single read from an extremity of a full-...	50	0.006
257	emb|BX025450.1|CNS08RSU Single read from an extremity of a full-...	50	0.006
258	emb|BX025107.1|CNS08RJB Single read from an extremity of a full-...	50	0.006
259	emb|BX025103.1|CNS08RJ7 Single read from an extremity of a full-...	50	0.006
260	emb|BX024846.1|CNS08RC2 Single read from an extremity of a full-...	50	0.006
261	emb|BX024832.1|CNS08RBO Single read from an extremity of a full-...	50	0.006
262	emb|BX024754.1|CNS08R9I Single read from an extremity of a full-...	50	0.006
263	emb|BX024652.1|CNS08R6O Single read from an extremity of a full-...	50	0.006
264	emb|BX024344.1|CNS08QY4 Single read from an extremity of a full-...	50	0.006
265	emb|BX024069.1|CNS08QQH Single read from an extremity of a full-...	50	0.006
266	emb|BX023999.1|CNS08QOJ Single read from an extremity of a full-...	50	0.006
267	emb|BX023956.1|CNS08QNC Single read from an extremity of a full-...	50	0.006
268	emb|BX023909.1|CNS08QM1 Single read from an extremity of a full-...	50	0.006
269	emb|BX023824.1|CNS08QJO Single read from an extremity of a full-...	50	0.006
270	emb|BX023742.1|CNS08QHE Single read from an extremity of a full-...	50	0.006
271	emb|BX023643.1|CNS08QEN Single read from an extremity of a full-...	50	0.006
272	emb|BX023296.1|CNS08Q50 Single read from an extremity of a full-...	50	0.006
273	emb|BX023108.1|CNS08PZS Single read from an extremity of a full-...	50	0.006
274	emb|BX022975.1|CNS08PW3 Single read from an extremity of a full-...	50	0.006
275	emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-...	50	0.006
276	emb|BX021908.1|CNS08P2G Single read from an extremity of a full-...	50	0.006
277	emb|BX021737.1|CNS08OXP Single read from an extremity of a full-...	50	0.006
278	emb|BX021571.1|CNS08OT3 Single read from an extremity of a full-...	50	0.006
279	emb|BX021462.1|CNS08OQ2 Single read from an extremity of a full-...	50	0.006
280	emb|BX021331.1|CNS08OMF Single read from an extremity of a full-...	50	0.006
281	emb|BX020818.1|CNS08O86 Single read from an extremity of a full-...	50	0.006
282	emb|BX020770.1|CNS08O6U Single read from an extremity of a full-...	50	0.006
283	emb|BX020718.1|CNS08O5E Single read from an extremity of a full-...	50	0.006
284	emb|BX020438.1|CNS08NXM Single read from an extremity of a full-...	50	0.006
285	emb|BX019922.1|CNS08NJA Single read from an extremity of a full-...	50	0.006
286	emb|BX019254.1|CNS08N0Q Single read from an extremity of a full-...	50	0.006
287	emb|BX019220.1|CNS08MZS Single read from an extremity of a full-...	50	0.006
288	emb|BX018801.1|CNS08MO5 Single read from an extremity of a full-...	50	0.006
289	emb|BX018535.1|CNS08MGR Single read from an extremity of a full-...	50	0.006
290	emb|BX017379.1|CNS08LKN Single read from an extremity of a full-...	50	0.006
291	emb|BX017311.1|CNS08LIR Single read from an extremity of a full-...	50	0.006
292	emb|BX017271.1|CNS08LHN Single read from an extremity of a full-...	50	0.006
293	emb|BX017270.1|CNS08LHM Single read from an extremity of a full-...	50	0.006
294	emb|BX016954.1|CNS08L8U Single read from an extremity of a full-...	50	0.006
295	emb|BX016896.1|CNS08L78 Single read from an extremity of a full-...	50	0.006
296	emb|BX016856.1|CNS08L64 Single read from an extremity of a full-...	50	0.006
297	emb|BX016665.1|CNS08L0T Single read from an extremity of a full-...	50	0.006
298	emb|BX015859.1|CNS08KEF Single read from an extremity of a full-...	50	0.006
299	emb|BX015858.1|CNS08KEE Single read from an extremity of a full-...	50	0.006
300	emb|BX015795.1|CNS08KCN Single read from an extremity of a full-...	50	0.006
301	emb|BX015743.1|CNS08KB7 Single read from an extremity of a full-...	50	0.006
302	emb|BX016230.1|CNS08KOQ Single read from an extremity of a full-...	50	0.006
303	emb|BX015945.1|CNS08KGT Single read from an extremity of a full-...	50	0.006
304	emb|BX015925.1|CNS08KG9 Single read from an extremity of a full-...	50	0.006
305	emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-...	50	0.006
306	emb|BX015611.1|CNS08K7J Single read from an extremity of a full-...	50	0.006
307	emb|BX014926.1|CNS08JOI Single read from an extremity of a full-...	50	0.006
308	emb|BX014301.1|CNS08J75 Single read from an extremity of a full-...	50	0.006
309	emb|BX013989.1|CNS08IYH Single read from an extremity of a full-...	50	0.006
310	emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-...	50	0.006
311	emb|BX013507.1|CNS08IL3 Single read from an extremity of a full-...	50	0.006
312	emb|BX013495.1|CNS08IKR Single read from an extremity of a full-...	50	0.006
313	emb|BX013299.1|CNS08IFB Single read from an extremity of a full-...	50	0.006
314	emb|BX013295.1|CNS08IF7 Single read from an extremity of a full-...	50	0.006
315	emb|BX013103.1|CNS08I9V Single read from an extremity of a full-...	50	0.006
316	emb|BX012511.1|CNS08HTF Single read from an extremity of a full-...	50	0.006
317	emb|BX012242.1|CNS08HLY Single read from an extremity of a full-...	50	0.006
318	emb|BX012147.1|CNS08HJB Single read from an extremity of a full-...	50	0.006
319	emb|BX012005.1|CNS08HFD Single read from an extremity of a full-...	50	0.006
320	emb|BX011777.1|CNS08H91 Single read from an extremity of a full-...	50	0.006
321	emb|BX011776.1|CNS08H90 Single read from an extremity of a full-...	50	0.006
322	emb|BX011772.1|CNS08H8W Single read from an extremity of a full-...	50	0.006
323	emb|BX011603.1|CNS08H47 Single read from an extremity of a full-...	50	0.006
324	emb|BX011581.1|CNS08H3L Single read from an extremity of a full-...	50	0.006
325	emb|BX011489.1|CNS08H11 Single read from an extremity of a full-...	50	0.006
326	emb|BX011488.1|CNS08H10 Single read from an extremity of a full-...	50	0.006
327	emb|BX011178.1|CNS08GSE Single read from an extremity of a full-...	50	0.006
328	emb|BX010356.1|CNS08G5K Single read from an extremity of a full-...	50	0.006
329	emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-...	50	0.006
330	emb|BX010071.1|CNS08FXN Single read from an extremity of a full-...	50	0.006
331	emb|BX009592.1|CNS08FKC Single read from an extremity of a full-...	50	0.006
332	emb|BX008659.1|CNS08EUF Single read from an extremity of a full-...	50	0.006
333	emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-...	50	0.006
334	emb|BX008395.1|CNS08EN3 Single read from an extremity of a full-...	50	0.006
335	emb|BX008250.1|CNS08EJ2 Single read from an extremity of a full-...	50	0.006
336	emb|BX007865.1|CNS08E8D Single read from an extremity of a full-...	50	0.006
337	emb|BX007549.1|CNS08DZL Single read from an extremity of a full-...	50	0.006
338	emb|BX007204.1|CNS08DQ0 Single read from an extremity of a full-...	50	0.006
339	emb|BX007203.1|CNS08DPZ Single read from an extremity of a full-...	50	0.006
340	emb|BX007147.1|CNS08DOF Single read from an extremity of a full-...	50	0.006
341	emb|BX006304.1|CNS08D10 Single read from an extremity of a full-...	50	0.006
342	emb|BX005921.1|CNS08CQD Single read from an extremity of a full-...	50	0.006
