ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet101a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 585 e-164
2gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 398 e-108
3gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 252 8e-64
4gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 196 4e-47
5emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 176 4e-41
6ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 174 1e-40
7dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
8dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
9dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
10dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
11emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 159 9e-36
12dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 155 1e-34
13dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 155 1e-34
14dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 155 1e-34
15dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
16dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
17dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
18dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
19ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 151 2e-33
20gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 151 2e-33
21dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 151 2e-33
22dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
23dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
24dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
25dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
26emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 147 3e-32
27dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
28dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 147 3e-32
29emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 145 1e-31
30gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 143 5e-31
31emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 141 2e-30
32emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 139 8e-30
33emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 137 3e-29
34emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 133 5e-28
35gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 133 5e-28
36gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 131 2e-27
37gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 131 2e-27
38emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 131 2e-27
39gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 131 2e-27
40ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 129 8e-27
41ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 129 8e-27
42ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 129 8e-27
43ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 129 8e-27
44gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 129 8e-27
45gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 129 8e-27
46gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 129 8e-27
47gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 129 8e-27
48gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 129 8e-27
49gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 129 8e-27
50gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 129 8e-27
51gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 129 8e-27
52gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 129 8e-27
53gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 129 8e-27
54gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 129 8e-27
55gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 129 8e-27
56gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 129 8e-27
57emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 129 8e-27
58emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 129 8e-27
59emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 129 8e-27
60emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 129 8e-27
61gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 127 3e-26
62gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 127 3e-26
63emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 125 1e-25
64emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 123 5e-25
65emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
66emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
67emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
68ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 117 3e-23
69emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 117 3e-23
70gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 117 3e-23
71gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 117 3e-23
72gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 117 3e-23
73emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 117 3e-23
74emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 117 3e-23
75emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 117 3e-23
76gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 115 1e-22
77gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 115 1e-22
78emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 115 1e-22
79emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 115 1e-22
80dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 115 1e-22
81gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 115 1e-22
82dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 115 1e-22
83gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 113 5e-22
84gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 113 5e-22
85gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 113 5e-22
86gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 113 5e-22
87gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 113 5e-22
88gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 113 5e-22
89gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 113 5e-22
90dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 111 2e-21
91gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 109 7e-21
92emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 109 7e-21
93gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 107 3e-20
94emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 107 3e-20
95emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 107 3e-20
96emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 107 3e-20
97gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 107 3e-20
98gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 107 3e-20
99gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 107 3e-20
100gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 107 3e-20
101gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 107 3e-20
102gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 107 3e-20
103gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 105 1e-19
104gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 105 1e-19
105emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 105 1e-19
106gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 105 1e-19
107gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 105 1e-19
108emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 105 1e-19
109emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 105 1e-19
110emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 105 1e-19
111gb|M64619.1|PEACAB66 Pea cab gene, complete cds 105 1e-19
112gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 105 1e-19
113gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 105 1e-19
114emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 103 5e-19
115emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 103 5e-19
116ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 101 2e-18
117gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 101 2e-18
118gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 101 2e-18
119gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 101 2e-18
120gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 101 2e-18
121gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 101 2e-18
122gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 101 2e-18
123gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 101 2e-18
124gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 101 2e-18
125emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
126emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 101 2e-18
127gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 101 2e-18
128gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 100 7e-18
129dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 100 7e-18
130gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 100 7e-18
131gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 100 7e-18
132emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 100 7e-18
133gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 100 7e-18
134dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 100 7e-18
135ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 98 3e-17
136gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 98 3e-17
137gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 98 3e-17
138gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 98 3e-17
139gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 98 3e-17
140gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 98 3e-17
141emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 98 3e-17
142emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 98 3e-17
143gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 98 3e-17
144emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 98 3e-17
145emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 98 3e-17
146gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 98 3e-17
147dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 98 3e-17
148ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 96 1e-16
149gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 96 1e-16
150gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 96 1e-16
151gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 96 1e-16
152gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 96 1e-16
153gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 96 1e-16
154emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 96 1e-16
155gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 96 1e-16
156gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 94 4e-16
157gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 94 4e-16
158gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 94 4e-16
159emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 94 4e-16
160gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 94 4e-16
161dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 94 4e-16
162emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 94 4e-16
163gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 94 4e-16
164dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 94 4e-16
165gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 92 2e-15
166gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 92 2e-15
167gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 92 2e-15
168emb|X16535.1|GMCAB4 G.max DNA for Cab4 92 2e-15
169gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 92 2e-15
170gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 92 2e-15
171gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 90 7e-15
172gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 90 7e-15
173gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 90 7e-15
174gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 90 7e-15
175gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 90 7e-15
176gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 90 7e-15
177gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 90 7e-15
178dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 90 7e-15
179gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 88 3e-14
180emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 88 3e-14
181gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 88 3e-14
182gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 88 3e-14
183gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 86 1e-13
184emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 86 1e-13
185gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 86 1e-13
186ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 84 4e-13
187emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 84 4e-13
188gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 84 4e-13
189gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 84 4e-13
190gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 84 4e-13
191gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 84 4e-13
192dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 84 4e-13
193gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 84 4e-13
194gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 84 4e-13
195emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
196emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
197emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
198emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
199emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
200emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
201emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
202emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
203emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 84 4e-13
204gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 84 4e-13
205gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 84 4e-13
206gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 84 4e-13
207gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 84 4e-13
208emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 84 4e-13
209emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 84 4e-13
210emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 84 4e-13
211gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 84 4e-13
212gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 84 4e-13
213dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 84 4e-13
214gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 84 4e-13
215gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 84 4e-13
216gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 84 4e-13
217gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 82 2e-12
218gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 82 2e-12
219gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 82 2e-12
220ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 80 7e-12
221ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 80 7e-12
222gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 80 7e-12
223gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 80 7e-12
224gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 80 7e-12
225gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 80 7e-12
226gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 80 7e-12
227emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
228emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
229emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
230emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
231emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
232gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 80 7e-12
233gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 78 3e-11
234gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 78 3e-11
235gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 78 3e-11
236dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 78 3e-11
237emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 78 3e-11
238emb|X16536.1|GMCAB5 G.max DNA for Cab5 78 3e-11
239emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 78 3e-11
240emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 78 3e-11
241gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 78 3e-11
242gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 78 3e-11
243gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 78 3e-11
244gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 76 1e-10
245emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
246emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 76 1e-10
247emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 76 1e-10
248gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 76 1e-10
249gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 76 1e-10
250dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 76 1e-10
251gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 74 4e-10
252gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 74 4e-10
253dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 74 4e-10
254dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 72 2e-09
255emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 72 2e-09
256gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 72 2e-09
257ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 70 6e-09
258ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
259ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
260ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
261ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
262ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
263ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
264ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 70 6e-09
265dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 70 6e-09
266gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 70 6e-09
267dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 70 6e-09
268dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
269dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 70 6e-09
270dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
271dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
272dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
273dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
274dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
275dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
276dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
277dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
278dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
279dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 6e-09
280gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 70 6e-09
281dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 70 6e-09
282gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 68 2e-08
283emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
284emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 68 2e-08
285gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 68 2e-08
286gb|M34396.1|PMJCABF3 Polystichum munitum chlorophyll a/b-binding... 68 2e-08
287dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 68 2e-08
288dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 68 2e-08
289emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 66 1e-07
290gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 66 1e-07
291gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 66 1e-07
292gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-... 66 1e-07
293gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 66 1e-07
294gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 66 1e-07
295dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 66 1e-07
296dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 66 1e-07
297gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 64 4e-07
298gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 64 4e-07
299dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 64 4e-07
300dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 64 4e-07
301dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 64 4e-07
302dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 64 4e-07
303gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 62 2e-06
304gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 62 2e-06
305emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 62 2e-06
306emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 62 2e-06
307dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
308gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 62 2e-06
309gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 62 2e-06
310gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 62 2e-06
311emb|X61915.1|PTCABP P.thunbergii cab gene 60 6e-06
312gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 60 6e-06
313gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 60 6e-06
314gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 60 6e-06
315emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 60 6e-06
316gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 58 2e-05
317emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 58 2e-05
318emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 58 2e-05
319gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA 58 2e-05
320gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 56 9e-05
321gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 54 4e-04
322emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 54 4e-04
323emb|AJ303353.1|HVU303353 Hordeum vulgare cv. Igri partial cab12 ... 54 4e-04
324emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 54 4e-04
325gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 50 0.006
326dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 50 0.006
327dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 50 0.006
328emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 48 0.023
329gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 46 0.091
330gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 46 0.091
331gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c... 46 0.091
332gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c... 46 0.091
333gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 46 0.091
334emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 46 0.091
335ref|NM_187740.1| Oryza sativa (japonica cultivar-group), predic... 44 0.36
336gb|AC104428.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.36
337dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
338gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.36
339dbj|AP004742.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
340emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 44 0.36
341dbj|D78207.1|PHNCABBP Japanese morning glory mRNA for chlorophyl... 44 0.36
342ref|XM_468446.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.4
343ref|XM_507058.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 1.4
344dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
345gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 42 1.4
346dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
347dbj|AP004878.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
348dbj|AK112048.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
349emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 42 1.4
350emb|Z22782.1|MSCHLABA M.squamata chlorophyll a/b binding protein... 42 1.4
351emb|X69524.1|MSCABC1 M.squamata cabc1 mRNA for chlorophyll a/b/c... 42 1.4
352emb|X73540.1|MSLHC13 M.squamata Lhc1*3 mRNA for chlorophyll a/b/... 42 1.4
353emb|X73539.1|MSLHC14 M.squamata Lhc1*4 mRNA for chlorophyll a/b/... 42 1.4
354dbj|AK099147.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
355gb|L15738.1|MNTCPCABBP Mantoniella squamata chloroplast photosyn... 42 1.4
356gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 40 5.6
357gb|BC011604.2| Homo sapiens connector enhancer of kinase suppres... 40 5.6
358gb|BC012797.2| Homo sapiens connector enhancer of kinase suppres... 40 5.6
359gb|AC120164.7| Mus musculus chromosome 19, clone RP24-470C3, com... 40 5.6
360gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 40 5.6
361gb|AC135102.16| Medicago truncatula clone mth2-8m3, complete seq... 40 5.6
362emb|AL606510.10| Human DNA sequence from clone RP11-435D11 on ch... 40 5.6
363gb|AC015756.18| Homo sapiens chromosome , clone RP11-1L12, compl... 40 5.6
364emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, ... 40 5.6
365gb|BT007606.1| Synthetic construct Homo sapiens connector enhanc... 40 5.6
366gb|BT006900.1| Homo sapiens connector enhancer of KSR-like (Dros... 40 5.6
367gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.6
368gb|AC016450.10| Homo sapiens chromosome 11, clone RP11-361K15, c... 40 5.6
369gb|AC068107.6| Homo sapiens chromosome 11, clone RP11-807F21, co... 40 5.6
370gb|AC151000.3| Medicago truncatula chromosome 2 BAC clone mth2-1... 40 5.6
371dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete ge... 40 5.6
372gb|AY892731.1| Synthetic construct Homo sapiens clone FLH024774.... 40 5.6
373gb|AY890248.1| Synthetic construct Homo sapiens clone FLH024778.... 40 5.6
374gb|AY890247.1| Synthetic construct Homo sapiens clone FLH024777.... 40 5.6
375emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 40 5.6
376gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana... 40 5.6
377gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4 40 5.6

