ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet101b06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC027848.1| Homo sapiens cDNA clone IMAGE:5200948, partial cds Length = 184 Score = 274 bits (138), Expect = 3e-70 Identities = 175/185 (94%), Gaps = 3/185 (1%) Strand = Plus / Plus Query: 30 tcccactccaccagtccacaccgcagcggcactccagtgagctcgaaaccgagagggcaa 89 |||| |||||||||||||||||||||| |||| ||||||||||| |||||||||| || Sbjct: 1 tcccgctccaccagtccacaccgcagcagcacg--agtgagctcgagaccgagaggggaa 58 Query: 90 gaagaggaggaaccgatacagcactacaggcaaccatggaggtggtgaccggcagcaacg 149 || ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 59 ga-gaggaggaagcgatacagtactacaggcaaccatggaggtggtgaccggcagcaacg 117 Query: 150 gcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggtgccgccccgccc 209 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 118 gcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggtgccgccccgccc 177 Query: 210 ccgtg 214 ||||| Sbjct: 178 ccgtg 182
>gb|AC135424.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0015F11, complete sequence Length = 177574 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 233 gaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgc 292 ||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||| Sbjct: 129668 gaggtggaggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgc 129609 Query: 293 gacagctggctccgcgactac 313 ||| |||||||||| |||||| Sbjct: 129608 gaccgctggctccgggactac 129588 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Minus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 129771 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 129722
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Minus Query: 233 gaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgc 292 ||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||| Sbjct: 16043917 gaggtggaggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgc 16043858 Query: 293 gacagctggctccgcgactac 313 ||| |||||||||| |||||| Sbjct: 16043857 gaccgctggctccgggactac 16043837 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Minus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 16044020 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 16043971 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 13413679 tcccatcccatcccatccca 13413698
>dbj|AK104716.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-A07, full insert sequence Length = 902 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 233 gaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgc 292 ||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||| Sbjct: 183 gaggtggaggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgc 242 Query: 293 gacagctggctccgcgactac 313 ||| |||||||||| |||||| Sbjct: 243 gaccgctggctccgggactac 263 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 80 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 129
>dbj|AK098850.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000G04, full insert sequence Length = 874 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 233 gaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgc 292 ||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||| Sbjct: 184 gaggtggaggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgc 243 Query: 293 gacagctggctccgcgactac 313 ||| |||||||||| |||||| Sbjct: 244 gaccgctggctccgggactac 264 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 81 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 130
>dbj|AK060058.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-F02, full insert sequence Length = 902 Score = 105 bits (53), Expect = 1e-19 Identities = 74/81 (91%) Strand = Plus / Plus Query: 233 gaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgc 292 ||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||| Sbjct: 183 gaggtggaggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgc 242 Query: 293 gacagctggctccgcgactac 313 ||| |||||||||| |||||| Sbjct: 243 gaccgctggctccgggactac 263 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 80 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 129
>dbj|AK119727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-H06, full insert sequence Length = 879 Score = 97.6 bits (49), Expect = 3e-17 Identities = 67/73 (91%) Strand = Plus / Plus Query: 241 ggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccgcgacagctg 300 |||||||||||| ||||||||||||||||||| |||||| ||| ||||||||||| |||| Sbjct: 195 ggacttctccccggagtggtggcgcctcgtcggctcctccccggccttccgcgaccgctg 254 Query: 301 gctccgcgactac 313 |||||| |||||| Sbjct: 255 gctccgggactac 267 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgccggggagctggt 197 |||||||| |||||||||||||||||||||||||||||||| | |||||| Sbjct: 84 cggcgggaagctgaacccgtgggcggagcccttcgtgccggcgggctggt 133
>gb|AY105659.1| Zea mays PCO117463 mRNA sequence Length = 562 Score = 91.7 bits (46), Expect = 2e-15 Identities = 76/86 (88%) Strand = Plus / Plus Query: 232 ggaggtcgaggacttctcccccgagtggtggcgcctcgtcgcctcctcgccgtccttccg 291 |||||| ||||||||||||||||||||||||||||| || || |||| ||| ||||||| Sbjct: 210 ggaggtggaggacttctcccccgagtggtggcgcctggtgtccgcctccccggccttccg 269 Query: 292 cgacagctggctccgcgactacggcg 317 |||| ||||||| ||||| ||||||| Sbjct: 270 cgaccgctggctgcgcgagtacggcg 295 Score = 69.9 bits (35), Expect = 7e-09 Identities = 38/39 (97%) Strand = Plus / Plus Query: 148 cggcgggaggctgaacccgtgggcggagcccttcgtgcc 186 |||||||||||||||||| |||||||||||||||||||| Sbjct: 120 cggcgggaggctgaacccctgggcggagcccttcgtgcc 158
>gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, complete sequence Length = 113368 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 11 ccattcccatcccatcccatccca 34 |||||||||||||||||||||||| Sbjct: 8062 ccattcccatcccatcccatccca 8039
>emb|AL390037.16| Human DNA sequence from clone RP5-851M4 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 79531 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 11 ccattcccatcccatcccatccca 34 |||||||||||||||||||||||| Sbjct: 2687 ccattcccatcccatcccatccca 2664 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 2678 tcccatcccatcccatccca 2659 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 2673 tcccatcccatcccatccca 2654 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 2668 tcccatcccatcccatccca 2649 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 2663 tcccatcccatcccatccca 2644
>gb|AC103890.1| 16q24.3 clone, complete sequence Length = 129848 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 11 ccattcccatcccatcccatccca 34 |||||||||||||||||||||||| Sbjct: 2891 ccattcccatcccatcccatccca 2914
>gb|AC006472.2|AC006472 Drosophila melanogaster, chromosome 2R, region 45E1-46A2, BAC clone BACR48G21, complete sequence Length = 156346 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 7 ccgtccattcccatcccatcccatccca 34 ||||||| |||||||||||||||||||| Sbjct: 152326 ccgtccaatcccatcccatcccatccca 152353
>gb|AC007086.10|AC007086 Drosophila melanogaster, chromosome 2R, region 45A-46A, BAC clone BACR14J24, complete sequence Length = 186241 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Plus Query: 7 ccgtccattcccatcccatcccatccca 34 ||||||| |||||||||||||||||||| Sbjct: 71020 ccgtccaatcccatcccatcccatccca 71047
>gb|AC104815.4| Homo sapiens BAC clone RP11-687B11 from 2, complete sequence Length = 41839 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatcccactccacc 41 |||| ||||||||||||||||||||| ||||| Sbjct: 20305 tccaatcccatcccatcccatcccaccccacc 20274 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 20123 tcccatcccatcccatcccac 20103 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 20526 tcccatcccatcccatccca 20507 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 20340 tcccatcccatcccatccca 20321
>gb|AC137932.1| Homo sapiens chromosome 16 clone GS2-740I5, complete sequence Length = 129785 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 11 ccattcccatcccatcccatccca 34 |||||||||||||||||||||||| Sbjct: 126895 ccattcccatcccatcccatccca 126872
>gb|AE003833.4| Drosophila melanogaster chromosome 2R, section 17 of 73 of the complete sequence Length = 297107 Score = 48.1 bits (24), Expect = 0.027 Identities = 27/28 (96%) Strand = Plus / Minus Query: 7 ccgtccattcccatcccatcccatccca 34 ||||||| |||||||||||||||||||| Sbjct: 188131 ccgtccaatcccatcccatcccatccca 188104
>gb|AC011252.5| Drosophila melanogaster clone BACR23H21, complete sequence Length = 157965 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 cattcccatcccatcccatccca 34 ||||||||||||||||||||||| Sbjct: 82925 cattcccatcccatcccatccca 82903 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 82912 tcccatcccatcccatcccattcca 82888 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82917 tcccatcccatcccatccca 82898
>gb|AC009357.8| Drosophila melanogaster clone BACR18I07, complete sequence Length = 179374 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 cattcccatcccatcccatccca 34 ||||||||||||||||||||||| Sbjct: 9957 cattcccatcccatcccatccca 9935 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 9944 tcccatcccatcccatcccattcca 9920 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 9949 tcccatcccatcccatccca 9930
>gb|AC182748.2| Mus musculus BAC clone RP23-348N13 from chromosome 17, complete sequence Length = 214515 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactc 37 ||||||||||||||||||||||| Sbjct: 46097 tcccatcccatcccatcccactc 46119
>gb|AC107765.9| Mus musculus chromosome 17, clone RP23-166P7, complete sequence Length = 229687 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 65238 tcccatcccatcccatcccaccccacc 65264 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 65227 ttcccatcccatcccatccca 65247 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 65233 tcccatcccatcccatccca 65252
>emb|AL365361.12| Human DNA sequence from clone RP11-284N8 on chromosome 1 Contains the KCNA2 gene for a potassium voltage-gated channel from the shaker-related subfamily member 2, the KCNA3 gene for a potassium voltage-gated channel from the shaker-related subfamily member 3 and two CpG islands, complete sequence Length = 193182 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 23617 tcccatcccatcccatcccaccccacc 23643 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 23612 tcccatcccatcccatccca 23631 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 23607 tcccatcccatcccatccca 23626
>gb|AC158749.5| Mus musculus chromosome 7, clone RP23-285C18, complete sequence Length = 237364 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 177475 tcccatcccatcccatcccaccccacc 177449 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccactccacc 41 |||||||||||||||||||| ||||| Sbjct: 177449 cccatcccatcccatcccaccccacc 177424 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177410 tcccatcccatcccatccca 177391 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177405 tcccatcccatcccatccca 177386 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177400 tcccatcccatcccatccca 177381 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177395 tcccatcccatcccatccca 177376 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177390 tcccatcccatcccatccca 177371 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177385 tcccatcccatcccatccca 177366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 177380 tcccatcccatcccatccca 177361
>gb|AC120128.17| Mus musculus chromosome 5, clone RP23-181F22, complete sequence Length = 213246 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 68669 tcccatcccatcccatcccaccccacc 68695 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccactccacc 41 |||||||||||||||||||| ||||| Sbjct: 68715 cccatcccatcccatcccaccccacc 68740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 68653 ttcccatcccatcccatccca 68673 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccac 35 |||||||||||||||||||| Sbjct: 68755 cccatcccatcccatcccac 68774 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 68664 tcccatcccatcccatccca 68683 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 68659 tcccatcccatcccatccca 68678
>gb|AC153363.4| Mus musculus BAC clone RP23-5I6 from chromosome 9, complete sequence Length = 185444 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 83815 tcccatcccatcccatcccaccccacc 83841 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 83335 tcccatcccatcccatcccaccccacc 83361 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 83315 tccaatcccatcccatcccatccca 83339 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83810 tcccatcccatcccatccca 83829 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83805 tcccatcccatcccatccca 83824 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83800 tcccatcccatcccatccca 83819 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83795 tcccatcccatcccatccca 83814 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83790 tcccatcccatcccatccca 83809 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83785 tcccatcccatcccatccca 83804 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83780 tcccatcccatcccatccca 83799 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83775 tcccatcccatcccatccca 83794 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83770 tcccatcccatcccatccca 83789 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83765 tcccatcccatcccatccca 83784 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83760 tcccatcccatcccatccca 83779 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83755 tcccatcccatcccatccca 83774 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83750 tcccatcccatcccatccca 83769 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83745 tcccatcccatcccatccca 83764 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83740 tcccatcccatcccatccca 83759 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83735 tcccatcccatcccatccca 83754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83730 tcccatcccatcccatccca 83749 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83725 tcccatcccatcccatccca 83744 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83720 tcccatcccatcccatccca 83739 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83715 tcccatcccatcccatccca 83734 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83710 tcccatcccatcccatccca 83729 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83705 tcccatcccatcccatccca 83724 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83700 tcccatcccatcccatccca 83719 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83695 tcccatcccatcccatccca 83714 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83690 tcccatcccatcccatccca 83709 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83685 tcccatcccatcccatccca 83704 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83680 tcccatcccatcccatccca 83699 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83675 tcccatcccatcccatccca 83694 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83670 tcccatcccatcccatccca 83689 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83665 tcccatcccatcccatccca 83684 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83660 tcccatcccatcccatccca 83679 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83655 tcccatcccatcccatccca 83674 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83650 tcccatcccatcccatccca 83669 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83645 tcccatcccatcccatccca 83664 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83640 tcccatcccatcccatccca 83659 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83635 tcccatcccatcccatccca 83654 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83630 tcccatcccatcccatccca 83649 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83625 tcccatcccatcccatccca 83644 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83620 tcccatcccatcccatccca 83639 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83615 tcccatcccatcccatccca 83634 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83610 tcccatcccatcccatccca 83629 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83605 tcccatcccatcccatccca 83624 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83600 tcccatcccatcccatccca 83619 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83595 tcccatcccatcccatccca 83614 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83590 tcccatcccatcccatccca 83609 