343	emb|BX005588.1|CNS08CH4 Single read from an extremity of a full-...	50	0.006
344	emb|CR938650.1| Single read from an extremity of a full-length c...	50	0.006
345	ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 ...	50	0.006
346	emb|BX041242.1|CNS093ZI Single read from an extremity of a full-...	48	0.026
347	emb|BX023957.1|CNS08QND Single read from an extremity of a full-...	48	0.026
348	emb|BX015037.1|CNS08JRL Single read from an extremity of a full-...	48	0.026
349	emb|BX024000.1|CNS08QOK Single read from an extremity of a full-...	46	0.10
350	emb|BX006256.1|CNS08CZO Single read from an extremity of a full-...	46	0.10
351	gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.40
352	ref|XM_572918.1| Cryptococcus neoformans var. neoformans JEC21 4...	44	0.40
353	ref|XM_792701.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.40
354	emb|BX069252.1|CNS09PLK Single read from an extremity of a full-...	44	0.40
355	emb|BX048785.1|CNS099T1 Single read from an extremity of a full-...	44	0.40
356	emb|BX014555.1|CNS08JE7 Single read from an extremity of a full-...	44	0.40
357	emb|CR938492.1| Single read from an extremity of a full-length c...	44	0.40
358	gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome	44	0.40
359	dbj|AK108362.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.40
360	gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence	44	0.40
361	gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome	42	1.6
362	ref|NM_193932.1| Oryza sativa (japonica cultivar-group), predic...	42	1.6
363	gb|AF101045.1| Oryza sativa (japonica cultivar-group) putative A...	42	1.6
364	gb|U70541.1|OSU70541 Oryza sativa (indica cultivar-group) putati...	42	1.6
365	emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-...	42	1.6
366	emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-...	42	1.6
367	emb|BX059338.1|CNS09HY6 Single read from an extremity of a full-...	42	1.6
368	emb|BX056727.1|CNS09FXN Single read from an extremity of a full-...	42	1.6
369	emb|BX030897.1|CNS08W05 Single read from an extremity of a full-...	42	1.6
370	emb|BX047263.1|CNS098MR Single read from an extremity of a full-...	42	1.6
371	emb|BX045530.1|CNS097AM Single read from an extremity of a full-...	42	1.6
372	emb|BX035678.1|CNS08ZOY Single read from an extremity of a full-...	42	1.6
373	emb|BX035677.1|CNS08ZOX Single read from an extremity of a full-...	42	1.6
374	emb|BX033928.1|CNS08YCC Single read from an extremity of a full-...	42	1.6
375	emb|BX032604.1|CNS08XBK Single read from an extremity of a full-...	42	1.6
376	emb|BX027127.1|CNS08T3F Single read from an extremity of a full-...	42	1.6
377	emb|BX027126.1|CNS08T3E Single read from an extremity of a full-...	42	1.6
378	emb|BX026703.1|CNS08SRN Single read from an extremity of a full-...	42	1.6
379	emb|BX024221.1|CNS08QUP Single read from an extremity of a full-...	42	1.6
380	emb|BX023584.1|CNS08QD0 Single read from an extremity of a full-...	42	1.6
381	emb|BX019733.1|CNS08NE1 Single read from an extremity of a full-...	42	1.6
382	emb|BX021163.1|CNS08OHR Single read from an extremity of a full-...	42	1.6
383	emb|BX020765.1|CNS08O6P Single read from an extremity of a full-...	42	1.6
384	emb|BX020707.1|CNS08O53 Single read from an extremity of a full-...	42	1.6
385	emb|BX018984.1|CNS08MT8 Single read from an extremity of a full-...	42	1.6
386	emb|BX012873.1|CNS08I3H Single read from an extremity of a full-...	42	1.6
387	emb|BX012174.1|CNS08HK2 Single read from an extremity of a full-...	42	1.6
388	emb|BX011604.1|CNS08H48 Single read from an extremity of a full-...	42	1.6
389	emb|BX011136.1|CNS08GR8 Single read from an extremity of a full-...	42	1.6
390	emb|BX007568.1|CNS08E04 Single read from an extremity of a full-...	42	1.6
391	emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,...	42	1.6
392	dbj|AB225911.1| Aspergillus oryzae cDNA, contig sequence: AoEST2766	42	1.6
393	dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012	42	1.6
394	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
395	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
396	gb|AE004832.1| Pseudomonas aeruginosa PAO1, section 393 of 529 o...	42	1.6
397	dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
398	dbj|AP004317.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
399	emb|Y07956.1|OSDIHYFLA O.sativa mRNA for dihydroflavonol reductase	42	1.6
400	dbj|AB003495.1| Oryza sativa (japonica cultivar-group) DNA for d...	42	1.6
401	gb|L48340.1|MTBKATA Methylobacterium extorquens catalase (katA) ...	42	1.6
402	dbj|AB003496.1| Oryza sativa (japonica cultivar-group) mRNA for ...	42	1.6
403	ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constitu...	40	6.3
404	ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constitu...	40	6.3
405	gb|CP000148.1| Geobacter metallireducens GS-15, complete genome	40	6.3
406	ref|XM_520453.1| PREDICTED: Pan troglodytes similar to GLSR2492 ...	40	6.3
407	ref|XM_468611.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.3
408	gb|AY190671.1| Pagrus major 40S ribosomal protein Sa mRNA, parti...	40	6.3
409	gb|AY351649.1| Acanthamoeba healyi laminin-binding protein mRNA,...	40	6.3
410	ref|XM_953899.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.3
411	ref|XM_331436.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.3
412	gb|BC060578.1| Rattus norvegicus ribosomal protein SA, mRNA (cDN...	40	6.3
413	gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, compl...	40	6.3
414	ref|NM_017138.1| Rattus norvegicus ribosomal protein SA (Rpsa), ...	40	6.3
415	gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal prote...	40	6.3
416	emb|BX029512.1|CNS08UXO Single read from an extremity of a full-...	40	6.3
417	emb|BX022896.1|CNS08PTW Single read from an extremity of a full-...	40	6.3
418	gb|CP000089.1| Dechloromonas aromatica RCB, complete genome	40	6.3
419	gb|BC061298.1| Xenopus tropicalis ribosomal protein SA, mRNA (cD...	40	6.3
420	gb|CP000282.1| Saccharophagus degradans 2-40, complete genome	40	6.3
421	ref|NM_203737.1| Xenopus tropicalis ribosomal protein SA (MGC757...	40	6.3
422	gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, com...	40	6.3
423	ref|XM_682448.1| PREDICTED: Danio rerio similar to urotensin 2 r...	40	6.3
424	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	40	6.3
425	gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genom...	40	6.3
426	gb|AY550956.1| Sparus aurata 40S ribosomal protein Sa-like prote...	40	6.3
427	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	40	6.3
428	gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete s...	40	6.3
429	emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ...	40	6.3
430	emb|CR942700.2| Xenopus tropicalis finished cDNA, clone TNeu119p20	40	6.3
431	gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mR...	40	6.3
432	gb|U02370.1|UCU02370 Urechis caupo 34/67 kD laminin binding prot...	40	6.3
433	dbj|D25224.1|RAT40RP Rat mRNA for 40kDa ribosomal protein, compl...	40	6.3