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  585 bits (295), Expect = e-164
 Identities = 361/383 (94%)
 Strand = Plus / Plus

                                                                       
Query: 38  agacatcttagcactccaatggcggccaccaccatgtccctctcctcatcgacattcgca 97
           ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| 
Sbjct: 1   agacaccttagcactccaatggcggccaccaccatgtacctctcctcatcgacattcgcc 60

                                                                       
Query: 98  ggcaaagcggtgaagaatgtcccatcgtcagctctcttcggcgaggcccgcgtcaccatg 157
           || || |||||||||||||||||||  || ||||||||||| ||||| ||||||||||||
Sbjct: 61  ggaaaggcggtgaagaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatg 120

                                                                       
Query: 158 cgcaagaccacggcaaaagctaagcaggtttcctccggcagcccatggtacggagctgat 217
           ||||||||| |||| ||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 121 cgcaagaccgcggcgaaagctaagcaagtttcctccagcagcccatggtacggagctgat 180

                                                                       
Query: 218 cgcgtgctctacctcggcccactctctggcgagcccccaagctacctcaccggtgagttc 277
           || |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||
Sbjct: 181 cgtgtgctctacctcggcccactctctcgcgagcccccaagctacctcaccggtgatttc 240

                                                                       
Query: 278 cccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaag 337
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 cccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaag 300