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83585 tcccatcccatcccatccca 83604 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83580 tcccatcccatcccatccca 83599 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83575 tcccatcccatcccatccca 83594 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83570 tcccatcccatcccatccca 83589 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83565 tcccatcccatcccatccca 83584 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83560 tcccatcccatcccatccca 83579 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83555 tcccatcccatcccatccca 83574 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83550 tcccatcccatcccatccca 83569 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83545 tcccatcccatcccatccca 83564 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83540 tcccatcccatcccatccca 83559 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83535 tcccatcccatcccatccca 83554 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83530 tcccatcccatcccatccca 83549 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83525 tcccatcccatcccatccca 83544 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83520 tcccatcccatcccatccca 83539 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83515 tcccatcccatcccatccca 83534 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83510 tcccatcccatcccatccca 83529 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83505 tcccatcccatcccatccca 83524 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83500 tcccatcccatcccatccca 83519 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83495 tcccatcccatcccatccca 83514 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83490 tcccatcccatcccatccca 83509 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83485 tcccatcccatcccatccca 83504 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83480 tcccatcccatcccatccca 83499 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83475 tcccatcccatcccatccca 83494 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83470 tcccatcccatcccatccca 83489 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83465 tcccatcccatcccatccca 83484 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83460 tcccatcccatcccatccca 83479 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83455 tcccatcccatcccatccca 83474 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83450 tcccatcccatcccatccca 83469 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83445 tcccatcccatcccatccca 83464 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83440 tcccatcccatcccatccca 83459 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83435 tcccatcccatcccatccca 83454 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83430 tcccatcccatcccatccca 83449 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83425 tcccatcccatcccatccca 83444 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83420 tcccatcccatcccatccca 83439 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83415 tcccatcccatcccatccca 83434 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83410 tcccatcccatcccatccca 83429 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83405 tcccatcccatcccatccca 83424 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83400 tcccatcccatcccatccca 83419 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83395 tcccatcccatcccatccca 83414 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83390 tcccatcccatcccatccca 83409 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83385 tcccatcccatcccatccca 83404 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83380 tcccatcccatcccatccca 83399 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83375 tcccatcccatcccatccca 83394 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83330 tcccatcccatcccatccca 83349 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83325 tcccatcccatcccatccca 83344
>gb|AC095350.8| Homo sapiens 12 BAC RP11-662M24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 129055 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccacc 41 |||||||||||||||||||| |||||| Sbjct: 119434 tcccatcccatcccatcccattccacc 119408 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 119439 tcccatcccatcccatccca 119420
>gb|AE003601.4| Drosophila melanogaster chromosome 3R, section 7 of 118 of the complete sequence Length = 305165 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 12 cattcccatcccatcccatccca 34 ||||||||||||||||||||||| Sbjct: 152758 cattcccatcccatcccatccca 152736 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 152745 tcccatcccatcccatcccattcca 152721 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 152750 tcccatcccatcccatccca 152731
>gb|AC126669.4| Mus musculus BAC clone RP24-457D15 from 9, complete sequence Length = 180081 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 4895 tcccatcccatcccatcccaccccacc 4921 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccacc 41 ||||||||||||||||||||| ||||| Sbjct: 4085 tcccatcccatcccatcccaccccacc 4111 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccactccacc 41 |||||||||||||||||||| ||||| Sbjct: 4951 cccatcccatcccatcccaccccacc 4976 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 4680 tcccatcccatcccatcccac 4700 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 4510 tcccatcccatcccatcccac 4530 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 4035 tccaatcccatcccatcccatccca 4059 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4890 tcccatcccatcccatccca 4909 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4885 tcccatcccatcccatccca 4904 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4880 tcccatcccatcccatccca 4899 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4875 tcccatcccatcccatccca 4894 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4870 tcccatcccatcccatccca 4889 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4865 tcccatcccatcccatccca 4884 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4860 tcccatcccatcccatccca 4879 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4855 tcccatcccatcccatccca 4874 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4850 tcccatcccatcccatccca 4869 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4845 tcccatcccatcccatccca 4864 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4840 tcccatcccatcccatccca 4859 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4835 tcccatcccatcccatccca 4854 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4830 tcccatcccatcccatccca 4849 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4825 tcccatcccatcccatccca 4844 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4820 tcccatcccatcccatccca 4839 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4815 tcccatcccatcccatccca 4834 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4810 tcccatcccatcccatccca 4829 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4805 tcccatcccatcccatccca 4824 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4780 tcccatcccatcccatccca 4799 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4775 tcccatcccatcccatccca 4794 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4770 tcccatcccatcccatccca 4789 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4765 tcccatcccatcccatccca 4784 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4760 tcccatcccatcccatccca 4779 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4755 tcccatcccatcccatccca 4774 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4750 tcccatcccatcccatccca 4769 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 catcccatcccatcccactccacc 41 |||||||||||||||||| ||||| Sbjct: 4703 catcccatcccatcccaccccacc 4726 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4675 tcccatcccatcccatccca 4694 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4670 tcccatcccatcccatccca 4689 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4665 tcccatcccatcccatccca 4684 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4660 tcccatcccatcccatccca 4679 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4655 tcccatcccatcccatccca 4674 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 18 catcccatcccatcccactccacc 41 |||||||||||||||||| ||||| Sbjct: 4613 catcccatcccatcccaccccacc 4636 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccac 35 |||||||||||||||||||| Sbjct: 4556 cccatcccatcccatcccac 4575 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4505 tcccatcccatcccatccca 4524 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4500 tcccatcccatcccatccca 4519 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4495 tcccatcccatcccatccca 4514 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4490 tcccatcccatcccatccca 4509 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4485 tcccatcccatcccatccca 4504 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4480 tcccatcccatcccatccca 4499 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4475 tcccatcccatcccatccca 4494 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4470 tcccatcccatcccatccca 4489 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4465 tcccatcccatcccatccca 4484 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4460 tcccatcccatcccatccca 4479 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4455 tcccatcccatcccatccca 4474 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4450 tcccatcccatcccatccca 4469 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4445 tcccatcccatcccatccca 4464 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4440 tcccatcccatcccatccca 4459 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4435 tcccatcccatcccatccca 4454 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4430 tcccatcccatcccatccca 4449 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4425 tcccatcccatcccatccca 4444 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4420 tcccatcccatcccatccca 4439 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4415 tcccatcccatcccatccca 4434 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4410 tcccatcccatcccatccca 4429 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4405 tcccatcccatcccatccca 4424 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4400 tcccatcccatcccatccca 4419 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4395 tcccatcccatcccatccca 4414 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4390 tcccatcccatcccatccca 4409 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4385 tcccatcccatcccatccca 4404 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4380 tcccatcccatcccatccca 4399 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4375 tcccatcccatcccatccca 4394 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4370 tcccatcccatcccatccca 4389 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4365 tcccatcccatcccatccca 4384 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4360 tcccatcccatcccatccca 4379 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4355 tcccatcccatcccatccca 4374 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4350 tcccatcccatcccatccca 4369 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4345 tcccatcccatcccatccca 4364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4340 tcccatcccatcccatccca 4359 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4335 tcccatcccatcccatccca 4354 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4330 tcccatcccatcccatccca 4349 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4325 tcccatcccatcccatccca 4344 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4320 tcccatcccatcccatccca 4339 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4315 tcccatcccatcccatccca 4334 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4310 tcccatcccatcccatccca 4329 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4305 tcccatcccatcccatccca 4324 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4300 tcccatcccatcccatccca 4319 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4295 tcccatcccatcccatccca 4314 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4290 tcccatcccatcccatccca 4309 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4285 tcccatcccatcccatccca 4304 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4280 tcccatcccatcccatccca 4299 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4275 tcccatcccatcccatccca 4294 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4270 tcccatcccatcccatccca 4289 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4265 tcccatcccatcccatccca 4284 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4260 tcccatcccatcccatccca 4279 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4255 tcccatcccatcccatccca 4274 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4250 tcccatcccatcccatccca 4269 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4245 tcccatcccatcccatccca 4264 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4240 tcccatcccatcccatccca 4259 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4235 tcccatcccatcccatccca 4254 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4230 tcccatcccatcccatccca 4249 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4225 tcccatcccatcccatccca 4244 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4220 tcccatcccatcccatccca 4239 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4215 tcccatcccatcccatccca 4234 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4210 tcccatcccatcccatccca 4229 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4205 tcccatcccatcccatccca 4224 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4200 tcccatcccatcccatccca 4219 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4195 tcccatcccatcccatccca 4214 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4190 tcccatcccatcccatccca 4209 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4185 tcccatcccatcccatccca 4204 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4180 tcccatcccatcccatccca 4199 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4175 tcccatcccatcccatccca 4194 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4170 tcccatcccatcccatccca 4189 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4165 tcccatcccatcccatccca 4184 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4160 tcccatcccatcccatccca 4179 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4155 tcccatcccatcccatccca 4174 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4150 tcccatcccatcccatccca 4169 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4145 tcccatcccatcccatccca 4164 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4140 tcccatcccatcccatccca 4159 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4135 tcccatcccatcccatccca 4154 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4130 tcccatcccatcccatccca 4149 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4125 tcccatcccatcccatccca 4144 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4080 tcccatcccatcccatccca 4099 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4075 tcccatcccatcccatccca 4094 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4070 tcccatcccatcccatccca 4089 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4065 tcccatcccatcccatccca 4084 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4060 tcccatcccatcccatccca 4079 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4055 tcccatcccatcccatccca 4074 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4050 tcccatcccatcccatccca 4069 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4045 tcccatcccatcccatccca 4064
>gb|AC154443.2| Mus musculus BAC clone RP24-178N23 from chromosome 17, complete sequence Length = 174220 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactc 37 ||||||||||||||||||||||| Sbjct: 97098 tcccatcccatcccatcccactc 97120
>gb|AC154202.2| Mus musculus BAC clone RP24-386E14 from chromosome 14, complete sequence Length = 147957 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactccac 40 ||||||||||||||||||||| |||| Sbjct: 54248 tcccatcccatcccatcccaccccac 54273
>gb|AC092494.2| Drosophila melanogaster clone BACR23I18, complete sequence Length = 172029 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 119333 attcccatcccatcccatccca 119312