---

>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence
          Length = 1267

 Score =  428 bits (216), Expect = e-117
 Identities = 285/308 (92%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||
Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| ||||||||||||||||| ||||  ||||||||| |||||||||||
Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||||||||||| ||||||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctatggccagcgtgct 378

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           |||||||||||||| ||| |||| |||||  | |||||||| ||||||||||||||||||
Sbjct: 379 gtcctcaagttcgctcagtacactggcgctcatgccatcgctgggaggcacacccctggt 438

                   
Query: 439 accttcac 446
           ||||||||
Sbjct: 439 accttcac 446

---

>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence
          Length = 1275

 Score =  416 bits (210), Expect = e-113
 Identities = 285/310 (91%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 358 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 417

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           |||||||||||||||||| |||| |||||| | |||||||| ||||||||||||||||||
Sbjct: 418 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 477

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 478 accttcacca 487

---

>gb|AY103617.1| Zea mays PCO143386 mRNA sequence
          Length = 1516

 Score =  416 bits (210), Expect = e-113
 Identities = 285/310 (91%)
 Strand = Plus / Plus

                                                                       
Query: 139 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 198
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 397 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 456

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           |||||||||||||||||| |||| |||||| | |||||||| ||||||||||||||||||
Sbjct: 457 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 516

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 517 accttcacca 526

---

>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full
           insert sequence
          Length = 1310

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 345
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 346 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 405
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                              
Query: 406 gccaacgccatcgccgggaggcacacccctggtac 440
           ||  ||||||| || || ||||| || ||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtac 416

---

>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full
           insert sequence
          Length = 1276

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 345
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 346 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 405
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                              
Query: 406 gccaacgccatcgccgggaggcacacccctggtac 440
           ||  ||||||| || || ||||| || ||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtac 416

---

>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full
           insert sequence
          Length = 1223

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 345
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 346 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 405
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                              
Query: 406 gccaacgccatcgccgggaggcacacccctggtac 440
           ||  ||||||| || || ||||| || ||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtac 416

---

>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full
           insert sequence
          Length = 1320

 Score =  402 bits (203), Expect = e-109
 Identities = 302/335 (90%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 92  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 151

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 152 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 211

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 212 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 271

                                                                       
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 345
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 272 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 331

                                                                       
Query: 346 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 405
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 332 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 391

                                              
Query: 406 gccaacgccatcgccgggaggcacacccctggtac 440
           ||  ||||||| || || ||||| || ||||||||
Sbjct: 392 gcgcacgccattgctggaaggcatacgcctggtac 426

---

>ref|XM_470555.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 918

 Score =  396 bits (200), Expect = e-107
 Identities = 299/332 (90%)
 Strand = Plus / Plus

                                                                       
Query: 109 atggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgtacag 168
           |||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| |||
Sbjct: 1   atggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtgcag 60

                                                                       
Query: 169 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 228
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 120

                                                                       
Query: 229 tacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgggag 288
           |||| |||||||||||||||||| || ||||||||||||||||| |||||||||||||||
Sbjct: 121 tacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgggag 180

                                                                       
Query: 289 aagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatcgtc 348
           ||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| |||
Sbjct: 181 aagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgtc 240