                                                                       
Query: 338 aaccgtgagttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtg 397
           ||||| ||||||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 301 aaccgcgagttggaggtgatacactgccgctgggctatgcttggtgcactgggttgcgtg 360

                                  
Query: 398 ttccctgagttgctggcccgcaa 420
           |||||||||||||| ||||||||
Sbjct: 361 ttccctgagttgcttgcccgcaa 383



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  398 bits (201), Expect = e-108
 Identities = 327/369 (88%)
 Strand = Plus / Plus

                                                                       
Query: 52  tccaatggcggccaccaccatgtccctctcctcatcgacattcgcaggcaaagcggtgaa 111
           ||||||||||||  ||||||||||||||||||| ||||| || || ||||| ||||||||
Sbjct: 6   tccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaa 65

                                                                       
Query: 112 gaatgtcccatcgtcagctctcttcggcgaggcccgcgtcaccatgcgcaagaccacggc 171
           |||||| ||||| |  |||||||| |||||||||||||||||||||||||||||| | ||
Sbjct: 66  gaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagaccgcagc 125

                                                                       
Query: 172 aaaagctaagcaggtttcctccggcagcccatggtacggagctgatcgcgtgctctacct 231
           ||| || |||||||||||||||||||||||||||||||| ||||| || |||||||||||
Sbjct: 126 aaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacct 185

                                                                       
Query: 232 cggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgg 291
           |||||||||||| || ||||| || |||||||| |||||||||||||| || ||||| ||
Sbjct: 186 cggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgactatgg 245

                                                                       
Query: 292 gtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttgga 351
           ||||||||| |||||||| || |||||||| ||||||||||| |||||||| ||| ||||
Sbjct: 246 gtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggagctgga 305

                                                                       
Query: 352 ggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgct 411
           ||| |||||||| |||||||| |||||||| ||||| ||||| || ||||||||||||||
Sbjct: 306 ggtgatccactgtcgctgggccatgcttggggcacttggttgtgtcttccctgagttgct 365

                    
Query: 412 ggcccgcaa 420
            ||||||||
Sbjct: 366 cgcccgcaa 374



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  252 bits (127), Expect = 8e-64
 Identities = 256/299 (85%)
 Strand = Plus / Plus

                                                                       
Query: 122 tcgtcagctctcttcggcgaggcccgcgtcaccatgcgcaagaccacggcaaaagctaag 181
           ||||| || |||||||| ||||| ||||||||||||||||||||| |||| || || |||
Sbjct: 130 tcgtcggcgctcttcggggaggcgcgcgtcaccatgcgcaagaccgcggccaaggccaag 189

                                                                       
Query: 182 caggtttcctccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactc 241
           | ||| || ||||||||||| ||||||||  | || |||||||||||||||||||| |||
Sbjct: 190 ccggtgtcgtccggcagcccgtggtacgggtccgaccgcgtgctctacctcggcccgctc 249

                                                                       
Query: 242 tctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacg 301
           || ||||| ||||| |||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 250 tccggcgaccccccgagctacctcaccggcgagttccccggcgactacgggtgggacacc 309

                                                                       
Query: 302 gctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccac 361
           || || || || || ||||||||||||||| | |||||||| ||| ||||||| ||||||
Sbjct: 310 gcggggctgtcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatccac 369

                                                                      
Query: 362 tgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           ||||| ||||| ||||| ||||| || || ||||| ||||| ||| |||| ||||||||
Sbjct: 370 tgccggtgggccatgctgggcgcgctcggctgcgtcttccccgagctgctcgcccgcaa 428



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  196 bits (99), Expect = 4e-47
 Identities = 300/367 (81%)
 Strand = Plus / Plus

                                                                       
Query: 54  caatggcggccaccaccatgtccctctcctcatcgacattcgcaggcaaagcggtgaaga 113
           |||||||||||||||||||||| || ||||| ||| | ||||| ||||| || || ||||
Sbjct: 199 caatggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggccgtcaaga 258

                                                                       
Query: 114 atgtcccatcgtcagctctcttcggcgaggcccgcgtcaccatgcgcaagaccacggcaa 173
           |  | || ||||| |||||| | || || || || || | ||||||||||||  |||| |
Sbjct: 259 acttgccctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcga 318

                                                                       
Query: 174 aagctaagcaggtttcctccggcagcccatggtacggagctgatcgcgtgctctacctcg 233
           | || || || ||||| ||  ||||||| ||||||||  |||| || |||||||||||||
Sbjct: 319 aggccaaacaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcg 378

                                                                       
Query: 234 gcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggt 293
           |||| || || ||||||||||| |||||| | || |||||||||||||||||||| ||||
Sbjct: 379 gcccgctttccggcgagccccccagctacttgactggtgagttccccggtgactatgggt 438

                                                                       
Query: 294 gggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggagg 353
           ||||||| || || ||||| |||||||| ||||||||| | |||||||| ||| | ||||
Sbjct: 439 gggacaccgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgagg 498

                                                                       
Query: 354 ttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctgg 413
           | ||||||||||| ||||| ||||| || || || ||||| || || || |||||||| |
Sbjct: 499 tgatccactgccgatgggccatgctcggtgcgcttggttgtgtctttcccgagttgcttg 558

                  
Query: 414 cccgcaa 420
           |||||||
Sbjct: 559 cccgcaa 565



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  176 bits (89), Expect = 4e-41
 Identities = 244/295 (82%), Gaps = 3/295 (1%)
 Strand = Plus / Plus

                                                                       
Query: 129 ctctcttcggcgaggcccgcgtcaccatgcgcaagaccacggcaaaagctaagcaggttt 188
           |||||||||||||||||||||| || |||||||||||  |||| || || |||| ||   
Sbjct: 80  ctctcttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggcaaagccggcgg 139

                                                                       
Query: 189 c---ctccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctg 245
           |   |||||||||||| ||||||||  | || |||||||||||||| |||||||| || |
Sbjct: 140 cgagctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccg 199

                                                                       
Query: 246 gcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctg 305
           |||||||||| |||||||| || || |||||||| || |||||||| |||||||| || |
Sbjct: 200 gcgagcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 259

                                                                       
Query: 306 gactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgcc 365
           | || || || ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||
Sbjct: 260 ggctgtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactccc 319

                                                                  
Query: 366 gctgggctatgcttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           ||||||| ||||| |||||  |||| ||||||||||| ||| |||| ||||||||
Sbjct: 320 gctgggccatgctgggcgcgttgggctgcgtgttcccggagctgctcgcccgcaa 374