>gb|AC138290.9| Mus musculus chromosome 10, clone RP23-245C15, complete sequence Length = 151470 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 21146 attcccatcccatcccatccca 21125 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 21139 tcccatcccatcccatccca 21120
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 159445 attcccatcccatcccatccca 159424
>gb|AC009030.10| Homo sapiens chromosome 16 clone RP11-13G6, complete sequence Length = 189379 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatc 31 |||||||||||||||||||||| Sbjct: 136147 tccattcccatcccatcccatc 136168 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 136830 tcccatcccatcccatcccattcca 136854 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 133351 tcccatcccatcccatcccattcca 133327 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 136825 tcccatcccatcccatccca 136844 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 136820 tcccatcccatcccatccca 136839 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 136815 tcccatcccatcccatccca 136834 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 136810 tcccatcccatcccatccca 136829 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 136730 tcccatcccatcccatccca 136749 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccactcca 39 ||||||||||||||||||| |||| Sbjct: 136329 cccatcccatcccatcccattcca 136352 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133486 tcccatcccatcccatccca 133467 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133391 tcccatcccatcccatccca 133372 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133386 tcccatcccatcccatccca 133367 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133381 tcccatcccatcccatccca 133362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133376 tcccatcccatcccatccca 133357 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133371 tcccatcccatcccatccca 133352 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133366 tcccatcccatcccatccca 133347 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133361 tcccatcccatcccatccca 133342 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133356 tcccatcccatcccatccca 133337
>emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on chromosome 1 Contains thirteen novel genes, a novel pseudogene, a novel gene similar to the F-box only protein 25 gene(FBXO25), a novel pseudogene similar to the beta-tubulin family and a CpG island, complete sequence Length = 179567 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccac 40 |||||||||||||||||||| ||||| Sbjct: 92542 tcccatcccatcccatcccattccac 92517 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 92582 tcccatcccatcccatccca 92563 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 92577 tcccatcccatcccatccca 92558 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 92572 tcccatcccatcccatccca 92553 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 92567 tcccatcccatcccatccca 92548
>emb|AL157934.17| Human DNA sequence from clone RP11-449M9 on chromosome Xq13.1-13.3 Contains the 3' end of the SLC16A2 gene for solute carrier family 16 member 2 and two CpG islands, complete sequence Length = 106497 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccac 40 |||||||||||||||||||| ||||| Sbjct: 70559 tcccatcccatcccatcccattccac 70534 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 70564 tcccatcccatcccatccca 70545
>gb|AC010030.10| Drosophila melanogaster 3L BAC RP98-2C14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 200859 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatcccactcca 39 |||| |||||||||||||||||||| |||| Sbjct: 113469 tccaatcccatcccatcccatcccattcca 113498
>gb|AC161106.13| Medicago truncatula clone mth2-168f23, complete sequence Length = 94766 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 45089 attcccatcccatcccatccca 45068 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45082 tcccatcccatcccatccca 45063
>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 191590 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccac 40 ||||||||||||| |||||||||||| Sbjct: 91714 tcccatcccatccgatcccactccac 91689
>gb|AC130449.2| Homo sapiens chromosome 16 clone CTA-233A7, complete sequence Length = 175104 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatc 31 |||||||||||||||||||||| Sbjct: 79544 tccattcccatcccatcccatc 79523 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 82325 tcccatcccatcccatcccattcca 82349 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 78836 tcccatcccatcccatcccattcca 78812 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82320 tcccatcccatcccatccca 82339 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82315 tcccatcccatcccatccca 82334 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82310 tcccatcccatcccatccca 82329 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82305 tcccatcccatcccatccca 82324 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82300 tcccatcccatcccatccca 82319 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82205 tcccatcccatcccatccca 82224 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccactcca 39 ||||||||||||||||||| |||| Sbjct: 79362 cccatcccatcccatcccattcca 79339 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78961 tcccatcccatcccatccca 78942 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78881 tcccatcccatcccatccca 78862 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78876 tcccatcccatcccatccca 78857 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78871 tcccatcccatcccatccca 78852 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78866 tcccatcccatcccatccca 78847 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78861 tcccatcccatcccatccca 78842 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78856 tcccatcccatcccatccca 78837 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78851 tcccatcccatcccatccca 78832 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78846 tcccatcccatcccatccca 78827 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 78841 tcccatcccatcccatccca 78822
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 259425 attcccatcccatcccatccca 259404
>gb|AE003546.4| Drosophila melanogaster chromosome 3L, section 39 of 83 of the complete sequence Length = 281589 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatcccactcca 39 |||| |||||||||||||||||||| |||| Sbjct: 42083 tccaatcccatcccatcccatcccattcca 42112
>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete sequence Length = 299943 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccac 40 ||||||||||||| |||||||||||| Sbjct: 237705 tcccatcccatccgatcccactccac 237680
>gb|AC122301.4| Mus musculus BAC clone RP23-276C6 from 10, complete sequence Length = 179801 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 13 attcccatcccatcccatccca 34 |||||||||||||||||||||| Sbjct: 8472 attcccatcccatcccatccca 8493 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 8479 tcccatcccatcccatccca 8498
>emb|AL772145.9| Mouse DNA sequence from clone RP23-212H4 on chromosome 3, complete sequence Length = 228623 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 398 gagggagaggggaggaaggaag 419 |||||||||||||||||||||| Sbjct: 11747 gagggagaggggaggaaggaag 11726
>gb|AC022351.3| Drosophila melanogaster clone BACR29G15, complete sequence Length = 179396 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 27829 tcccatcccatcccatcccattcca 27853
>gb|AC137855.14| Mus musculus chromosome 16, clone RP24-444E8, complete sequence Length = 196783 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 27687 tcccatcccatcccatcccac 27707 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 17 ccatcccatcccatcccactccacc 41 ||||||||||||||||||| ||||| Sbjct: 27385 ccatcccatcccatcccaccccacc 27409 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27682 tcccatcccatcccatccca 27701 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27677 tcccatcccatcccatccca 27696 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccac 35 |||||||||||||||||||| Sbjct: 27638 cccatcccatcccatcccac 27657 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27588 tcccatcccatcccatccca 27607 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccac 35 |||||||||||||||||||| Sbjct: 27349 cccatcccatcccatcccac 27368 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27299 tcccatcccatcccatccca 27318
>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence Length = 212923 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 119009 tcccatcccatcccatcccattcca 118985 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 119024 tcccatcccatcccatccca 119005 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 119019 tcccatcccatcccatccca 119000 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 119014 tcccatcccatcccatccca 118995
>gb|AC159991.9| Mus musculus chromosome 1, clone RP23-413H17, complete sequence Length = 180715 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 166740 tcccatcccatcccatcccac 166760 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166735 tcccatcccatcccatccca 166754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166730 tcccatcccatcccatccca 166749 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166725 tcccatcccatcccatccca 166744 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166720 tcccatcccatcccatccca 166739 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166715 tcccatcccatcccatccca 166734 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166710 tcccatcccatcccatccca 166729 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 166705 tcccatcccatcccatccca 166724
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence Length = 1608198 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 600552 tcccatcccatcccatcccac 600532 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 600557 tcccatcccatcccatccca 600538
>gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21.1, complete sequence Length = 138999 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccact 36 ||||||||||||||||||||| Sbjct: 135340 cccatcccatcccatcccact 135360
>gb|AC104617.9| Trypanosoma brucei chromosome 5 clone RPCI93-1P6, complete sequence Length = 152664 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 76720 tcccatcccatcccatcccac 76740 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 76715 tcccatcccatcccatccca 76734
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence Length = 183048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 173834 tcccatcccatcccatcccac 173814
>gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete sequence Length = 185417 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 162521 tcccatcccatcccatcccagtcca 162545
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 149924 tcccatcccatcccatcccac 149944 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 149919 tcccatcccatcccatccca 149938
>gb|AC115928.10| Mus musculus chromosome 18, clone RP24-530D22, complete sequence Length = 182777 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 13 attcccatcccatcccatccc 33 ||||||||||||||||||||| Sbjct: 112785 attcccatcccatcccatccc 112805
>ref|NM_011799.2| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 1, mRNA Length = 4608 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3458 tcccatcccatcccatcccac 3438 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3463 tcccatcccatcccatccca 3444
>ref|NM_001025779.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae) (Cdc6), transcript variant 2, mRNA Length = 4532 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3382 tcccatcccatcccatcccac 3362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3387 tcccatcccatcccatccca 3368
>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence Length = 195972 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 156361 tcccatcccatcccatcccac 156381 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 156356 tcccatcccatcccatccca 156375 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 156351 tcccatcccatcccatccca 156370 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 156346 tcccatcccatcccatccca 156365 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 156341 tcccatcccatcccatccca 156360 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 156336 tcccatcccatcccatccca 156355
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 20935354 tcccatcccatcccatcccac 20935334 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 35509309 tcccatcccatcccatccca 35509290 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22546408 tcccatcccatcccatccca 22546427 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 20935359 tcccatcccatcccatccca 20935340 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 5602646 tcccatcccatcccatccca 5602665 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 5602641 tcccatcccatcccatccca 5602660
>gb|AC161586.5| Mus musculus BAC clone RP24-457J18 from chromosome 13, complete sequence Length = 146936 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 397 agagggagaggggaggaaggaagaa 421 |||||||||||||||||||| |||| Sbjct: 107540 agagggagaggggaggaaggcagaa 107564
>gb|AC140353.2| Mus musculus BAC clone RP24-67E1 from chromosome 5, complete sequence Length = 161652 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 45019 tcccatcccatcccatcccac 45039 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45014 tcccatcccatcccatccca 45033 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45009 tcccatcccatcccatccca 45028 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45004 tcccatcccatcccatccca 45023 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 44999 tcccatcccatcccatccca 45018 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 44994 tcccatcccatcccatccca 45013 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 44989 tcccatcccatcccatccca 45008
>gb|AC115766.9| Mus musculus chromosome 1, clone RP23-82I24, complete sequence Length = 225600 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 218593 tcccatcccatcccatcccac 218613 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 218588 tcccatcccatcccatccca 218607 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 218583 tcccatcccatcccatccca 218602 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 218578 tcccatcccatcccatccca 218597 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 218573 tcccatcccatcccatccca 218592 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 218568 tcccatcccatcccatccca 218587
>gb|AC124770.4| Mus musculus BAC clone RP23-8J2 from chromosome 18, complete sequence Length = 216754 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 13 attcccatcccatcccatccc 33 ||||||||||||||||||||| Sbjct: 215353 attcccatcccatcccatccc 215333
>emb|CT009489.6| Mouse DNA sequence from clone RP23-97F8 on chromosome 14, complete sequence Length = 150382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 45387 tcccatcccatcccatcccac 45407 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45382 tcccatcccatcccatccca 45401 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45377 tcccatcccatcccatccca 45396 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45372 tcccatcccatcccatccca 45391 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 45367 tcccatcccatcccatccca 45386
>gb|AC123798.5| Mus musculus BAC clone RP24-334O8 from chromosome 3, complete sequence Length = 168467 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 86106 tccaatcccatcccatcccatccca 86130 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86146 tcccatcccatcccatccca 86165 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86141 tcccatcccatcccatccca 86160 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86136 tcccatcccatcccatccca 86155 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86131 tcccatcccatcccatccca 86150 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86126 tcccatcccatcccatccca 86145 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86121 tcccatcccatcccatccca 86140 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86116 tcccatcccatcccatccca 86135 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86086 tcccatcccatcccatccca 86105 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86081 tcccatcccatcccatccca 86100