                                                                       
Query: 349 cagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggcgcc 408
           ||||| |||||||||||||||||||| ||||||||||||||||||||| |||| ||||| 
Sbjct: 241 cagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggcgcg 300

                                           
Query: 409 aacgccatcgccgggaggcacacccctggtac 440
            ||||||| || || ||||| || ||||||||
Sbjct: 301 cacgccattgctggaaggcatacgcctggtac 332

---

>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence
          Length = 1418

 Score =  383 bits (193), Expect = e-103
 Identities = 277/305 (90%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacc 201
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 133 ctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggcacc 192

                                                                       
Query: 202 aagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctac 261
           ||||||||||| ||||||| ||||||||| | ||  |||||||| |||||||||||||||
Sbjct: 193 aagaactgcgatttccagacggagcgctatgtctttaagcgccgttccgacggcatctac 252

                                                                       
Query: 262 atcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcc 321
           |||||||| || |||||||||||||| || |||||||| || |||||||| ||||| |||
Sbjct: 253 atcatcaatcttggcaagacatgggataaactccagcttgcagcgagggttatcgttgcc 312

                                                                       
Query: 322 atcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtc 381
           |||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||
Sbjct: 313 atcgagaacccgcaggacatcatcgtccagtctgcccgcccatatggccagcgtgctgtc 372

                                                                       
Query: 382 ctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacc 441
           ||||||||||| ||| |||| |||||| | |||||||| |||||||||||||||||||| 
Sbjct: 373 ctcaagttcgctcagtacactggcgcccatgccatcgctgggaggcacacccctggtaca 432

                
Query: 442 ttcac 446
           |||||
Sbjct: 433 ttcac 437

---

>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full
           insert sequence
          Length = 1182

 Score =  325 bits (164), Expect = 7e-86
 Identities = 233/256 (91%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 83  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 142

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 202

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 203 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 262

                                                                       
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 345
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 263 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 322

                           
Query: 346 gtccagtccgcccgcc 361
           |||||||| |||||||
Sbjct: 323 gtccagtcggcccgcc 338

---

>ref|XM_479167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1280

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 299

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 300 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 359

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 360 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 419

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 420 ggtacatttaccaaccagctgcagacct 447

---

>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1298

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 301

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 302 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 361

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 362 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 421

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 422 ggtacatttaccaaccagctgcagacct 449

---

>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1310

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 302

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 303 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 362

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 363 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 422

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 423 ggtacatttaccaaccagctgcagacct 450

---

>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1343

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 125 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 184

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 185 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 244

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 245 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 304

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 305 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 364

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 365 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 424

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 425 ggtacatttaccaaccagctgcagacct 452

---

>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full
           insert sequence
          Length = 1298

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 301

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 302 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 361

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 362 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 421

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 422 ggtacatttaccaaccagctgcagacct 449

---

>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full
           insert sequence
          Length = 1280

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 299

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 300 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 359

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 360 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 419

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 420 ggtacatttaccaaccagctgcagacct 447

---

>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full
           insert sequence
          Length = 1342

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 124 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 183

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 243

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 244 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 303

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 304 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 363

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 364 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 423

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 424 ggtacatttaccaaccagctgcagacct 451

---

>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full
           insert sequence
          Length = 1310

 Score =  270 bits (136), Expect = 4e-69
 Identities = 281/328 (85%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 136 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 196 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 255
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                       
Query: 256 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 302

                                                                       
Query: 316 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 303 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 362

                                                                       
Query: 376 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 363 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 422

                                       
Query: 436 ggtaccttcacc-accaggtgcagacct 462
           ||||| || ||| ||||| |||||||||
Sbjct: 423 ggtacatttaccaaccagctgcagacct 450

---

>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full
           insert sequence
          Length = 1264

 Score =  252 bits (127), Expect = 9e-64
 Identities = 265/311 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 115 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 174

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 175 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 234

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 235 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 294

                                                                       
Query: 310 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 369
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 295 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 354

                                                                       
Query: 370 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 429
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 355 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 414

                      
Query: 430 acccctggtac 440
           || ||||||||
Sbjct: 415 actcctggtac 425

---

>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full
           insert sequence
          Length = 1176

 Score =  252 bits (127), Expect = 9e-64
 Identities = 265/311 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 118 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 177

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 178 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 237

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 238 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 297

                                                                       
Query: 310 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 369
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 298 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 357

                                                                       
Query: 370 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 429
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 358 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 417

                      
Query: 430 acccctggtac 440
           || ||||||||
Sbjct: 418 actcctggtac 428

---

>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full
           insert sequence
          Length = 1245

 Score =  252 bits (127), Expect = 9e-64
 Identities = 265/311 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 189
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 121 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 180

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 181 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 240

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 241 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 300

                                                                       
Query: 310 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 369
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 301 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 360

                                                                       
Query: 370 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 429
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 361 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 420

                      
Query: 430 acccctggtac 440
           || ||||||||
Sbjct: 421 actcctggtac 431

---

>gb|AY105034.1| Zea mays PCO130341 mRNA sequence
          Length = 1213

 Score =  234 bits (118), Expect = 2e-58
 Identities = 259/306 (84%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 202
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 76  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135

                                                                       
Query: 203 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 262
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || |||||||
Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195

                                                                       
Query: 263 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 322
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255

                                                                       
Query: 323 tcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtcc 382
           | ||||| ||||||||||| ||||| ||||| ||  | ||||| |||||| | || ||||
Sbjct: 256 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 315

                                                                       
Query: 383 tcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacct 442
           ||||||| |||||| |||| || ||| | ||||| || || |||||||| |||||||| |
Sbjct: 316 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 375

                 
Query: 443 tcacca 448
           ||||||
Sbjct: 376 tcacca 381

---

>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence
          Length = 1208

 Score =  226 bits (114), Expect = 5e-56
 Identities = 258/306 (84%)
 Strand = Plus / Plus

                                                                       
Query: 143 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 202
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 73  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132

                                                                       
Query: 203 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 262
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || ||||| |
Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192

                                                                       
Query: 263 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 322
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252

                                                                       
Query: 323 tcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtcc 382
           | ||||| ||||||||||| ||||| ||||| ||  | ||||| |||||| | || ||||
Sbjct: 253 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 312