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| |||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 306

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| ||||| ||||||||||| ||| | || ||||||||
Sbjct: 307 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaa 350



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                            
Query: 197      agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
                ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 257      agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
                |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                                            
Query: 317      gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
                ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| |||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 23603849

                                                            
Query: 377      cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
                || ||||| ||||| ||||||||||| ||| | || ||||||||
Sbjct: 23603850 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaa 23603893



 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                            
Query: 197      agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
                ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 257      agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
                  |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 317      gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
                ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                                                            
Query: 377      cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
                || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 30024656 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 30024699



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                         
Query: 197   agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
             ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 257   agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                                         
Query: 317   gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
             ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| |||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 66548

                                                         
Query: 377   cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
             || ||||| ||||| ||||||||||| ||| | || ||||||||
Sbjct: 66549 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaa 66592



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 377

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| ||||| ||||||||||| ||| | || ||||||||
Sbjct: 378 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaa 421



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  174 bits (88), Expect = 1e-40
 Identities = 190/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| |||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 376

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| ||||| ||||||||||| ||| | || ||||||||
Sbjct: 377 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaa 420



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  159 bits (80), Expect = 9e-36
 Identities = 290/360 (80%)
 Strand = Plus / Plus

                                                                       
Query: 61  ggccaccaccatgtccctctcctcatcgacattcgcaggcaaagcggtgaagaatgtccc 120
           ||||||||||||||| |  ||||| ||| | ||||| ||||| || || |||||  | ||
Sbjct: 1   ggccaccaccatgtctcgttcctcttcgtccttcgccggcaaggccgtcaagaacttgcc 60

                                                                       
Query: 121 atcgtcagctctcttcggcgaggcccgcgtcaccatgcgcaagaccacggcaaaagctaa 180
            ||||| |||||| | || || || || || | ||||||||||||  |||| || || ||
Sbjct: 61  ctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcgaaggccaa 120

                                                                       
Query: 181 gcaggtttcctccggcagcccatggtacggagctgatcgcgtgctctacctcggcccact 240
            || ||||| ||  ||||||| ||||||||  |||| || ||||||||||||||| | ||
Sbjct: 121 acaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcggctcgct 180

                                                                       
Query: 241 ctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacac 300
            || ||||| ||||| |||||| | || |||||||||||||||||||| |||||||||||
Sbjct: 181 ttccggcgaaccccccagctacttgactggtgagttccccggtgactatgggtgggacac 240

                                                                       
Query: 301 ggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcca 360
            || || ||||| |||||||| ||||||||| | |||||||| ||| | ||||| |||||
Sbjct: 241 cgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgaggtgatcca 300

                                                                       
Query: 361 ctgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           |||||| ||||| ||||| || || || ||||| || || || |||||||| ||||||||
Sbjct: 301 ctgccgatgggccatgctcggtgcgcttggttgtgtctttcccgagttgcttgcccgcaa 360



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                            
Query: 197      agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
                ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 257      agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
                |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                                            
Query: 317      gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
                ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302

                                          
Query: 377      cttggcgcactgggttgcgtgttccc 402
                || ||||| || || ||||| |||||
Sbjct: 10793303 ctgggcgcgctcggctgcgtcttccc 10793328



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 131      ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
                |||||||||||||| ||  |||||||||||||||||
Sbjct: 10793054 ctcttcggcgaggcgcggatcaccatgcgcaagacc 10793089



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                         
Query: 197   agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
             ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 257   agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                                         
Query: 317   gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
             ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025

                                       
Query: 377   cttggcgcactgggttgcgtgttccc 402
             || ||||| || || ||||| |||||
Sbjct: 17026 ctgggcgcgctcggctgcgtcttccc 17051



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 131   ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
             |||||||||||||| ||  |||||||||||||||||
Sbjct: 16777 ctcttcggcgaggcgcggatcaccatgcgcaagacc 16812



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                          
Query: 197    agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
              ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 257    agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
              |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                                          
Query: 317    gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
              ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920

                                        
Query: 377    cttggcgcactgggttgcgtgttccc 402
              || ||||| || || ||||| |||||
Sbjct: 129921 ctgggcgcgctcggctgcgtcttccc 129946



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 131    ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
              |||||||||||||| ||  |||||||||||||||||
Sbjct: 129672 ctcttcggcgaggcgcggatcaccatgcgcaagacc 129707



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 371 ctgggcgcgctcggctgcgtcttccc 396



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 122 ctcttcggcgaggcgcggatcaccatgcgcaagacc 157



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 376 ctgggcgcgctcggctgcgtcttccc 401



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagacc 162



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 378 ctgggcgcgctcggctgcgtcttccc 403



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 129 ctcttcggcgaggcgcggatcaccatgcgcaagacc 164



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  155 bits (78), Expect = 1e-34
 Identities = 174/206 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 376 ctgggcgcgctcggctgcgtcttccc 401



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagacc 162



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 319 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 362



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Minus

                                                                         
Query: 197   agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
             ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 257   agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
               |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 317   gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
             ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

                                                         
Query: 377   cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
             || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 14355 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 14312



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                         
Query: 197   agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
             ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 257   agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
               |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 317   gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
             ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

                                                         
Query: 377   cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
             || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 20646 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 20689



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 443



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 443



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 445



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  151 bits (76), Expect = 2e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| ||||||||||| |||||||| |||||||| || || || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 445



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  147 bits (74), Expect = 3e-32
 Identities = 164/194 (84%)
 Strand = Plus / Plus

                                                                        
Query: 227  tacctcggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgac 286
            |||||||||||  |||| ||||||||||| |||||||||||||| ||||||||||| |||
Sbjct: 1051 tacctcggccccttctccggcgagcccccgagctacctcaccggcgagttccccggcgac 1110

                                                                        
Query: 287  tacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgag 346
            ||||| |||||||| || || || || || ||||||||||| ||| | |||||||| |||
Sbjct: 1111 tacggctgggacaccgccgggctgtccgccgaccccgagacattcgccaagaaccgcgag 1170

                                                                        
Query: 347  ttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
             ||||||| ||||||| ||||||||| ||||| ||||| || || ||||| ||||| |||
Sbjct: 1171 ctggaggtgatccactcccgctgggccatgctcggcgcgctcggctgcgtcttccccgag 1230

                          
Query: 407  ttgctggcccgcaa 420
             ||||  |||||||
Sbjct: 1231 ctgctctcccgcaa 1244