>gb|AC129295.4| Mus musculus BAC clone RP24-560M23 from chromosome 1, complete sequence Length = 121538 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 99664 tcccatcccatcccatcccac 99684 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccactcca 39 ||||||||||||||||| |||||| Sbjct: 99776 cccatcccatcccatcctactcca 99799 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99659 tcccatcccatcccatccca 99678 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99625 tcccatcccatcccatccca 99644
>gb|AC002331.1|HUAC002331 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-A-218C7, complete sequence Length = 139480 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 397 agagggagaggggaggaaggaagaa 421 ||||||| ||||||||||||||||| Sbjct: 41946 agagggaaaggggaggaaggaagaa 41922
>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete sequence Length = 159082 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 145020 tcccatcccatcccatcccac 145040 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 145015 tcccatcccatcccatccca 145034 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 145010 tcccatcccatcccatccca 145029 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 145005 tcccatcccatcccatccca 145024 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 145000 tcccatcccatcccatccca 145019
>gb|AC124189.3| Mus musculus BAC clone RP23-254C8 from 5, complete sequence Length = 150507 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 143367 tcccatcccatcccatcccac 143387 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143362 tcccatcccatcccatccca 143381 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143357 tcccatcccatcccatccca 143376 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143352 tcccatcccatcccatccca 143371 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143347 tcccatcccatcccatccca 143366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143342 tcccatcccatcccatccca 143361 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143337 tcccatcccatcccatccca 143356
>gb|AC095044.3| Homo sapiens BAC clone RP11-132B16 from 7, complete sequence Length = 134184 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 398 gagggagaggggaggaaggaa 418 ||||||||||||||||||||| Sbjct: 46653 gagggagaggggaggaaggaa 46633
>gb|BC052434.1| Mus musculus cell division cycle 6 homolog (S. cerevisiae), mRNA (cDNA clone MGC:63392 IMAGE:6837113), complete cds Length = 4442 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3382 tcccatcccatcccatcccac 3362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3387 tcccatcccatcccatccca 3368
>gb|AC019028.13| Mus musculus chromosome 5, clone RP23-88A22, complete sequence Length = 264425 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 94886 tcccatcccatcccatcccac 94906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 94842 tcccatcccatcccatcccac 94862 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 94768 tcccatcccatcccatcccac 94788 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 94837 tcccatcccatcccatccca 94856 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 94763 tcccatcccatcccatccca 94782 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 94758 tcccatcccatcccatccca 94777
>gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, complete sequence Length = 211521 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 174348 tcccatcccatcccatcccac 174368 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 174304 tcccatcccatcccatcccac 174324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 174230 tcccatcccatcccatcccac 174250 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 174299 tcccatcccatcccatccca 174318 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 174225 tcccatcccatcccatccca 174244 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 174220 tcccatcccatcccatccca 174239
>emb|Z68754.1|HSE78H10 Human DNA sequence from clone LL22NC01-78H10 on chromosome 22, complete sequence Length = 24888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 cccatcccatcccactccacc 41 ||||||||||||||||||||| Sbjct: 2215 cccatcccatcccactccacc 2235 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 cccatcccatcccactccacc 41 ||||||||||||||||||||| Sbjct: 2195 cccatcccatcccactccacc 2215
>emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on chromosome 22q12.1, complete sequence Length = 117939 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 29307 tcccatcccatcccatcccac 29327 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 29498 tcccatcccatcccatccca 29517 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 29493 tcccatcccatcccatccca 29512 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 29488 tcccatcccatcccatccca 29507 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 29483 tcccatcccatcccatccca 29502
>gb|AC080112.15| Homo sapiens chromosome 17, clone CTD-2267D19, complete sequence Length = 175014 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 cccatcccatcccatcccact 36 ||||||||||||||||||||| Sbjct: 119260 cccatcccatcccatcccact 119280
>emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B18 on chromosome 20q13.11-13.3 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 129874 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 19769 tcccatcccatcccatcccac 19749 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 19774 tcccatcccatcccatccca 19755
>gb|AC161351.3| Mus musculus chromosome 15, clone RP24-142I15, complete sequence Length = 161308 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 56949 tccagtcccatcccatcccatccca 56925 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56939 tcccatcccatcccatccca 56920 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56934 tcccatcccatcccatccca 56915 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56929 tcccatcccatcccatccca 56910 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56924 tcccatcccatcccatccca 56905 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56919 tcccatcccatcccatccca 56900 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56914 tcccatcccatcccatccca 56895 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56909 tcccatcccatcccatccca 56890 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56904 tcccatcccatcccatccca 56885 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56899 tcccatcccatcccatccca 56880
>emb|AL626804.10| Zebrafish DNA sequence from clone RP71-1H10 in linkage group 1 Contains a novel gene similar to human CTNNA2 (catenin (cadherin-associated protein), alpha 2) and three CpG islands, complete sequence Length = 149717 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 101196 tccaatcccatcccatcccatccca 101172 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101221 tcccatcccatcccatccca 101202 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101216 tcccatcccatcccatccca 101197 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101186 tcccatcccatcccatccca 101167 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101181 tcccatcccatcccatccca 101162
>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the 3' end of the Ulk2 gene for Unc-51 like kinase 2 (C. elegans), the Prpsap2 gene for phosphoribosyl pyrophosphate synthetase-associated protein 2, the gene for a novel sodium/glucose cotransporter protein, the gene for a novel protein (2310040C09Rik), the Grap gene for GRB2-related adaptor protein and a CpG island, complete sequence Length = 186359 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 89581 tcccatcccatcccatcccac 89561 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89611 tcccatcccatcccatccca 89592 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89606 tcccatcccatcccatccca 89587 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89601 tcccatcccatcccatccca 89582 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89596 tcccatcccatcccatccca 89577 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89591 tcccatcccatcccatccca 89572 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89586 tcccatcccatcccatccca 89567
>gb|AC096539.2| Homo sapiens chromosome 1 clone RP11-150L22, complete sequence Length = 183307 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 121508 tcccatcccatcccatcccac 121488
>emb|AL627411.21| Mouse DNA sequence from clone RP23-346H6 on chromosome X, complete sequence Length = 185184 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 175112 tcccatcccatcccatcccac 175092
>gb|AC023675.4| Drosophila melanogaster 3L BAC RP98-3I22 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178338 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 ||||| ||||||||||||||||||| Sbjct: 51253 tccatacccatcccatcccatccca 51229
>tpg|BK003220.1| TPA: TPA_inf: Drosophila melanogaster HDC19720 (HDC19720) gene, complete cds Length = 3420 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3116 tcccatcccatcccatcccac 3096
>gb|AC051654.9| Homo sapiens chromosome 8, clone RP11-35O14, complete sequence Length = 176393 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 126362 tcccatcccatcccatcccac 126342 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 126322 tcccatcccatcccatcccac 126302 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126372 tcccatcccatcccatccca 126353 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126367 tcccatcccatcccatccca 126348 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126337 tcccatcccatcccatccca 126318 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126332 tcccatcccatcccatccca 126313 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126327 tcccatcccatcccatccca 126308 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126297 tcccatcccatcccatccca 126278
>gb|AC091824.3| Homo sapiens chromosome 5 clone CTC-455O22, complete sequence Length = 171962 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 52544 tcccatcccatcccatcccac 52564
>gb|AC090338.6| Homo sapiens chromosome 18, clone RP11-704C2, complete sequence Length = 200525 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 151965 ttcccatcccatcccatccca 151945 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 151959 tcccatcccatcccatccca 151940 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 151954 tcccatcccatcccatccca 151935 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 151949 tcccatcccatcccatccca 151930 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 151944 tcccatcccatcccatccca 151925 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 151939 tcccatcccatcccatccca 151920
>gb|AC010113.6| Drosophila melanogaster 3L BAC RPCI98-10H23 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 182898 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 ||||| ||||||||||||||||||| Sbjct: 169050 tccatacccatcccatcccatccca 169026
>gb|AF380138.1|AF380138 Monkeypox virus strain Zaire-96-I-16, complete genome Length = 196858 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 31773 tcccatcccatcccatcccattcca 31797 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31768 tcccatcccatcccatccca 31787
>gb|AC013526.7| Homo sapiens, clone RP11-114I24, complete sequence Length = 156895 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 6 accgtccattcccatcccatcccatccca 34 ||||||| |||||||||||||||||||| Sbjct: 143977 accgtcccatcccatcccatcccatccca 144005 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143991 tcccatcccatcccatccca 144010 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143935 tcccatcccatcccatccca 143954 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143930 tcccatcccatcccatccca 143949 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 143925 tcccatcccatcccatccca 143944
>gb|AC015617.8| Homo sapiens, clone RP11-45H23, complete sequence Length = 160541 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 93450 ttcccatcccatcccatccca 93470 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93476 tcccatcccatcccatccca 93495 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93471 tcccatcccatcccatccca 93490 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93466 tcccatcccatcccatccca 93485 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93461 tcccatcccatcccatccca 93480 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93456 tcccatcccatcccatccca 93475
>dbj|AK162669.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched library, clone:9830165N12 product:cell division cycle 6 homolog (S. cerevisiae), full insert sequence Length = 4803 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3655 tcccatcccatcccatcccac 3635 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3660 tcccatcccatcccatccca 3641
>emb|BX322540.5| Zebrafish DNA sequence from clone CH211-247B3 in linkage group 19, complete sequence Length = 156150 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 244 cttctcccccgagtggtggcg 264 ||||||||||||||||||||| Sbjct: 86962 cttctcccccgagtggtggcg 86942
>gb|AC159297.3| Mus musculus BAC clone RP23-258F9 from chromosome 12, complete sequence Length = 193434 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 148358 tcccatcccatcccatcccac 148338 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccaccag 43 |||||||||||||||||||| ||||||| Sbjct: 148363 tcccatcccatcccatcccatcccaccag 148335 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148393 tcccatcccatcccatccca 148374 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148388 tcccatcccatcccatccca 148369 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148383 tcccatcccatcccatccca 148364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148378 tcccatcccatcccatccca 148359 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148373 tcccatcccatcccatccca 148354 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 148368 tcccatcccatcccatccca 148349
>gb|AC159880.2| Mus musculus BAC clone RP24-490L14 from chromosome 9, complete sequence Length = 142451 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 55626 tcccatcccatcccatcccac 55606 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 55631 tcccatcccatcccatccca 55612 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 55601 tcccatcccatcccatccca 55582 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 55596 tcccatcccatcccatccca 55577 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 55591 tcccatcccatcccatccca 55572
>gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 195501 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 101867 tcccatcccatcccatcccattcca 101843 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101902 tcccatcccatcccatccca 101883 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101897 tcccatcccatcccatccca 101878 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101892 tcccatcccatcccatccca 101873 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101887 tcccatcccatcccatccca 101868 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101882 tcccatcccatcccatccca 101863 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101877 tcccatcccatcccatccca 101858 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101872 tcccatcccatcccatccca 101853
>gb|AC022379.2|AC022379 Homo sapiens chromosome 3 clone 996C6 map 3p, complete sequence Length = 222542 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 28984 tcccatcccatcccatcccac 29004 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 28964 tccaatcccatcccatcccatccca 28988 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 28979 tcccatcccatcccatccca 28998 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 28974 tcccatcccatcccatccca 28993
>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone BACR27L16, complete sequence Length = 182623 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 34788 tcccatcccatcccatcccac 34768
>gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, region 21D-21E, BAC clone BACR48E08, complete sequence Length = 182726 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 155353 tcccatcccatcccatcccagtcca 155329
>gb|AC138969.2| Homo sapiens chromosome 16 clone RP11-958N24, complete sequence Length = 216759 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 395 gcagagggagaggggaggaag 415 ||||||||||||||||||||| Sbjct: 191663 gcagagggagaggggaggaag 191643