                                                                       
Query: 383 tcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacct 442
           ||||||| |||||| |||| || ||| | ||||| || || |||||||| |||||||| |
Sbjct: 313 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 372

                 
Query: 443 tcacca 448
           ||||||
Sbjct: 373 tcacca 378

---

>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full
           insert sequence
          Length = 1144

 Score =  224 bits (113), Expect = 2e-55
 Identities = 155/169 (91%)
 Strand = Plus / Plus

                                                                       
Query: 228 ctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatggga 287
           ||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225

                                                                       
Query: 288 gaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatcgt 347
           |||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| ||
Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgt 285

                                                            
Query: 348 ccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcag 396
           |||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 286 ccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcag 334



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 106 accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 89  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 148

                                   
Query: 166 cagatgatgctcgccgccgacgtc 189
           |||||||||||||||||| |||||
Sbjct: 149 cagatgatgctcgccgcctacgtc 172

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  208 bits (105), Expect = 1e-50
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                           
Query: 256     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4319936 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319877

                                                                           
Query: 316     gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
               || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 4319876 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 4319817

                                                                           
Query: 376     gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
               ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 4319816 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 4319757

                    
Query: 436     ggtac 440
               |||||
Sbjct: 4319756 ggtac 4319752



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 106     accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320485 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320426

                                                                           
Query: 166     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320425 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320366

                                         
Query: 226     cgctacgcctacaagcgccgctccga 251
               ||||||| ||||||||||||||||||
Sbjct: 4320365 cgctacgtctacaagcgccgctccga 4320340



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 173      tgctcgccgccgacgtccacctcg 196
                ||||||||||||||||| ||||||
Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027

---

>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score =  208 bits (105), Expect = 1e-50
 Identities = 165/185 (89%)
 Strand = Plus / Plus

                                                                          
Query: 256    atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
              ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 106561 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 106620

                                                                          
Query: 316    gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
              || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 106621 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 106680

                                                                          
Query: 376    gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
              ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 106681 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 106740

                   
Query: 436    ggtac 440
              |||||
Sbjct: 106741 ggtac 106745



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Plus

                                                                          
Query: 106    accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
              ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 106012 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 106071

                                                                          
Query: 166    cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106072 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 106131

                                        
Query: 226    cgctacgcctacaagcgccgctccga 251
              ||||||| ||||||||||||||||||
Sbjct: 106132 cgctacgtctacaagcgccgctccga 106157

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  208 bits (105), Expect = 1e-50
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                           
Query: 256     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4320051 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319992

                                                                           
Query: 316     gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
               || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 4319991 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 4319932

                                                                           
Query: 376     gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
               ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 4319931 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 4319872

                    
Query: 436     ggtac 440
               |||||
Sbjct: 4319871 ggtac 4319867



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 106     accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 165
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320600 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320541

                                                                           
Query: 166     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320540 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320481

                                         
Query: 226     cgctacgcctacaagcgccgctccga 251
               ||||||| ||||||||||||||||||
Sbjct: 4320480 cgctacgtctacaagcgccgctccga 4320455



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 173      tgctcgccgccgacgtccacctcg 196
                ||||||||||||||||| ||||||
Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  172 bits (87), Expect = 7e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                            
Query: 136      cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
                |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 25361982 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 25361923

                                                                   
Query: 196      ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
                ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 25361922 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 25361872



 Score =  103 bits (52), Expect = 5e-19
 Identities = 170/208 (81%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                            
Query: 256      atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
                |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 25361294 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 25361235

                                                                            
Query: 316      gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
                || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 25361234 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 25361175

                                                                            
Query: 376      gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
                || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 25361174 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 25361115

                                            
Query: 436      ggtaccttcacc-accaggtgcagacct 462
                ||||| || ||| ||||| |||||||||
Sbjct: 25361114 ggtacatttaccaaccagctgcagacct 25361087

---

>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1056G08
          Length = 168173

 Score =  172 bits (87), Expect = 7e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                         
Query: 136   cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 195
             |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 55072 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 55013

                                                                
Query: 196   ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
             ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 55012 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 54962



 Score =  103 bits (52), Expect = 5e-19
 Identities = 170/208 (81%), Gaps = 1/208 (0%)
 Strand = Plus / Minus

                                                                         
Query: 256   atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 315
             |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 54384 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 54325

                                                                         
Query: 316   gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 375
             || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 54324 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 54265

                                                                         
Query: 376   gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 435
             || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 54264 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 54205

                                         
Query: 436   ggtaccttcacc-accaggtgcagacct 462
             ||||| || ||| ||||| |||||||||
Sbjct: 54204 ggtacatttaccaaccagctgcagacct 54177

---

>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds
          Length = 1141

 Score =  133 bits (67), Expect = 6e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 124 cagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaaatggaa 183

                                                                       
Query: 226 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 285
           || |||  || ||||||||||  |||||| || ||||| || ||||| || ||||| |||
Sbjct: 184 cgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaagacgtgg 243

                                                                      
Query: 286 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcat 344
           |||||||| ||||| || || ||||| || || || || |||||||| ||||| |||||
Sbjct: 244 gagaagcttcagctagcagctagggttatagttgcaattgagaacccccaggatatcat 302



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 424 aggcacacccctggtaccttcacca 448
           |||||||| ||||||||||||||||
Sbjct: 382 aggcacactcctggtaccttcacca 406

---

>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.2 mRNA,
           complete cds
          Length = 1173

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 416 accttcacca 425

---

>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.1 mRNA,
           complete cds
          Length = 1185

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 416 accttcacca 425

---

>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1032

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 331 accttcacca 340

---

>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue
          Length = 1073

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 96  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 216 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 275

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 276 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 335

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 336 accttcacca 345

---

>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1103

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 273 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 332

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 333 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 392

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 393 accttcacca 402

---

>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1042

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 331 accttcacca 340

---

>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 897

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 331 accttcacca 340

---

>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370; T10D10.16) mRNA,
           complete cds
          Length = 1151

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 413 accttcacca 422

---

>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1182

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 416 accttcacca 425

---

>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1168

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 276 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 335

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 336 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 395

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 396 accttcacca 405

---

>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1096

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 280 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 339

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 340 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 399

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 400 accttcacca 409

---

>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1126

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 266 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 325

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 326 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 385