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 133 cttcggcgaggcccgcgtcaccatgcgcaagacc 166
           ||||||||||| |||| |||||||||||||||||
Sbjct: 957 cttcggcgagggccgcatcaccatgcgcaagacc 990



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  147 bits (74), Expect = 3e-32
 Identities = 173/206 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| |||||  || | |||||||| ||| ||||||| ||||||| ||| ||||| |||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 376 ctgggcgcgctcggctgcgtcttccc 401



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagacc 162



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  147 bits (74), Expect = 3e-32
 Identities = 173/206 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
           |||||||||||||| |||||||| || ||||||||||||||||| || || ||||| || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||| | ||||||| ||| ||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

                                     
Query: 377 cttggcgcactgggttgcgtgttccc 402
           || ||||| || || ||||| |||||
Sbjct: 357 ctgggcgcgctcggctgcgtcttccc 382



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 108 ctcttcggcgaggcgcggatcaccatgcgcaagacc 143



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  145 bits (73), Expect = 1e-31
 Identities = 189/227 (83%), Gaps = 3/227 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggc---gagccc 253
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||   ||||| 
Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| ||||||||||||||||| || || ||||| 
Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| | | ||||| 
Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcg 803

                                                          
Query: 374 atgcttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           ||||| ||||  ||||| ||||||||||| ||| | || ||||||||
Sbjct: 804 atgctcggcgggctgggctgcgtgttcccggagctcctcgcccgcaa 850



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  143 bits (72), Expect = 5e-31
 Identities = 186/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccccca 256
           ||||| |||||||| || || |||||||||||||||||||| ||||| |||||||| || 
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 257 agctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgct 316
             |||||||||||| |||||| |||| |||||||| |||||||| || || || || || 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 317 gaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||||| ||||| ||| | |||||||| ||| ||||||| ||||||||||| ||||| |||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

                                                       
Query: 377 cttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 361 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 404



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  141 bits (71), Expect = 2e-30
 Identities = 175/209 (83%), Gaps = 3/209 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 agcccatggtacggagctgatcgcgtgctctacctcggcccactctctggc---gagccc 253
           ||||| |||||||| || || ||||| |||||||||||||| ||||| |||   ||||| 
Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||||||||| ||||||||||| ||||||||||||||||| || || ||||| 
Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||| ||| | |||||||| ||| ||||||| ||||||| ||| ||||| 
Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764

                                        
Query: 374 atgcttggcgcactgggttgcgtgttccc 402
           ||||| ||||| || || ||||| |||||
Sbjct: 765 atgctgggcgcgctcggctgcgtcttccc 793



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 131 ctcttcggcgaggcccgcgtcaccatgcgcaagacc 166
           |||||||||||||| ||  |||||||||||||||||
Sbjct: 516 ctcttcggcgaggcgcggatcaccatgcgcaagacc 551



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  139 bits (70), Expect = 8e-30
 Identities = 190/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||| ||||| ||||||||  | || |||||||| ||||| |||||||| || ||||||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || |||||||| || || |||||||| || |||||||| |||||||| || || || 
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || ||||| ||||| ||| | |||||||| ||| ||||||| |||||||||||||||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                                                             
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || ||||| ||||| || |||||||| ||||| ||| | || ||||||||
Sbjct: 377 gccatgctgggcgcgctcggttgcgtcttcccggagcttctcgcccgcaa 426



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 133 cttcggcgaggcccgcgtcaccatgcgcaagac 165
           |||||||||||||||||| || |||||||||||
Sbjct: 136 cttcggcgaggcccgcgtgacgatgcgcaagac 168



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score =  137 bits (69), Expect = 3e-29
 Identities = 177/213 (83%)
 Strand = Plus / Minus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || |||   ||| | || ||| |||| |||||||||
Sbjct: 285 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 226

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 166

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 165 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 106

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 105 atgctcggagccctaggctgcgttttccctgag 73



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  133 bits (67), Expect = 5e-28
 Identities = 130/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 ccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactct 311
           |||| |||||| | |||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 86  ccccgagctacttgaccggtgagttccccggtgactacggctgggacactgctggactct 145

                                                                       
Query: 312 ctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctggg 371
           | |||||||| ||||||||| | |||||||||||| | ||||| |||||||   | ||||
Sbjct: 146 cagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatccactcaagatggg 205

                                          
Query: 372 ctatgcttggcgcactgggttgcgtgttccc 402
           | |||||||| ||||| || ||||| |||||
Sbjct: 206 ccatgcttggagcactcggatgcgtattccc 236



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score =  133 bits (67), Expect = 5e-28
 Identities = 136/159 (85%)
 Strand = Plus / Plus

                                                                       
Query: 248 gagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctgga 307
           |||||||| |||||||||||||| ||||||||||| |||||||| |||||||| || || 
Sbjct: 7   gagcccccgagctacctcaccggagagttccccggagactacggatgggacaccgccggt 66

                                                                       
Query: 308 ctctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgc 367
           ||||| |||||||||||||||||| | | |||||||||| | || |||||||||||| | 
Sbjct: 67  ctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccactgcaga 126

                                                  
Query: 368 tgggctatgcttggcgcactgggttgcgtgttccctgag 406
           ||||| ||||| || || || || ||||| |||||||||
Sbjct: 127 tgggccatgctcggagccctaggctgcgttttccctgag 165



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  131 bits (66), Expect = 2e-27
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                       
Query: 227 tacctcggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgac 286
           |||||||||||  |||| |||||| |||||   ||||||||||| || |||||||| |||
Sbjct: 226 tacctcggcccgttctccggcgaggccccatcatacctcaccggcgaattccccggcgac 285

                                                                       
Query: 287 tacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgag 346
           |||||||||||||| || || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 286 tacgggtgggacaccgccgggctctccgccgaccccgagaccttctccaagaaccgggag 345

                                                                       
Query: 347 ttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            | ||||| ||||||||||| ||||| ||||| || || || || ||||| ||||| |||
Sbjct: 346 ctcgaggtgatccactgccggtgggccatgctgggtgctctcggctgcgtcttccccgag 405

                         
Query: 407 ttgctggcccgcaa 420
            | || ||||||||
Sbjct: 406 ctcctcgcccgcaa 419



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                       
Query: 248 gagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctgga 307
           |||||||||||||||||||| || |||||||||||||||||||| |||||||| || || 
Sbjct: 232 gagcccccaagctacctcacaggagagttccccggtgactacggatgggacaccgccggt 291