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 27363530 tcccatcccatcccatcccac 27363510 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27363535 tcccatcccatcccatccca 27363516 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccc 33 |||| ||||||||||||||||||| Sbjct: 9857287 tccaatcccatcccatcccatccc 9857264 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 9590913 tcccatcccatcccatccca 9590932 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 9097791 tcccatcccatcccatccca 9097810 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1497937 tcccatcccatcccatccca 1497918
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 20928383 tcccatcccatcccatcccac 20928363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 35599381 tcccatcccatcccatccca 35599362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22539437 tcccatcccatcccatccca 22539456 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 20928388 tcccatcccatcccatccca 20928369 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 5601861 tcccatcccatcccatccca 5601880 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 5601856 tcccatcccatcccatccca 5601875
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 1106532 tcccatcccatcccatcccac 1106552 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 ggaggctgcggcgtcggcggaggt 237 |||||||||| ||||||||||||| Sbjct: 41488389 ggaggctgcgacgtcggcggaggt 41488366 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 28233337 tcccatcccatcccatccca 28233318 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 27100343 tcccatcccatcccatccca 27100362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1106527 tcccatcccatcccatccca 1106546
>gb|AC010920.11|AC010920 Drosophila melanogaster, chromosome X, region 14C-14D, BAC clone BACR47D09, complete sequence Length = 166935 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 159480 tcccatcccatcccatcccattcca 159504
>emb|AL844591.6| Mouse DNA sequence from clone RP23-414J11 on chromosome 2, complete sequence Length = 215003 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 397 agagggagaggggaggaagga 417 ||||||||||||||||||||| Sbjct: 68509 agagggagaggggaggaagga 68489
>dbj|AP006505.1| Mus musculus genomic DNA, chromosome 4, clone: RP23-266A3, complete sequence Length = 199759 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 402 gagaggggaggaaggaagaag 422 ||||||||||||||||||||| Sbjct: 11110 gagaggggaggaaggaagaag 11090
>dbj|AP006504.1| Mus musculus genomic DNA, chromosome 4, clone: RP23-100M2, complete sequence Length = 209271 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gagaggggaggaaggaagaag 422 ||||||||||||||||||||| Sbjct: 41179 gagaggggaggaaggaagaag 41199
>gb|AC008756.9| Homo sapiens chromosome 16 clone CTD-3028M10, complete sequence Length = 173527 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 397 agagggagaggggaggaaggaagaa 421 ||||||| ||||||||||||||||| Sbjct: 103792 agagggaaaggggaggaaggaagaa 103768
>gb|AC154741.3| Mus musculus BAC clone RP24-392C9 from chromosome 9, complete sequence Length = 178684 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 107598 tcccatcccatcccatcccattcca 107622 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107593 tcccatcccatcccatccca 107612 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107588 tcccatcccatcccatccca 107607 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107583 tcccatcccatcccatccca 107602 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107578 tcccatcccatcccatccca 107597 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107573 tcccatcccatcccatccca 107592 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107568 tcccatcccatcccatccca 107587 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 11 ccattcccatcccatcccatccca 34 |||| ||||||||||||||||||| Sbjct: 107559 ccatccccatcccatcccatccca 107582
>gb|AC073624.28| Homo sapiens chromosome 17, clone RP11-537K14, complete sequence Length = 145512 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 6651 tcccatcccatcccatcccac 6671
>gb|AC157660.2| Mus musculus BAC clone RP23-263I16 from chromosome 1, complete sequence Length = 192026 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 388 tcccatcccatcccatcccac 368 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 427 tcccatcccatcccatccca 408 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 393 tcccatcccatcccatccca 374 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccactcca 39 ||||||||||||||||| |||||| Sbjct: 276 cccatcccatcccatcctactcca 253
>gb|AC136624.3| Homo sapiens chromosome 16 clone RP11-517A5, complete sequence Length = 211896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 395 gcagagggagaggggaggaag 415 ||||||||||||||||||||| Sbjct: 105513 gcagagggagaggggaggaag 105493
>gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, complete sequence Length = 159722 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 24662 tcccatcccatcccatcccattcca 24638 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 24687 tcccatcccatcccatccca 24668 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 24682 tcccatcccatcccatccca 24663 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 24677 tcccatcccatcccatccca 24658 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 24672 tcccatcccatcccatccca 24653 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 24667 tcccatcccatcccatccca 24648
>gb|AC026408.6| Homo sapiens chromosome 5 clone CTC-424O20, complete sequence Length = 72675 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 59726 tcccatcccatcccatcccac 59746
>gb|AC097468.3| Homo sapiens BAC clone RP11-33O4 from 2, complete sequence Length = 169741 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 ||||||||||||||| ||||||||| Sbjct: 89413 tcccatcccatcccaccccactcca 89389 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 17 ccatcccatcccatcccactccacc 41 ||||||||||||||||||| ||||| Sbjct: 89391 ccatcccatcccatcccaccccacc 89367 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 89278 tcccatcccatcccatcccattcca 89254 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 17 ccatcccatcccatcccactccac 40 ||||||||||||||||||| |||| Sbjct: 89416 ccatcccatcccatcccaccccac 89393 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89293 tcccatcccatcccatccca 89274 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89288 tcccatcccatcccatccca 89269 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 89283 tcccatcccatcccatccca 89264
>gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D1416) genomic sequence Length = 38050 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 24922 tcccatcccatcccatcccattcca 24898
>gb|AC130465.2| Homo sapiens chromosome 16 clone CTA-962B4, complete sequence Length = 173911 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 395 gcagagggagaggggaggaag 415 ||||||||||||||||||||| Sbjct: 78017 gcagagggagaggggaggaag 78037
>gb|AC154502.2| Mus musculus BAC clone RP24-87I20 from chromosome 13, complete sequence Length = 183319 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 403 agaggggaggaaggaagaagc 423 ||||||||||||||||||||| Sbjct: 59112 agaggggaggaaggaagaagc 59092
>dbj|AP002541.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0494A10 Length = 145576 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 144200 tcccatcccatcccatcccac 144220 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 144195 tcccatcccatcccatccca 144214
>dbj|AP002868.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698A04 Length = 141079 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 75846 tcccatcccatcccatcccac 75866 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 75841 tcccatcccatcccatccca 75860
>dbj|AP003635.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0686E06 Length = 150474 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 106357 tcccatcccatcccatcccac 106337 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 106362 tcccatcccatcccatccca 106343
>dbj|BS000130.1| Pan troglodytes chromosome 22 clone:CH251-010A09, map 22, complete sequences Length = 201997 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 256 tcccatcccatcccatcccac 276
>emb|AL844869.5| Mouse DNA sequence from clone RP23-437K18 on chromosome X, complete sequence Length = 207432 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 11 ccattcccatcccatcccatcccactccaccag 43 |||| |||||||||||||| ||||| ||||||| Sbjct: 131356 ccatccccatcccatcccaccccaccccaccag 131324
>emb|X89248.1|GGRNAAMH G.gallus mRNA for anti-mullerian hormone Length = 4200 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 1406 ttcccatcccatcccatccca 1426 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1432 tcccatcccatcccatccca 1451 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1427 tcccatcccatcccatccca 1446 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1422 tcccatcccatcccatccca 1441 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1417 tcccatcccatcccatccca 1436 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1412 tcccatcccatcccatccca 1431
>emb|X77575.1|HVES43 H.vulgare (Dbg576) ES43 mRNA Length = 1058 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 11 ccattcccatcccatcccatcccac 35 |||| |||||||||||||||||||| Sbjct: 17 ccatccccatcccatcccatcccac 41
>gb|U91318.1|HUU91318 Human chromosome 16 BAC clone CIT987SK-A-962B4, complete sequence Length = 172984 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 395 gcagagggagaggggaggaag 415 ||||||||||||||||||||| Sbjct: 77089 gcagagggagaggggaggaag 77109
>gb|AY937239.1| Chlamydomonas incerta plus agglutinin (SAG1) gene, partial cds Length = 13081 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 13 attcccatcccatcccatcccactccacc 41 |||||||||||| |||||||||| ||||| Sbjct: 9678 attcccatcccaccccatcccaccccacc 9706
>gb|AC140346.4| Mus musculus BAC clone RP24-260I8 from 16, complete sequence Length = 185587 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 17 ccatcccatcccatcccactccacc 41 ||||||||||||||||||| ||||| Sbjct: 51870 ccatcccatcccatcccaccccacc 51846 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 51606 tcccatcccatcccatcccac 51586 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 51956 tcccatcccatcccatccca 51937 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccac 35 |||||||||||||||||||| Sbjct: 51906 cccatcccatcccatcccac 51887 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 51616 tcccatcccatcccatccca 51597 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 51611 tcccatcccatcccatccca 51592
>gb|AY108761.1| Zea mays PCO105606 mRNA sequence Length = 815 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 234 aggtcgaggacttctcccccgagtggtgg 262 |||| ||||||||||| |||||||||||| Sbjct: 244 aggtggaggacttctcgcccgagtggtgg 272
>gb|AF175270.1|AF175270 Benincasa hispida osmotin-like protein (olp) gene, complete cds Length = 1501 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 400 gggagaggggaggaaggaagaagccgccg 428 ||||||||| ||| ||||||||||||||| Sbjct: 628 gggagagggaagggaggaagaagccgccg 600
>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete sequence Length = 306076 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 196114 tcccatcccatcccatcccagtcca 196138
>gb|AE003558.3| Drosophila melanogaster chromosome 3L, section 27 of 83 of the complete sequence Length = 284442 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 ||||| ||||||||||||||||||| Sbjct: 155982 tccatacccatcccatcccatccca 155958
>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete sequence Length = 346474 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 79034 tcccatcccatcccatcccac 79014
>gb|AE003502.4| Drosophila melanogaster chromosome X, section 54 of 74 of the complete sequence Length = 304712 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 178762 tcccatcccatcccatcccattcca 178786
>dbj|AP001743.1| Homo sapiens genomic DNA, chromosome 21q, section 87/105 Length = 219256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 192 tcccatcccatcccatcccac 212
>gb|AC093467.10| Mus musculus chromosome 12, clone RP23-9A4, complete sequence Length = 236969 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 3322 tcccatcccatcccatcccac 3302 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccaccag 43 |||||||||||||||||||| ||||||| Sbjct: 3327 tcccatcccatcccatcccatcccaccag 3299 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3357 tcccatcccatcccatccca 3338 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3352 tcccatcccatcccatccca 3333 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3347 tcccatcccatcccatccca 3328 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3342 tcccatcccatcccatccca 3323 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3337 tcccatcccatcccatccca 3318 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3332 tcccatcccatcccatccca 3313
>gb|AC117808.8| Mus musculus chromosome 1, clone RP24-570C24, complete sequence Length = 189713 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 176452 tcccatcccatcccatcccac 176432 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 176477 tcccatcccatcccatccca 176458 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 176472 tcccatcccatcccatccca 176453 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 176467 tcccatcccatcccatccca 176448 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 176462 tcccatcccatcccatccca 176443 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 176457 tcccatcccatcccatccca 176438
>gb|AC161468.2| Gallus gallus BAC clone CH261-94J19 from chromosome unknown, complete sequence Length = 238361 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 175849 tcccatcccatcccatcccac 175869 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 17 ccatcccatcccatcccactccacc 41 ||||||||||||||||||| ||||| Sbjct: 175724 ccatcccatcccatcccaccccacc 175748 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 175654 tcccatcccatcccatcccac 175674 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 175605 tcccatcccatcccatcccac 175625 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 139186 tcccatcccatcccatcccac 139166 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175844 tcccatcccatcccatccca 175863 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175839 tcccatcccatcccatccca 175858 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175834 tcccatcccatcccatccca 175853 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175829 tcccatcccatcccatccca 175848 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175781 tcccatcccatcccatccca 175800 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175776 tcccatcccatcccatccca 175795 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175771 tcccatcccatcccatccca 175790 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175684 tcccatcccatcccatccca 175703 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175679 tcccatcccatcccatccca 175698 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139226 tcccatcccatcccatccca 139207 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139221 tcccatcccatcccatccca 139202 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139216 tcccatcccatcccatccca 139197 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139211 tcccatcccatcccatccca 139192 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139206 tcccatcccatcccatccca 139187 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139201 tcccatcccatcccatccca 139182 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139196 tcccatcccatcccatccca 139177 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139191 tcccatcccatcccatccca 139172 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139027 tcccatcccatcccatccca 139008
>gb|AC164569.3| Gallus gallus BAC clone CH261-138K23 from chromosome unknown, complete sequence Length = 248284 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 214625 tcccatcccatcccatcccac 214605 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 214576 tcccatcccatcccatcccac 214556 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 17 ccatcccatcccatcccactccacc 41 ||||||||||||||||||| ||||| Sbjct: 214506 ccatcccatcccatcccaccccacc 214482 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 214381 tcccatcccatcccatcccac 214361 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214551 tcccatcccatcccatccca 214532 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214546 tcccatcccatcccatccca 214527 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214459 tcccatcccatcccatccca 214440 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214454 tcccatcccatcccatccca 214435 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214449 tcccatcccatcccatccca 214430 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214401 tcccatcccatcccatccca 214382 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214396 tcccatcccatcccatccca 214377 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214391 tcccatcccatcccatccca 214372 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 214386 tcccatcccatcccatccca 214367