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 386 accttcacca 395

---

>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence
          Length = 1177

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 413 accttcacca 422

---

>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA,
           complete cds
          Length = 1137

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 200/250 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 258
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 265 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 324

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 325 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 384

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 385 accttcacca 394

---

>emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40
          Length = 3690

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 154/190 (81%)
 Strand = Plus / Plus

                                                                        
Query: 259  tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
            |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 2285 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 2344

                                                                        
Query: 319  gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
            ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 2345 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 2404

                                                                        
Query: 379  gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
            ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 2405 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 2464

                      
Query: 439  accttcacca 448
            ||||||||||
Sbjct: 2465 accttcacca 2474

---

>emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene
          Length = 2049

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 154/190 (81%)
 Strand = Plus / Plus

                                                                       
Query: 259 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 774 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 833

                                                                       
Query: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 834 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 893

                                                                       
Query: 379 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 894 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 953

                     
Query: 439 accttcacca 448
           ||||||||||
Sbjct: 954 accttcacca 963

---

>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete
             sequence
          Length = 87039

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 154/190 (81%)
 Strand = Plus / Plus

                                                                         
Query: 259   tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 318
             |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 69076 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 69135

                                                                         
Query: 319   gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 378
             ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 69136 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 69195

                                                                         
Query: 379   gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 438
             ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 69196 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 69255

                       
Query: 439   accttcacca 448
             ||||||||||
Sbjct: 69256 accttcacca 69265

---

>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete
           cds
          Length = 1138

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 205/259 (79%)
 Strand = Plus / Plus

                                                                       
Query: 190 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 249
           |||||||| |||||||||||| ||| ||| |||||||| |||| || |||| | |||  |
Sbjct: 118 cacctcggaaccaagaactgcaactaccaaatggagcgttacgtcttcaagagacgcaac 177

                                                                       
Query: 250 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 309
           ||||| || |||||| | ||||| || |||||||||||||||||   | | |||||  | 
Sbjct: 178 gacggtatttacatctttaaccttggaaagacatgggagaagctgatgatggctgcacga 237

                                                                       
Query: 310 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 369
           |||||||| || ||||||||||| || |||||||| || ||||| ||  | ||||| || 
Sbjct: 238 gtcatcgttgctatcgagaacccacaagacatcattgtgcagtcagctaggccctatggt 297

                                                                       
Query: 370 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 429
           ||| | || ||  | |||||||| ||| |||| || || || ||||| || || ||||||
Sbjct: 298 cagagagctgttttgaagttcgctcagtacactggagctaatgccattgctggaaggcac 357

                              
Query: 430 acccctggtaccttcacca 448
           || |||||||| |||||||
Sbjct: 358 actcctggtactttcacca 376

---

>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA
          Length = 2515

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                        
Query: 212  acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
            |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 1681 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 1740

                                                                        
Query: 272  tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
            |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 1741 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 1800

             
Query: 332  c 332
            |
Sbjct: 1801 c 1801

---

>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence
          Length = 627

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 193

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 194 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 253

            
Query: 332 c 332
           |
Sbjct: 254 c 254

---

>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence
          Length = 579

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 59  acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 118

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 119 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 178

            
Query: 332 c 332
           |
Sbjct: 179 c 179

---

>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7
          Length = 45861

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 212   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 16965 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 16906

                                                                         
Query: 272   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 16905 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 16846

              
Query: 332   c 332
             |
Sbjct: 16845 c 16845

---

>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                          
Query: 212    acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
              |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 159536 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 159477

                                                                          
Query: 272    tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
              |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 159476 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 159417

               
Query: 332    c 332
              |
Sbjct: 159416 c 159416

---

>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA
          Length = 1104

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 332 c 332
           |
Sbjct: 392 c 392

---

>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA
          Length = 964

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 761 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 702

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 701 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 642

            
Query: 332 c 332
           |
Sbjct: 641 c 641

---

>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D
           (sta), mRNA
          Length = 1041

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 221 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 280

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 281 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 340

            
Query: 332 c 332
           |
Sbjct: 341 c 341

---

>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B
           (sta), mRNA
          Length = 1089

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 332 c 332
           |
Sbjct: 392 c 392

---

>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end
          Length = 1272

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 174 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 233

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 234 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 293

            
Query: 332 c 332
           |
Sbjct: 294 c 294

---

>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A
           (sta), mRNA
          Length = 1236

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 419 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 478

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 479 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 538

            
Query: 332 c 332
           |
Sbjct: 539 c 539

---

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 212   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 22120 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 22061

                                                                         
Query: 272   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 22060 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 22001

              
Query: 332   c 332
             |
Sbjct: 22000 c 22000

---

>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 150

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 151 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 210

            
Query: 332 c 332
           |
Sbjct: 211 c 211

---

>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds
          Length = 1545

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 721 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 780

                                                                       
Query: 272 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 331
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 781 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 840

            
Query: 332 c 332
           |
Sbjct: 841 c 841

---

>dbj|AB032438.1| Drosophila erecta sta gene for stubarista, partial cds
          Length = 1532

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 705 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 764

                                       
Query: 272 tgggcaagacatgggagaagctccagct 299
           |||||||||| ||||| ||||| |||||
Sbjct: 765 tgggcaagacctgggaaaagctgcagct 792

---

>dbj|AB032439.1| Drosophila orena sta gene for stubarista, partial cds
          Length = 1371

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||| |||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 554 acttccaaatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 613

                                       
Query: 272 tgggcaagacatgggagaagctccagct 299
           | |||||||| ||||||||||| |||||
Sbjct: 614 taggcaagacctgggagaagctgcagct 641

---

>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds
          Length = 1111

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 193 ctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgac 252
           ||||||||||| ||||| || |||||||||||||| || | || |||||||||   ||| 
Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212

                                                    
Query: 253 ggcatctacatcatcaacctgggcaagacatgggagaagct 293
           || || || ||||||||  |||| |||||||||||||||||
Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagct 253

---

>emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH91ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1125

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 acctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgaga 328
           |||| ||||||| |||||| ||||||||| | ||||| || || || || ||||| ||||
Sbjct: 232 accttggcaagagatgggaaaagctccagatggctgctagagttattgttgccattgaga 291