                                                                       
Query: 308 ctctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgc 367
           || || |||||||||||||||||| | | |||||||||| | || |||||||||||| | 
Sbjct: 292 ctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccactgcaga 351

                         
Query: 368 tgggctatgcttgg 381
           ||||| ||||||||
Sbjct: 352 tgggccatgcttgg 365



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  131 bits (66), Expect = 2e-27
 Identities = 147/174 (84%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | || ||||||||||| ||||||||||||
Sbjct: 244 ggcccattctctggtgagtccccaagctacttgactggtgagttccctggtgactacggg 303

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| |||||||| || ||||| || || || ||  | ||||| ||||||||||||
Sbjct: 304 tgggacactgctggactttcagctgatccagaaacttttgccaagaatcgtgagttggag 363

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | ||||| |||||||| || || ||||| || |||||||||
Sbjct: 364 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccctgag 417



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  131 bits (66), Expect = 2e-27
 Identities = 147/174 (84%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||||| |||  |||||| ||||| |||||||| ||||||||||| 
Sbjct: 145 ggcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggt 204

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| |||||||| || ||||| |||||||||||| | ||||||||||||||||| 
Sbjct: 205 tgggacactgctggactttcagctgatcccgagaccttcgccaagaaccgtgagttggaa 264

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||| | | ||||| |||||||| ||  |||| || || |||||||||
Sbjct: 265 gtgatccactccagatgggccatgcttggagctttggggtgtgttttccctgag 318



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Minus

                                                                        
Query: 194  ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
            |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 3111 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3052

                                                                        
Query: 254  ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
            || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 3051 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 2992

                                                                        
Query: 314  gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
            || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 2991 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2932

                                             
Query: 374  atgcttggcgcactgggttgcgtgttccctgag 406
            ||||| || || || || ||||| |||||||||
Sbjct: 2931 atgctcggagccctaggctgcgttttccctgag 2899



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Minus

                                                                        
Query: 194  ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
            |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 3150 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3091

                                                                        
Query: 254  ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
            || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 3090 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 3031

                                                                        
Query: 314  gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
            || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 3030 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2971

                                             
Query: 374  atgcttggcgcactgggttgcgtgttccctgag 406
            ||||| || || || || ||||| |||||||||
Sbjct: 2970 atgctcggagccctaggctgcgttttccctgag 2938



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 368 atgctcggagccctaggctgcgttttccctgag 400



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 368 atgctcggagccctaggctgcgttttccctgag 400



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 313 atgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 368 atgctcggagccctaggctgcgttttccctgag 400



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Minus

                                                                         
Query: 194   ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
             |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 93868 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 93809

                                                                         
Query: 254   ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
             || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 93808 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 93749

                                                                         
Query: 314   gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
             || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 93748 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 93689

                                              
Query: 374   atgcttggcgcactgggttgcgtgttccctgag 406
             ||||| || || || || ||||| |||||||||
Sbjct: 93688 atgctcggagccctaggctgcgttttccctgag 93656



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                         
Query: 191   tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
             ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 95437 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 95496

                                                                         
Query: 251   cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
             || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 95497 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 95556

                                                                         
Query: 311   tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
             || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 95557 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 95616

                                                 
Query: 371   gctatgcttggcgcactgggttgcgtgttccctgag 406
             || ||||| || || || || ||||| |||||||||
Sbjct: 95617 gccatgctcggagccctaggctgcgttttccctgag 95652



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                         
Query: 194   ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
             |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 80334 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 80393

                                                                         
Query: 254   ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
             || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 80394 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 80453

                                                                         
Query: 314   gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
             || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 80454 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 80513

                                              
Query: 374   atgcttggcgcactgggttgcgtgttccctgag 406
             ||||| || || || || ||||| |||||||||
Sbjct: 80514 atgctcggagccctaggctgcgttttccctgag 80546



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Minus

                                                                         
Query: 191   tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
             ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 78765 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 78706

                                                                         
Query: 251   cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
             || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 78705 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 78646

                                                                         
Query: 311   tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
             || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 78645 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 78586

                                                 
Query: 371   gctatgcttggcgcactgggttgcgtgttccctgag 406
             || ||||| || || || || ||||| |||||||||
Sbjct: 78585 gccatgctcggagccctaggctgcgttttccctgag 78550



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 313 atgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 313 atgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 313 atgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 364 atgctcggagccctaggctgcgttttccctgag 396



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 165 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 224

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 284

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 285 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 344

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 345 atgctcggagccctaggctgcgttttccctgag 377



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 288 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 347

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 348 atgctcggagccctaggctgcgttttccctgag 380



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  129 bits (65), Expect = 8e-27
 Identities = 197/241 (81%)
 Strand = Plus / Plus

                                                                        
Query: 132  tcttcggcgaggcccgcgtcaccatgcgcaagaccacggcaaaagctaagcaggtttcct 191
            |||||||||||| |||| ||||||||||||||||| | || ||  | |||| ||    ||
Sbjct: 1997 tcttcggcgagggccgcatcaccatgcgcaagaccgccgccaagcccaagccggcgcgct 2056

                                                                        
Query: 192  ccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagc 251
            |||||||||| |||||||| || || ||||| || ||||| ||||| || || |||   |
Sbjct: 2057 ccggcagcccctggtacggtgccgaccgcgtcctgtacctgggcccgctgtccggctcac 2116

                                                                        
Query: 252  ccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactct 311
            | || |||||||| ||||| ||||||||||| ||||||||||||||||| |  || || |
Sbjct: 2117 ctccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggctgt 2176

                                                                        
Query: 312  ctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctggg 371
            | || ||||| ||||||||| | |||||||| ||| ||||||| ||||||||||||||||
Sbjct: 2177 cggcggacccggagaccttcgccaagaaccgcgagctggaggtgatccactgccgctggg 2236

             
Query: 372  c 372
            |
Sbjct: 2237 c 2237



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score =  129 bits (65), Expect = 8e-27
 Identities = 176/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 433 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 492

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 493 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 552

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 553 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 612

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 613 atgctcggagccctaggctgcgttttccctgag 645



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 179 aagcaggtttcctccggcagcccatggtacggagctgatcgcgtgctctacctcggccca 238
           ||||||||||||||||| ||||||||||||||  | || || ||    ||| | ||||||
Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232