>dbj|AP003354.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1507C5 Length = 148405 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 85878 tcccatcccatcccatcccac 85898 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 85838 tcccatcccatcccatcccac 85858 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85903 tcccatcccatcccatccca 85922 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85873 tcccatcccatcccatccca 85892 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85868 tcccatcccatcccatccca 85887 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85863 tcccatcccatcccatccca 85882 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85833 tcccatcccatcccatccca 85852 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 85828 tcccatcccatcccatccca 85847
>gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s DS00764 (D273) and DS00501 (D274)), complete sequence Length = 104278 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcca 39 |||||||||||||||||||| |||| Sbjct: 65483 tcccatcccatcccatcccagtcca 65507
>gb|AC148982.4| Mus musculus BAC clone RP23-174I22 from 1, complete sequence Length = 195580 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 165400 tcccatcccatcccatcccac 165380 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 165439 tcccatcccatcccatccca 165420 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 165405 tcccatcccatcccatccca 165386 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccactcca 39 ||||||||||||||||| |||||| Sbjct: 165288 cccatcccatcccatcctactcca 165265
>gb|AC131774.4| Mus musculus BAC clone RP24-311P6 from 12, complete sequence Length = 150645 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 63748 tcccatcccatcccatcccac 63728 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccactccaccag 43 |||||||||||||||||||| ||||||| Sbjct: 63753 tcccatcccatcccatcccatcccaccag 63725 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63783 tcccatcccatcccatccca 63764 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63778 tcccatcccatcccatccca 63759 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63773 tcccatcccatcccatccca 63754 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63768 tcccatcccatcccatccca 63749 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63763 tcccatcccatcccatccca 63744 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63758 tcccatcccatcccatccca 63739
>emb|AL591067.35| Mouse DNA sequence from clone RP23-333D2 on chromosome 11, complete sequence Length = 196512 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 66216 tcccatcccatcccatcccac 66196 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 66221 tcccatcccatcccatccca 66202
>emb|AL163217.2|HS21C017 Homo sapiens chromosome 21 segment HS21C017 Length = 340000 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 269506 ttcccatcccatcccatccca 269526 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269637 tcccatcccatcccatccca 269656 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269632 tcccatcccatcccatccca 269651 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269627 tcccatcccatcccatccca 269646 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269622 tcccatcccatcccatccca 269641 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269617 tcccatcccatcccatccca 269636 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269612 tcccatcccatcccatccca 269631 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269607 tcccatcccatcccatccca 269626 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269602 tcccatcccatcccatccca 269621 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269597 tcccatcccatcccatccca 269616 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269592 tcccatcccatcccatccca 269611 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269547 tcccatcccatcccatccca 269566 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269542 tcccatcccatcccatccca 269561 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269537 tcccatcccatcccatccca 269556 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269532 tcccatcccatcccatccca 269551 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269527 tcccatcccatcccatccca 269546 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269522 tcccatcccatcccatccca 269541 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269517 tcccatcccatcccatccca 269536 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 269512 tcccatcccatcccatccca 269531
>emb|CT025619.9| Mouse DNA sequence from clone RP23-442M18 on chromosome 9, complete sequence Length = 193329 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 80207 tcccatcccatcccatcccac 80187 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 80212 tcccatcccatcccatccca 80193 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 80182 tcccatcccatcccatccca 80163 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 80177 tcccatcccatcccatccca 80158 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 80172 tcccatcccatcccatccca 80153
>emb|CT010462.5| Mouse DNA sequence from clone RP23-321N21 on chromosome 12, complete sequence Length = 204912 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 112983 tcccatcccatcccatcccac 113003 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112978 tcccatcccatcccatccca 112997 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112973 tcccatcccatcccatccca 112992 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112968 tcccatcccatcccatccca 112987 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112963 tcccatcccatcccatccca 112982 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112958 tcccatcccatcccatccca 112977
>gb|AC024910.5| Homo sapiens chromosome 3 clone RP11-380A22 map 3p, complete sequence Length = 207606 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 50974 tcccatcccatcccatcccac 50994 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 50954 tccaatcccatcccatcccatccca 50978 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 50969 tcccatcccatcccatccca 50988 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 50964 tcccatcccatcccatccca 50983
>gb|AC102227.17| Mus musculus chromosome 1, clone RP24-62C22, complete sequence Length = 201757 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 14629 tcccatcccatcccatcccac 14649 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14624 tcccatcccatcccatccca 14643 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14619 tcccatcccatcccatccca 14638 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14614 tcccatcccatcccatccca 14633 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14609 tcccatcccatcccatccca 14628 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14604 tcccatcccatcccatccca 14623 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14599 tcccatcccatcccatccca 14618 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14594 tcccatcccatcccatccca 14613
>emb|AL669980.9| Mouse DNA sequence from clone RP23-218C2 on chromosome 4, complete sequence Length = 157624 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 cccatcccatcccatcccact 36 ||||||||||||||||||||| Sbjct: 130315 cccatcccatcccatcccact 130295
>emb|AL078474.2|HSH2137 Homo sapiens chromosome 21 PAC RPCIP704H2137, complete sequence Length = 131184 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 14 ttcccatcccatcccatccca 34 ||||||||||||||||||||| Sbjct: 18775 ttcccatcccatcccatccca 18755 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18769 tcccatcccatcccatccca 18750 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18764 tcccatcccatcccatccca 18745 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18759 tcccatcccatcccatccca 18740 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18754 tcccatcccatcccatccca 18735 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18749 tcccatcccatcccatccca 18730 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18744 tcccatcccatcccatccca 18725 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18739 tcccatcccatcccatccca 18720 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18734 tcccatcccatcccatccca 18715 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18689 tcccatcccatcccatccca 18670 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18684 tcccatcccatcccatccca 18665 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18679 tcccatcccatcccatccca 18660 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18674 tcccatcccatcccatccca 18655 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18669 tcccatcccatcccatccca 18650 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18664 tcccatcccatcccatccca 18645 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18659 tcccatcccatcccatccca 18640 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18654 tcccatcccatcccatccca 18635 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18649 tcccatcccatcccatccca 18630 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 18644 tcccatcccatcccatccca 18625
>emb|AL805912.5| Mouse DNA sequence from clone RP23-425K3 on chromosome 4, complete sequence Length = 151967 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 41602 tcccatcccatcccatcccac 41622 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41597 tcccatcccatcccatccca 41616 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41592 tcccatcccatcccatccca 41611 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41587 tcccatcccatcccatccca 41606 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41582 tcccatcccatcccatccca 41601
>emb|AL606933.4| Mouse DNA sequence from clone RP23-168M5 on chromosome 4, complete sequence Length = 197552 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 129152 tcccatcccatcccatcccac 129132 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 129157 tcccatcccatcccatccca 129138
>gb|AC066580.4| Homo sapiens chromosome 3 clone RP11-109J15 map 3p, complete sequence Length = 149252 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccca 34 |||| |||||||||||||||||||| Sbjct: 56258 tccaatcccatcccatcccatccca 56234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 56238 tcccatcccatcccatcccac 56218 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56248 tcccatcccatcccatccca 56229 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 56243 tcccatcccatcccatccca 56224
>dbj|AP001612.1| Homo sapiens genomic DNA, chromosome 21, clone:c102B1011, MX1-D21S171 region, complete sequence Length = 1971 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 192 tcccatcccatcccatcccac 212
>emb|AL731655.8| Mouse DNA sequence from clone RP23-249G3 on chromosome 4, complete sequence Length = 126753 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gagaggggaggaaggaagaag 422 ||||||||||||||||||||| Sbjct: 106304 gagaggggaggaaggaagaag 106324
>dbj|AP005211.2| Homo sapiens genomic DNA, chromosome 18, clone:RP11-267C19, complete sequence Length = 156794 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccac 35 ||||||||||||||||||||| Sbjct: 139238 tcccatcccatcccatcccac 139258 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 139233 tcccatcccatcccatccca 139252
>gb|AY830604.1| Urosticte benjamani adenylate kinase (AK1) gene, intron 5 and partial cds Length = 525 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 114 tcccatcccatcccatccca 133 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 109 tcccatcccatcccatccca 128 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 104 tcccatcccatcccatccca 123 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99 tcccatcccatcccatccca 118 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 94 tcccatcccatcccatccca 113
>gb|AY830567.1| Heliodoxa leadbeateri adenylate kinase (AK1) gene, intron 5 and partial cds Length = 552 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 117 tcccatcccatcccatccca 136
>gb|AY830555.1| Eriocnemis luciani adenylate kinase (AK1) gene, intron 5 and partial cds Length = 517 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82 tcccatcccatcccatccca 101
>gb|AY830554.1| Ensifera ensifera adenylate kinase (AK1) gene, intron 5 and partial cds Length = 510 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 75 tcccatcccatcccatccca 94
>gb|AY830535.1| Aglaeactis cupripennis adenylate kinase (AK1) gene, intron 5 and partial cds Length = 543 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 108 tcccatcccatcccatccca 127 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 103 tcccatcccatcccatccca 122 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 98 tcccatcccatcccatccca 117 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 93 tcccatcccatcccatccca 112 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 88 tcccatcccatcccatccca 107 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 83 tcccatcccatcccatccca 102
>gb|AY830534.1| Aglaeactis castelnaudii adenylate kinase (AK1) gene, intron 5 and partial cds Length = 561 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 126 tcccatcccatcccatccca 145 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 121 tcccatcccatcccatccca 140 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 116 tcccatcccatcccatccca 135 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 111 tcccatcccatcccatccca 130 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 106 tcccatcccatcccatccca 125 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101 tcccatcccatcccatccca 120 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 96 tcccatcccatcccatccca 115 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 91 tcccatcccatcccatccca 110 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 86 tcccatcccatcccatccca 105 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 81 tcccatcccatcccatccca 100
>gb|AC133860.5| Oryza sativa chromosome 3 BAC OSJNBa0091E13 genomic sequence, complete sequence Length = 157397 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 121738 tcccatcccatcccatccca 121719
>gb|AY693425.1| Drosophila pseudoobscura isolate BP_159_160_C distal Arrowhead inversion breakpoint region Length = 20941 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 16342 tcccatcccatcccatccca 16323 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 16337 tcccatcccatcccatccca 16318
>gb|AC102696.6| Mus musculus chromosome 7, clone RP24-112I14, complete sequence Length = 155408 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 agggagaggggaggaaggaa 418 |||||||||||||||||||| Sbjct: 4115 agggagaggggaggaaggaa 4096
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17475 tcccatcccatcccatccca 17456 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17470 tcccatcccatcccatccca 17451 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17465 tcccatcccatcccatccca 17446 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17460 tcccatcccatcccatccca 17441 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17455 tcccatcccatcccatccca 17436 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17450 tcccatcccatcccatccca 17431
>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence Length = 181052 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 2197 tcccatcccatcccatccca 2216
>gb|AC107774.8| Mus musculus chromosome 5, clone RP23-99A9, complete sequence Length = 227044 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82078 tcccatcccatcccatccca 82059 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82073 tcccatcccatcccatccca 82054 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82068 tcccatcccatcccatccca 82049 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82063 tcccatcccatcccatccca 82044 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82058 tcccatcccatcccatccca 82039 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82053 tcccatcccatcccatccca 82034 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82048 tcccatcccatcccatccca 82029 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82043 tcccatcccatcccatccca 82024 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82038 tcccatcccatcccatccca 82019 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82033 tcccatcccatcccatccca 82014 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 82028 tcccatcccatcccatccca 82009