                                   
Query: 329 acccgcaggacatcatcgtccagt 352
           |||| ||| |||||||||||||||
Sbjct: 292 acccacagaacatcatcgtccagt 315

---

>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like
           mRNA, complete cds
          Length = 1106

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 187 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173

                                                          
Query: 247 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 293
             |||||| |||||||| || |||   || ||||||||||| |||||
Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagct 220

---

>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40
          Length = 1169

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 225
           ||||||||| | || ||||| || |||||||| |||||||||||  ||||||||||||||
Sbjct: 120 cagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccagatggag 179

             
Query: 226 cg 227
           ||
Sbjct: 180 cg 181

---

>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds
          Length = 1061

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 187 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 246
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162

                                                          
Query: 247 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 293
             |||||| ||||| || || |||   || ||||||||||| |||||
Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagct 209

---

>ref|XM_749197.1| Aspergillus fumigatus Af293 40S ribosomal protein S0 (Afu3g13320)
           partial mRNA
          Length = 894

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggcgccaac 411
           ||||| || ||||||||||||||||| ||||| ||||||||    |||||||| |||| |
Sbjct: 238 tccgctcgtccctacggccagcgtgctgtcctgaagttcgcttctcacaccggtgccacc 297

                      
Query: 412 gccatcgccgg 422
           ||||| |||||
Sbjct: 298 gccattgccgg 308

---

>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 166   cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 224
             ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 42985 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 42927



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 283   tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacat 341
             |||||||| || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 42208 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaacccccaggacat 42150

---

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166  cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 224
            ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 8505 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 8447



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 283  tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacat 341
            |||||||| || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 7728 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaacccccaggacat 7670

---

>ref|XM_322650.1| Neurospora crassa OR74A hypothetical protein (NCU03393.1) partial
           mRNA
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 355 gcccgcccctacggccagcgtgccgtcctcaagttcgc 392
           ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 278

---

>ref|XM_951747.1| Neurospora crassa OR74A hypothetical protein (NCU03393.1) partial
           mRNA
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 355 gcccgcccctacggccagcgtgccgtcctcaagttcgc 392
           ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 278

---

>gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein SA mRNA, complete
           cds
          Length = 867

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 92  acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 151

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 152 tgggccgcacctgggaaaagctgctgctcgctgc 185

---

>ref|XM_391081.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG10905.1) partial mRNA
          Length = 885

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 355 gcccgcccctacggccagcgtgccgtcctcaagttcgc 392
           ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgctgtcctcaagttcgc 278

---

>ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predicted mRNA
          Length = 726

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 260 acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 305
           ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 47  acatcatcaacgttggcaagacctgggagaagatccagctggctgc 92



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 352 tccgcccgcccctacggccagcgtgccgtcctcaagttcgc 392
           ||||||||  ||||||| ||||| ||||| |||||||||||
Sbjct: 139 tccgcccgaacctacggacagcgagccgttctcaagttcgc 179

---

>emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II BAC clone B19C19
          Length = 61082

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 355  gcccgcccctacggccagcgtgccgtcctcaagttcgc 392
            ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 8721 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 8684

---

>emb|CR938589.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 611

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 158 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 217

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 218 tgggccgcacctgggaaaagctgctgctcgctgc 251

---

>emb|CR938120.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 876

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249

---

>emb|CR938108.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 855

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249

---

>emb|CR937995.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YN23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 162 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 221

                                             
Query: 272 tgggcaagacatgggagaagctccagctcgctgc 305
           |||||   || ||||| ||||| | |||||||||
Sbjct: 222 tgggccgcacctgggaaaagctgctgctcgctgc 255

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                             
Query: 260     acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 305
               ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 1902094 acatcatcaacgttggcaagacctgggagaagatccagctggctgc 1902139



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                        
Query: 352     tccgcccgcccctacggccagcgtgccgtcctcaagttcgc 392
               ||||||||  ||||||| ||||| ||||| |||||||||||
Sbjct: 1902186 tccgcccgaacctacggacagcgagccgttctcaagttcgc 1902226

---

>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 272 tgggc 276
           |||||
Sbjct: 163 tgggc 167

---

>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 272 tgggc 276
           |||||
Sbjct: 193 tgggc 197

---

>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 97  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 156

                
Query: 272 tgggc 276
           |||||
Sbjct: 157 tgggc 161

---

>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 137 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 196

                
Query: 272 tgggc 276
           |||||
Sbjct: 197 tgggc 201

---

>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 114 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 173

                
Query: 272 tgggc 276
           |||||
Sbjct: 174 tgggc 178

---

>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 272 tgggc 276
           |||||
Sbjct: 181 tgggc 185

---

>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 572

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 964 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 905

                
Query: 272 tgggc 276
           |||||
Sbjct: 904 tgggc 900

---

>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 160 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 219

                
Query: 272 tgggc 276
           |||||
Sbjct: 220 tgggc 224

---

>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 272 tgggc 276
           |||||
Sbjct: 194 tgggc 198

---

>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 214

                
Query: 272 tgggc 276
           |||||
Sbjct: 215 tgggc 219

---

>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX062255.1|CNS09K77 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 962 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgaacatcatcaacc 903

                
Query: 272 tgggc 276
           |||||
Sbjct: 902 tgggc 898

---

>emb|BX062254.1|CNS09K76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 272 tgggc 276
           |||||
Sbjct: 196 tgggc 200

---

>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 167 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 226

                
Query: 272 tgggc 276
           |||||
Sbjct: 227 tgggc 231

---

>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 94  acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 153

                
Query: 272 tgggc 276
           |||||
Sbjct: 154 tgggc 158

---

>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 162 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 221

                
Query: 272 tgggc 276
           |||||
Sbjct: 222 tgggc 226

---

>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 272 tgggc 276
           |||||
Sbjct: 204 tgggc 208

---

>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 272 tgggc 276
           |||||
Sbjct: 196 tgggc 200

---

>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 983 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 924

                
Query: 272 tgggc 276
           |||||
Sbjct: 923 tgggc 919

---

>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 272 tgggc 276
           |||||
Sbjct: 151 tgggc 155

---

>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 129 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 188

                
Query: 272 tgggc 276
           |||||
Sbjct: 189 tgggc 193

---

>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 193

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 95  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 154