                                                                       
Query: 239 ctctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggac 298
            |||| |||||||||||   |||||||||||| |||||||| ||||||||||| ||||||
Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292

                                                                       
Query: 299 acggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatc 358
           || ||||| || || |||||||| ||||||||| | | ||||||||||||||| || |||
Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352

               
Query: 359 cact 362
           ||||
Sbjct: 353 cact 356



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  127 bits (64), Expect = 3e-26
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||||||| | |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 205 ggcccattctctggcgagtcaccatcctacctcactggtgaattccctggtgactacggg 264

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| |||||||||||||||||||| ||||||||  | |||||||| ||  | |||
Sbjct: 265 tgggacactgctggactctctgctgacccagagacctttgctaagaaccgcgaacttgag 324

                                   
Query: 353 gttatccactgccgctgggctatg 376
           || ||||||||| | |||||||||
Sbjct: 325 gtgatccactgcagatgggctatg 348



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  125 bits (63), Expect = 1e-25
 Identities = 141/167 (84%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||| ||| ||||||||||| | || ||||||||||| ||||| || ||||||||||
Sbjct: 418 tctctggtgaggccccaagctacttgactggtgagttccctggtgattatgggtgggaca 477

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| || || || ||| | ||||| |||||||||||||| ||||
Sbjct: 478 ctgctggactttcagctgatccagaaactttcgccaagaatcgtgagttggaggtgatcc 537

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           ||||| | ||||| |||||||| || || |||||||| |||||||||
Sbjct: 538 actgcagatgggccatgcttggagctcttggttgcgtcttccctgag 584



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  123 bits (62), Expect = 5e-25
 Identities = 131/154 (85%)
 Strand = Plus / Plus

                                                                       
Query: 252 ccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactct 311
           ||||||||||| | |||||||||||||| |||||||| || |||||||| |||| ||| |
Sbjct: 430 ccccaagctacttgaccggtgagttccctggtgactatggttgggacaccgctgaacttt 489

                                                                       
Query: 312 ctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctggg 371
           | ||||| ||||| || ||| | |||||||||||||||||||| ||||||||| | ||||
Sbjct: 490 cagctgatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatggg 549

                                             
Query: 372 ctatgcttggcgcactgggttgcgtgttccctga 405
           | |||||||| || || ||||| || ||||||||
Sbjct: 550 ccatgcttggagctcttggttgtgtcttccctga 583



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score =  121 bits (61), Expect = 2e-24
 Identities = 175/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 175 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 234

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 235 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 294

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| || |||||| | | |||||||||| | || ||||||||| || | ||||| 
Sbjct: 295 gccgacccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 354

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 355 atgctcggagccctaggctgcgttttccctgag 387



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score =  121 bits (61), Expect = 2e-24
 Identities = 175/213 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || |||   ||| | || ||| |||| |||||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| || |||||| | | ||||||||||   || ||||||||| || | ||||| 
Sbjct: 288 gccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggcc 347

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 348 atgctcggagccctaggctgcgttttccctgag 380



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score =  121 bits (61), Expect = 2e-24
 Identities = 175/213 (82%)
 Strand = Plus / Minus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| |||| |||||||||
Sbjct: 751 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 692

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| |||||||||||||||||||||||||| |||||||| ||||| || || 
Sbjct: 691 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 632

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           || ||||| ||||||||| | | | |||||||| | || ||||||||| || | ||||| 
Sbjct: 631 gccgacccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggcc 572

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 571 atgctcggagccctaggctgcgttttccctgag 539



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 238 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 297

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 298 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 357

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||||||||| || || || || ||||| |||||||||
Sbjct: 358 acagcaggtgggctatgctcggagccctaggctgcgtcttccctgag 404



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 240  tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
            |||| |||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816

                                                                        
Query: 300  cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
            | ||||| || || |||||||||||||| ||| | |  ||||||||| | || |||||||
Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1876

                                                           
Query: 360  actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            ||||| | ||||| ||||| || || || |||||||| |||||||||
Sbjct: 1877 actgcagatgggccatgctcggagccctaggttgcgttttccctgag 1923



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 185 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 244

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 245 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 304

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||||||||| || || || || ||||| |||||||||
Sbjct: 305 acagcaggtgggctatgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 238 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 297

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 298 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 357

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||||||||| || || || || ||||| |||||||||
Sbjct: 358 acagcaggtgggctatgctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                         
Query: 240   tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
             ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 21923 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 21982

                                                                         
Query: 300   cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
             | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 21983 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 22042

                                                            
Query: 360   actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
             || || | ||||||||||| || || || || ||||| |||||||||
Sbjct: 22043 acagcaggtgggctatgctcggagccctaggctgcgtcttccctgag 22089



 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                         
Query: 240   tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
             ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 19277 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 19336

                                                                         
Query: 300   cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
             | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 19337 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 19396

                                                            
Query: 360   actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
             || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 19397 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 19443



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                         
Query: 194   ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
             |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 16776 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 16717

                                                                         
Query: 254   ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
             || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 314   gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
             |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                                              
Query: 374   atgcttggcgcactgggttgcgtgttccctgag 406
             ||||| || || || || ||||| |||||||||
Sbjct: 16596 atgctcggagccctaggctgcgtcttccctgag 16564



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                        
Query: 240  tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
            |||| |||||||||||||||||||| || || ||||||||||| ||||| || |||||||
Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817

                                                                        
Query: 300  cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
            | ||||| || || |||||||||||||| ||| | |  ||||||||| | || |||||||
Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1877

                                                           
Query: 360  actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            ||||| | ||||| ||||| || || || |||||||| |||||||||
Sbjct: 1878 actgcagatgggccatgctcggagccctaggttgcgttttccctgag 1924



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score =  117 bits (59), Expect = 3e-23
 Identities = 140/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 391 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 450

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 451 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 510

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||||||||| || || || || ||||| |||||||||
Sbjct: 511 acagcaggtgggctatgctcggagccctaggctgcgtcttccctgag 557



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score =  117 bits (59), Expect = 3e-23
 Identities = 122/143 (85%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           |||||||||||||||||||| ||||||||||| |||||||| ||||| || || ||||||
Sbjct: 257 tacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgac 316

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || || |||||| | |||||||||||| | || |||||||||||| | ||||||||| | 
Sbjct: 317 ccagaaaccttcgctaagaaccgtgagcttgaagttatccactgcaggtgggctatgttg 376

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           || ||| ||||||| || |||||
Sbjct: 377 ggagcattgggttgtgttttccc 399