>gb|BC053093.1| Mus musculus zinc finger protein 324, mRNA (cDNA clone MGC:62482 IMAGE:6400158), complete cds Length = 4316 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3190 tcccatcccatcccatccca 3209
>ref|NM_185480.1| Oryza sativa (japonica cultivar-group), Ozsa8577 predicted mRNA Length = 2811 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1238 tcccatcccatcccatccca 1257
>gb|AC107704.8| Mus musculus chromosome 7, clone RP24-121L4, complete sequence Length = 194458 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 191693 tcccatcccatcccatccca 191712
>gb|AC163675.4| Mus musculus BAC clone RP23-9G21 from chromosome 6, complete sequence Length = 243690 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 129074 tcccatcccatcccatccca 129055 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 129069 tcccatcccatcccatccca 129050 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 129064 tcccatcccatcccatccca 129045 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 129059 tcccatcccatcccatccca 129040
>gb|AC160982.5| Mus musculus BAC clone RP23-351J19 from chromosome 12, complete sequence Length = 231693 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125099 tcccatcccatcccatccca 125118 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125094 tcccatcccatcccatccca 125113 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125089 tcccatcccatcccatccca 125108 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125084 tcccatcccatcccatccca 125103 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125079 tcccatcccatcccatccca 125098 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125074 tcccatcccatcccatccca 125093 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125069 tcccatcccatcccatccca 125088 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125064 tcccatcccatcccatccca 125083 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 125059 tcccatcccatcccatccca 125078 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122804 tcccatcccatcccatccca 122823 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122799 tcccatcccatcccatccca 122818 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122794 tcccatcccatcccatccca 122813 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122789 tcccatcccatcccatccca 122808 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122784 tcccatcccatcccatccca 122803 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122779 tcccatcccatcccatccca 122798 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122774 tcccatcccatcccatccca 122793 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122769 tcccatcccatcccatccca 122788 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122764 tcccatcccatcccatccca 122783 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122759 tcccatcccatcccatccca 122778 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122754 tcccatcccatcccatccca 122773 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 122749 tcccatcccatcccatccca 122768
>gb|DQ215933.1| Taeniopygia guttata clone 0061P0023B05 RIKEN cDNA C630035N08 contaminent complex 2-like mRNA, complete sequence Length = 1501 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 20 tcccatcccatcccactccaccag 43 ||||||||||||||||||| |||| Sbjct: 102 tcccatcccatcccactcctccag 125
>gb|DQ214231.1| Taeniopygia guttata clone 0058P0053G01 mRNA sequence Length = 1190 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 758 tcccatcccatcccatccca 739
>gb|DQ214230.1| Taeniopygia guttata clone 0058P0032G03 mRNA sequence Length = 1190 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 758 tcccatcccatcccatccca 739
>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence Length = 216652 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25660 tcccatcccatcccatccca 25641 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25655 tcccatcccatcccatccca 25636 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25650 tcccatcccatcccatccca 25631 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25645 tcccatcccatcccatccca 25626 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25640 tcccatcccatcccatccca 25621 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 25635 tcccatcccatcccatccca 25616
>ref|NM_192083.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1455 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 80 tcccatcccatcccatccca 61
>ref|NM_002199.2| Homo sapiens interferon regulatory factor 2 (IRF2), mRNA Length = 2223 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1756 tcccatcccatcccatccca 1775 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1751 tcccatcccatcccatccca 1770 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1746 tcccatcccatcccatccca 1765 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1741 tcccatcccatcccatccca 1760
>gb|AC163264.3| Rhinolophus ferrumequinum clone VMRC7-385N19, complete sequence Length = 135924 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 401 ggagaggggaggaaggaaga 420 |||||||||||||||||||| Sbjct: 12447 ggagaggggaggaaggaaga 12466
>gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, complete sequence Length = 164313 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 114171 tcccatcccatcccatccca 114190
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence Length = 384518 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 231409 tcccatcccatcccatccca 231390
>gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0017M13, complete sequence Length = 161902 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101072 tcccatcccatcccatccca 101091 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 101067 tcccatcccatcccatccca 101086
>ref|NM_178732.3| Mus musculus zinc finger protein 324 (Zfp324), mRNA Length = 4316 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3190 tcccatcccatcccatccca 3209
>gb|AC158579.7| Mus musculus chromosome 7, clone RP24-180F12, complete sequence Length = 179049 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87620 tcccatcccatcccatccca 87639 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87615 tcccatcccatcccatccca 87634 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87610 tcccatcccatcccatccca 87629 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87605 tcccatcccatcccatccca 87624 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87600 tcccatcccatcccatccca 87619 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87595 tcccatcccatcccatccca 87614 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 87590 tcccatcccatcccatccca 87609
>gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, complete sequence Length = 208876 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 14179 tcccatcccatcccatccca 14160
>gb|AC138000.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0024M06, complete sequence Length = 51144 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 ggctgcggcgtcggcggagg 236 |||||||||||||||||||| Sbjct: 9099 ggctgcggcgtcggcggagg 9080
>gb|AC135459.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0004P24, complete sequence Length = 137721 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 ggctgcggcgtcggcggagg 236 |||||||||||||||||||| Sbjct: 109787 ggctgcggcgtcggcggagg 109768
>gb|AC167959.2| Mus musculus chromosome 1, clone wi1-870H21, complete sequence Length = 40520 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31812 tcccatcccatcccatccca 31831 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31807 tcccatcccatcccatccca 31826 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31802 tcccatcccatcccatccca 31821 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31797 tcccatcccatcccatccca 31816 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31792 tcccatcccatcccatccca 31811 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31787 tcccatcccatcccatccca 31806 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31782 tcccatcccatcccatccca 31801 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31777 tcccatcccatcccatccca 31796 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31772 tcccatcccatcccatccca 31791 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31747 tcccatcccatcccatccca 31766 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31742 tcccatcccatcccatccca 31761 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31737 tcccatcccatcccatccca 31756 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31732 tcccatcccatcccatccca 31751 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31727 tcccatcccatcccatccca 31746 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31722 tcccatcccatcccatccca 31741 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31717 tcccatcccatcccatccca 31736 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31712 tcccatcccatcccatccca 31731 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31707 tcccatcccatcccatccca 31726 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31702 tcccatcccatcccatccca 31721 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31697 tcccatcccatcccatccca 31716 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31692 tcccatcccatcccatccca 31711 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31687 tcccatcccatcccatccca 31706 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31642 tcccatcccatcccatccca 31661 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31617 tcccatcccatcccatccca 31636 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31612 tcccatcccatcccatccca 31631 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31607 tcccatcccatcccatccca 31626 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 31582 tcccatcccatcccatccca 31601
>gb|AC113113.18| Mus musculus chromosome 16, clone RP23-334P10, complete sequence Length = 216380 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41533 tcccatcccatcccatccca 41514 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41528 tcccatcccatcccatccca 41509 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41523 tcccatcccatcccatccca 41504 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 41518 tcccatcccatcccatccca 41499
>gb|AC151667.1| Pan troglodytes chromosome X clone RP43-007H19 map human ortholog q28, complete sequence Length = 200796 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90413 tcccatcccatcccatccca 90432 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90224 tcccatcccatcccatccca 90243 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90219 tcccatcccatcccatccca 90238 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90214 tcccatcccatcccatccca 90233 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90209 tcccatcccatcccatccca 90228 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90146 tcccatcccatcccatccca 90165
>gb|AC153152.4| Mus musculus BAC clone RP23-78F1 from chromosome 12, complete sequence Length = 184523 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 61052 tcccatcccatcccatccca 61033 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 61047 tcccatcccatcccatccca 61028 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 61042 tcccatcccatcccatccca 61023 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 61037 tcccatcccatcccatccca 61018 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 61032 tcccatcccatcccatccca 61013
>gb|AC159313.3| Mus musculus BAC clone RP23-99D11 from chromosome 9, complete sequence Length = 228299 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 gagaggggaggaaggaagaa 421 |||||||||||||||||||| Sbjct: 131114 gagaggggaggaaggaagaa 131133
>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete sequence Length = 157144 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 399 agggagaggggaggaaggaagaag 422 ||||||| |||||||||||||||| Sbjct: 74045 agggagaagggaggaaggaagaag 74022
>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence Length = 238433 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 gggagaggggaggaaggaag 419 |||||||||||||||||||| Sbjct: 176111 gggagaggggaggaaggaag 176092
>gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, complete sequence Length = 172490 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tcccatcccatcccatcccactcc 38 ||||| |||||||||||||||||| Sbjct: 101926 tcccaccccatcccatcccactcc 101949
>gb|AC114908.9| Mus musculus chromosome 3, clone RP24-173L8, complete sequence Length = 145363 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 91029 tcccatcccatcccatccca 91010 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90995 tcccatcccatcccatccca 90976 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90990 tcccatcccatcccatccca 90971 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90985 tcccatcccatcccatccca 90966 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90980 tcccatcccatcccatccca 90961 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90975 tcccatcccatcccatccca 90956 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90970 tcccatcccatcccatccca 90951 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90965 tcccatcccatcccatccca 90946 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90881 tcccatcccatcccatccca 90862 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90876 tcccatcccatcccatccca 90857 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90871 tcccatcccatcccatccca 90852 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90866 tcccatcccatcccatccca 90847 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 90861 tcccatcccatcccatccca 90842
>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence Length = 195159 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 174108 tcccatcccatcccatccca 174127
>gb|AC093198.3| Drosophila melanogaster clone BACR03G24, complete sequence Length = 182901 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 174105 tcccatcccatcccatccca 174124
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 132473 tcccatcccatcccatccca 132454 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 132468 tcccatcccatcccatccca 132449
>gb|AC009847.9| Drosophila melanogaster clone BACR03L10, complete sequence Length = 180498 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 159249 tcccatcccatcccatccca 159268 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 159244 tcccatcccatcccatccca 159263 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 159239 tcccatcccatcccatccca 159258
>gb|AC099009.2| Drosophila melanogaster clone BACR17M11, complete sequence Length = 188872 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 18 catcccatcccatcccactc 37 |||||||||||||||||||| Sbjct: 63119 catcccatcccatcccactc 63100
>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence Length = 185670 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 tccattcccatcccatcccatccc 33 ||||||||||||||||| |||||| Sbjct: 73495 tccattcccatcccatcgcatccc 73472
>gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, complete sequence Length = 220762 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 196564 tcccatcccatcccatccca 196583 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 196559 tcccatcccatcccatccca 196578
>gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP21-430D6 complete sequence Length = 221860 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 157729 tcccatcccatcccatccca 157710
>gb|AC008334.8| Drosophila melanogaster clone BACR08K05, complete sequence Length = 154336 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 21163 tcccatcccatcccatccca 21144
>gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete sequence Length = 181142 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 10 tccattcccatcccatcccatccc 33 ||||||||||||||||| |||||| Sbjct: 22326 tccattcccatcccatcgcatccc 22349
>gb|AC093440.2| Drosophila melanogaster clone BACR34H03, complete sequence Length = 192132 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 38623 tcccatcccatcccatccca 38642