                
Query: 272 tgggc 276
           |||||
Sbjct: 155 tgggc 159

---

>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 105 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 164

                
Query: 272 tgggc 276
           |||||
Sbjct: 165 tgggc 169

---

>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 979 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 920

                
Query: 272 tgggc 276
           |||||
Sbjct: 919 tgggc 915

---

>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 272 tgggc 276
           |||||
Sbjct: 187 tgggc 191

---

>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 56  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 115

                
Query: 272 tgggc 276
           |||||
Sbjct: 116 tgggc 120

---

>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 227

                
Query: 272 tgggc 276
           |||||
Sbjct: 228 tgggc 232

---

>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 285

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 227

                
Query: 272 tgggc 276
           |||||
Sbjct: 228 tgggc 232

---

>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 272 tgggc 276
           |||||
Sbjct: 181 tgggc 185

---

>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 272 tgggc 276
           |||||
Sbjct: 163 tgggc 167

---

>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 119 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 178

                
Query: 272 tgggc 276
           |||||
Sbjct: 179 tgggc 183

---

>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 272 tgggc 276
           |||||
Sbjct: 199 tgggc 203

---

>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 338

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 272 tgggc 276
           |||||
Sbjct: 186 tgggc 190

---

>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 214

                
Query: 272 tgggc 276
           |||||
Sbjct: 215 tgggc 219

---

>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 164 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 223

                
Query: 272 tgggc 276
           |||||
Sbjct: 224 tgggc 228

---

>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 272 tgggc 276
           |||||
Sbjct: 186 tgggc 190

---

>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 272 tgggc 276
           |||||
Sbjct: 180 tgggc 184

---

>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 272 tgggc 276
           |||||
Sbjct: 226 tgggc 230

---

>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 272 tgggc 276
           |||||
Sbjct: 193 tgggc 197

---

>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 81  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 140

                
Query: 272 tgggc 276
           |||||
Sbjct: 141 tgggc 145

---

>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 215

                
Query: 272 tgggc 276
           |||||
Sbjct: 216 tgggc 220

---

>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 272 tgggc 276
           |||||
Sbjct: 180 tgggc 184

---

>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 215

                
Query: 272 tgggc 276
           |||||
Sbjct: 216 tgggc 220

---

>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 80  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 139

                
Query: 272 tgggc 276
           |||||
Sbjct: 140 tgggc 144

---

>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 272 tgggc 276
           |||||
Sbjct: 187 tgggc 191

---

>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 206

                
Query: 272 tgggc 276
           |||||
Sbjct: 207 tgggc 211

---

>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 272 tgggc 276
           |||||
Sbjct: 897 tgggc 893

---

>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1079

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 272 tgggc 276
           |||||
Sbjct: 219 tgggc 223

---

>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205

---

>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 981 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 922

                
Query: 272 tgggc 276
           |||||
Sbjct: 921 tgggc 917

---

>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 272 tgggc 276
           |||||
Sbjct: 209 tgggc 213

---

>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 993 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 934

                
Query: 272 tgggc 276
           |||||
Sbjct: 933 tgggc 929

---

>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 272 tgggc 276
           |||||
Sbjct: 223 tgggc 227

---

>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 272 tgggc 276
           |||||
Sbjct: 200 tgggc 204

---

>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 986 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 927

                
Query: 272 tgggc 276
           |||||
Sbjct: 926 tgggc 922

---

>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 272 tgggc 276
           |||||
Sbjct: 218 tgggc 222

---

>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 272 tgggc 276
           |||||
Sbjct: 205 tgggc 209

---

>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 272 tgggc 276
           |||||
Sbjct: 203 tgggc 207

---

>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 272 tgggc 276
           |||||
Sbjct: 212 tgggc 216

---

>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 272 tgggc 276
           |||||
Sbjct: 213 tgggc 217

---

>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 272 tgggc 276
           |||||
Sbjct: 217 tgggc 221

---

>emb|BX031154.1|CNS08W7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX031118.1|CNS08W6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 272 tgggc 276
           |||||
Sbjct: 195 tgggc 199

---

>emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 272 tgggc 276
           |||||
Sbjct: 194 tgggc 198

---

>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX029939.1|CNS08V9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 272 tgggc 276
           |||||
Sbjct: 202 tgggc 206

---

>emb|BX029906.1|CNS08V8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 272 tgggc 276
           |||||
Sbjct: 206 tgggc 210

---

>emb|BX029898.1|CNS08V8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX029447.1|CNS08UVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 272 tgggc 276
           |||||
Sbjct: 198 tgggc 202

---

>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 207

                
Query: 272 tgggc 276
           |||||
Sbjct: 208 tgggc 212

---

>emb|BX028713.1|CNS08UBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 272 tgggc 276
           |||||
Sbjct: 214 tgggc 218

---

>emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 272 tgggc 276
           |||||
Sbjct: 151 tgggc 155

---

>emb|BX028388.1|CNS08U2G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX028172.1|CNS08TWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 78  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 137

                
Query: 272 tgggc 276
           |||||
Sbjct: 138 tgggc 142

---

>emb|BX027823.1|CNS08TMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 272 tgggc 276
           |||||
Sbjct: 226 tgggc 230

---

>emb|BX027638.1|CNS08THM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 272 tgggc 276
           |||||
Sbjct: 211 tgggc 215

---

>emb|BX027470.1|CNS08TCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 88  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 147

                
Query: 272 tgggc 276
           |||||
Sbjct: 148 tgggc 152

---

>emb|BX026965.1|CNS08SYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 272 tgggc 276
           |||||
Sbjct: 221 tgggc 225

---

>emb|BX026808.1|CNS08SUK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 272 tgggc 276
           |||||
Sbjct: 210 tgggc 214

---

>emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 212 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 271
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 272 tgggc 276
           |||||
Sbjct: 201 tgggc 205


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,407,162
Number of Sequences: 3902068
Number of extensions: 2407162
Number of successful extensions: 58395
Number of sequences better than 10.0: 433
Number of HSP's better than 10.0 without gapping: 411
Number of HSP's successfully gapped in prelim test: 25
Number of HSP's that attempted gapping in prelim test: 57054
Number of HSP's gapped (non-prelim): 1339
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---