>gb|AC010707.17| Drosophila melanogaster clone BACR06P10, complete sequence Length = 176969 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17875 tcccatcccatcccatccca 17856 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 17870 tcccatcccatcccatccca 17851
>gb|AC006402.12| Drosophila melanogaster clone BACR08D17, complete sequence Length = 174735 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 112815 tcccatcccatcccatccca 112834
>gb|AC150482.2| Bos taurus BAC CH240-308E11 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 179880 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 401 ggagaggggaggaaggaagaagcc 424 |||||||||||||||| ||||||| Sbjct: 90711 ggagaggggaggaagggagaagcc 90734
>gb|AC109601.9| Oryza sativa chromosome 3 BAC OSJNBa0004G03 genomic sequence, complete sequence Length = 145590 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 141655 tcccatcccatcccatccca 141674
>gb|AC135672.4| Mus musculus BAC clone RP23-449K22 from chromosome 9, complete sequence Length = 162356 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 cagagggagaggggaggaag 415 |||||||||||||||||||| Sbjct: 157903 cagagggagaggggaggaag 157922
>gb|AC137680.10| Mus musculus chromosome 13, clone RP23-454P19, complete sequence Length = 197663 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 397 agagggagaggggaggaaggaaga 420 |||||||||||| ||||||||||| Sbjct: 58386 agagggagagggaaggaaggaaga 58409
>gb|AC185247.2| Pan troglodytes BAC clone CH251-7D5 from chromosome 15, complete sequence Length = 175295 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 aggcaaccatggaggtggtg 136 |||||||||||||||||||| Sbjct: 24418 aggcaaccatggaggtggtg 24437
>gb|BC015803.2| Homo sapiens interferon regulatory factor 2, mRNA (cDNA clone MGC:9260 IMAGE:3920890), complete cds Length = 2088 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1580 tcccatcccatcccatccca 1599 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1575 tcccatcccatcccatccca 1594 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1570 tcccatcccatcccatccca 1589
>gb|AC139023.14| Mus musculus chromosome 1, clone RP23-430G15, complete sequence Length = 207067 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97424 tcccatcccatcccatccca 97405 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97419 tcccatcccatcccatccca 97400 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97414 tcccatcccatcccatccca 97395 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97409 tcccatcccatcccatccca 97390 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97404 tcccatcccatcccatccca 97385 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97399 tcccatcccatcccatccca 97380 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97394 tcccatcccatcccatccca 97375
>gb|AC144612.3| Homo sapiens BAC clone RP11-8N20 from UL, complete sequence Length = 66486 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 aggcaaccatggaggtggtg 136 |||||||||||||||||||| Sbjct: 12572 aggcaaccatggaggtggtg 12553
>gb|AC093953.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone OJ1057_C01, complete sequence Length = 142752 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 97142 tcccatcccatcccatccca 97161
>gb|AC131719.5| Mus musculus BAC clone RP23-151H15 from chromosome 19, complete sequence Length = 216902 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 agagggagaggggaggaagg 416 |||||||||||||||||||| Sbjct: 26006 agagggagaggggaggaagg 26025
>gb|AC133090.4| Mus musculus BAC clone RP24-194H23 from chromosome 15, complete sequence Length = 148555 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107839 tcccatcccatcccatccca 107820 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107834 tcccatcccatcccatccca 107815 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107829 tcccatcccatcccatccca 107810 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107824 tcccatcccatcccatccca 107805 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107819 tcccatcccatcccatccca 107800 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107814 tcccatcccatcccatccca 107795 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107809 tcccatcccatcccatccca 107790 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107804 tcccatcccatcccatccca 107785 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107799 tcccatcccatcccatccca 107780 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107794 tcccatcccatcccatccca 107775 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 107789 tcccatcccatcccatccca 107770
>gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome 18, complete sequence Length = 156356 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 100019 tcccatcccatcccatccca 100000
>gb|AC183293.4| Pan troglodytes BAC clone CH251-444I20 from chromosome 17, complete sequence Length = 154257 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 aggcaaccatggaggtggtg 136 |||||||||||||||||||| Sbjct: 142138 aggcaaccatggaggtggtg 142157
>gb|AC158947.4| Mus musculus chromosome 7, clone RP23-230A4, complete sequence Length = 191195 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124158 tcccatcccatcccatccca 124139 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124153 tcccatcccatcccatccca 124134 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124148 tcccatcccatcccatccca 124129 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124143 tcccatcccatcccatccca 124124 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124138 tcccatcccatcccatccca 124119 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124133 tcccatcccatcccatccca 124114 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 124128 tcccatcccatcccatccca 124109 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 399 agggagaggggaggaaggaa 418 |||||||||||||||||||| Sbjct: 15303 agggagaggggaggaaggaa 15322
>gb|AC104542.10| Mus musculus chromosome 1, clone RP23-165D11, complete sequence Length = 211537 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62105 tcccatcccatcccatccca 62086 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62100 tcccatcccatcccatccca 62081 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62095 tcccatcccatcccatccca 62076 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62090 tcccatcccatcccatccca 62071 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62085 tcccatcccatcccatccca 62066 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62080 tcccatcccatcccatccca 62061 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 62075 tcccatcccatcccatccca 62056
>gb|AC118610.9| Mus musculus chromosome 6, clone RP23-178I17, complete sequence Length = 255673 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113386 tcccatcccatcccatccca 113367 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113381 tcccatcccatcccatccca 113362 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113376 tcccatcccatcccatccca 113357 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113371 tcccatcccatcccatccca 113352 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113366 tcccatcccatcccatccca 113347 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113361 tcccatcccatcccatccca 113342 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 113356 tcccatcccatcccatccca 113337
>gb|AC168270.1| Mus musculus BAC clone RP23-173C15 from chromosome 3, complete sequence Length = 216449 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 131352 tcccatcccatcccatccca 131371 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 131347 tcccatcccatcccatccca 131366
>gb|AC121546.13| Mus musculus chromosome 6, clone RP24-537N12, complete sequence Length = 207556 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 67214 tcccatcccatcccatccca 67233 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 67209 tcccatcccatcccatccca 67228 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 67204 tcccatcccatcccatccca 67223
>gb|AC121301.8| Mus musculus chromosome 7, clone RP23-432H1, complete sequence Length = 205639 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 48253 tcccatcccatcccatccca 48272
>gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome 10, complete sequence Length = 180573 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 123924 tcccatcccatcccatccca 123905 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 123919 tcccatcccatcccatccca 123900
>gb|AC149630.3| Rhinolophus ferrumequinum clone VMRC7-251C10, complete sequence Length = 163389 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133771 tcccatcccatcccatccca 133752 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 133738 tcccatcccatcccatccca 133719
>gb|S35965.1| Mus musculus S alpha immunoglobulin switch region gene, complete sequence Length = 1401 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 551 tcccatcccatcccatccca 532 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 546 tcccatcccatcccatccca 527 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 541 tcccatcccatcccatccca 522 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 536 tcccatcccatcccatccca 517 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 531 tcccatcccatcccatccca 512
>gb|AC145616.2| Homo sapiens BAC clone RP11-1172A19 from UL, complete sequence Length = 172810 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 aggcaaccatggaggtggtg 136 |||||||||||||||||||| Sbjct: 105076 aggcaaccatggaggtggtg 105095
>gb|AC146613.3| Mus musculus BAC clone RP23-36P1 from chromosome 18, complete sequence Length = 197939 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22954 tcccatcccatcccatccca 22935 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22949 tcccatcccatcccatccca 22930 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22944 tcccatcccatcccatccca 22925 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22939 tcccatcccatcccatccca 22920 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22934 tcccatcccatcccatccca 22915 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22929 tcccatcccatcccatccca 22910 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22924 tcccatcccatcccatccca 22905 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22919 tcccatcccatcccatccca 22900 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22914 tcccatcccatcccatccca 22895 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 22909 tcccatcccatcccatccca 22890
>gb|AC005077.5| Homo sapiens BAC clone CTA-228D17 from 7, complete sequence Length = 240379 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 403 agaggggaggaaggaagaag 422 |||||||||||||||||||| Sbjct: 160400 agaggggaggaaggaagaag 160381
>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds Length = 590284 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99957 tcccatcccatcccatccca 99976 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99952 tcccatcccatcccatccca 99971 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99947 tcccatcccatcccatccca 99966 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99942 tcccatcccatcccatccca 99961 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99937 tcccatcccatcccatccca 99956 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99932 tcccatcccatcccatccca 99951 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99927 tcccatcccatcccatccca 99946 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99922 tcccatcccatcccatccca 99941 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99917 tcccatcccatcccatccca 99936 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99912 tcccatcccatcccatccca 99931 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 99907 tcccatcccatcccatccca 99926
>gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete sequence Length = 266344 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150360 tcccatcccatcccatccca 150379 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150355 tcccatcccatcccatccca 150374 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150350 tcccatcccatcccatccca 150369 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150345 tcccatcccatcccatccca 150364 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150340 tcccatcccatcccatccca 150359 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150335 tcccatcccatcccatccca 150354 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150330 tcccatcccatcccatccca 150349 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150325 tcccatcccatcccatccca 150344 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150320 tcccatcccatcccatccca 150339 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 150315 tcccatcccatcccatccca 150334
>gb|AC139341.3| Atelerix albiventris clone LB4-464N6, complete sequence Length = 195266 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 184273 tcccatcccatcccatccca 184292
>gb|AF481828.1| Chlamydomonas reinhardtii chloroplast sulfate transport system permease (SulP) mRNA, complete cds; nuclear gene for chloroplast product Length = 1984 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 1549 tcccatcccatcccatccca 1530
>gb|AF467891.1| Chlamydomonas reinhardtii chloroplast sulfate transport system permease (SulP) gene, complete cds; nuclear gene for chloroplast product Length = 3873 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 3438 tcccatcccatcccatccca 3419
>gb|AC145547.3| Homo sapiens BAC clone RP11-1437O6 from UL, complete sequence Length = 185637 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 117 aggcaaccatggaggtggtg 136 |||||||||||||||||||| Sbjct: 177626 aggcaaccatggaggtggtg 177645
>gb|AC124585.3| Mus musculus BAC clone RP23-130P17 from chromosome 10, complete sequence Length = 198030 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 63550 tcccatcccatcccatccca 63569
>gb|DQ483483.1| Gymnogyps californianus clone 42D microsatellite sequence Length = 662 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 341 tcccatcccatcccatccca 360
>ref|XM_753839.1| Ustilago maydis 521 hypothetical protein (UM02785.1) partial mRNA Length = 4650 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 4158 tcccatcccatcccatccca 4177
>ref|XM_757301.1| Ustilago maydis 521 hypothetical protein (UM06247.1) partial mRNA Length = 1434 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 175 tcccatcccatcccatccca 194
>emb|X62548.1|MMSREGU M.musculus germline DNA for upstream region of immunoglobulin S alpha region Length = 1145 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 294 tcccatcccatcccatccca 275 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 289 tcccatcccatcccatccca 270 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 284 tcccatcccatcccatccca 265 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 279 tcccatcccatcccatccca 260 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 274 tcccatcccatcccatccca 255
>gb|AC113285.9| Mus musculus chromosome 5, clone RP23-407I6, complete sequence Length = 283052 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 235030 tcccatcccatcccatccca 235011
>gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosome 19, complete sequence Length = 188709 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 agagggagaggggaggaagg 416 |||||||||||||||||||| Sbjct: 174669 agagggagaggggaggaagg 174688
>gb|AC123051.4| Mus musculus BAC clone RP24-366E4 from chromosome 6, complete sequence Length = 143909 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 81158 tcccatcccatcccatccca 81139 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 81153 tcccatcccatcccatccca 81134 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tcccatcccatcccatccca 34 |||||||||||||||||||| Sbjct: 81148 tcccatcccatcccatccca 81129 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,329,728 Number of Sequences: 3902068 Number of extensions: 4329728 Number of successful extensions: 126468 Number of sequences better than 10.0: 591 Number of HSP's better than 10.0 without gapping: 611 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 118855 Number of HSP's gapped (non-prelim): 7145 length of query: 483 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 461 effective length of database: 17,147,199,772 effective search space: 7904859094892 effective search space used: 7904859094892 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