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  115 bits (58), Expect = 1e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||||||||||||||||||||||||||| 
Sbjct: 207 ggcgagccgccatcctacttgaccggtgagttccccggtgactacgggtgggacacggcg 266

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  |||||||| | ||| |||| || |||||||||
Sbjct: 267 gggctttcggcagatccagagacttttgcgaagaacagagagctggaagtgatccactgc 326

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 327 cggtgggcaatgctgggcgctctgggttgcgttttccc 364



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score =  115 bits (58), Expect = 1e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||||||||||||||||||||||||||| 
Sbjct: 253 ggcgagccgccatcctacttgaccggtgagttccccggtgactacgggtgggacacggcg 312

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  |||||||| | ||| |||| || |||||||||
Sbjct: 313 gggctttcggcagatccagagacttttgcgaagaacagagagctggaagtgatccactgc 372

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 373 cggtgggcaatgctgggcgctctgggttgcgttttccc 410



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  115 bits (58), Expect = 1e-22
 Identities = 145/174 (83%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| | ||||| ||| ||||||||||| | || |||||||| || |||||||| |||
Sbjct: 408 ggcccattttctggtgaggccccaagctacttgactggtgagtttcctggtgactatggg 467

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || || ||| | |||||||| |||||||||
Sbjct: 468 tgggatactgctggactttcagcagacccagaaactttcgccaagaaccgggagttggag 527

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | ||||| |||||||| || || |||||||| |||||||||
Sbjct: 528 gtgatccactgcagatgggccatgcttggagctcttggttgcgtcttccctgag 581



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  115 bits (58), Expect = 1e-22
 Identities = 142/170 (83%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| | ||||||||| | || |||||||| || ||||| ||||||
Sbjct: 236 ggcccattctctggtgagtctccaagctacttgactggtgagtttcctggtgattacggg 295

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| |||||||| || ||||| || || || ||| | ||||||||||||||||||
Sbjct: 296 tgggacactgctggactttcagctgatccagaaacattcgccaagaaccgtgagttggag 355

                                                             
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||||||| | ||||| |||||||| || || ||||| || |||||
Sbjct: 356 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccc 405



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  115 bits (58), Expect = 1e-22
 Identities = 112/130 (86%)
 Strand = Plus / Minus

                                                                         
Query: 233   ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
             |||||| |||| || ||||||||   |||| | |||||||||||||||||||||||||| 
Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123

                                                                         
Query: 293   tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
             |||||||| ||||| || ||||||||||||||||| ||| | |||||||||||| | |||
Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063

                       
Query: 353   gttatccact 362
             || |||||||
Sbjct: 66062 gtgatccact 66053



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  115 bits (58), Expect = 1e-22
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| |||||| |||| |||||||| |||||||| || || ||||| || ||
Sbjct: 598 ctacctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcggccga 657

                                                                       
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgct 378
           ||||||||||||| | |||||||| ||| ||||||| ||||||   || ||||| |||||
Sbjct: 658 ccccgagaccttcgccaagaaccgggagctggaggtgatccacgcgcggtgggccatgct 717

                                                     
Query: 379 tggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
            ||||| ||||| ||||||||||| ||| ||||||| |||||
Sbjct: 718 cggcgcgctgggctgcgtgttcccggagctgctggcgcgcaa 759



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  115 bits (58), Expect = 1e-22
 Identities = 142/170 (83%)
 Strand = Plus / Plus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| ||||||| ||| | ||||||||| | || ||||| ||||| ||||||||||||
Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            |||||||| |||||||| || ||||| || || || ||  | ||||||||||||||||||
Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659

                                                              
Query: 353  gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
            || ||||||||| | ||||| |||||||| || || ||||| || |||||
Sbjct: 4660 gtgatccactgcagatgggcaatgcttggagctcttggttgtgtcttccc 4709



 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| ||||||| ||| | ||||||||| | || |||||||| || |||||||| || 
Sbjct: 2493 ggcccattctctggtgagtctccaagctacttgactggtgagtttccaggtgactatgga 2434

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            |||||||| |||||||| || ||||| || || || ||  | ||||||||||||||||||
Sbjct: 2433 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 2374

                                                              
Query: 353  gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
            || ||||||||| | ||||| |||||||| || || ||||| || |||||
Sbjct: 2373 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccc 2324



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||||||||||||||||||||| |||||||| |||||||| || || ||||| || |||
Sbjct: 243 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 302

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           |||||||| ||| | |||||||| ||| | ||||| ||||||||| | ||||| ||||| 
Sbjct: 303 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 362

                                                    
Query: 380 ggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 363 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaa 403



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||||||||||||||||||||| |||||||| |||||||| || || ||||| || |||
Sbjct: 78  tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 137

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           |||||||| ||| | |||||||| ||| | ||||| ||||||||| | ||||| ||||| 
Sbjct: 138 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 197

                                                    
Query: 380 ggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           ||||| || || ||||| ||||| ||| | || ||||||||
Sbjct: 198 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaa 238



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || ||||||||||| ||||| ||||| ||||| 
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || ||||||||||| ||||| ||||| ||||| 
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || ||||||||||| ||||| ||||| ||||| 
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score =  113 bits (57), Expect = 5e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || ||||||||||| ||||| ||||| ||||| 
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  113 bits (57), Expect = 5e-22
 Identities = 111/129 (86%)
 Strand = Plus / Plus

                                                                       
Query: 234 gcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggt 293
           ||||| ||||||| ||||| |||  |||||| ||||| |||||||| ||||||||||| |
Sbjct: 1   gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60

                                                                       
Query: 294 gggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggagg 353
           ||||||| |||||||| || ||||| |||||||||||| | |||||||| |||||||| |
Sbjct: 61  gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120

                    
Query: 354 ttatccact 362
           | |||||||
Sbjct: 121 tgatccact 129



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score =  111 bits (56), Expect = 2e-21
 Identities = 149/180 (82%)
 Strand = Plus / Plus

                                                                       
Query: 227 tacctcggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgac 286
           ||||| |||||| |||| |||||| | |||   ||||| |||||||| ||||| ||||||
Sbjct: 216 tacctaggcccattctccggcgaggctccatcatacctgaccggtgaattcccaggtgac 275

                                                                       
Query: 287 tacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgag 346
           ||||| |||||||| || ||||| |||||||| || ||||| || || ||||||||||||
Sbjct: 276 tacggctgggacaccgccggactttctgctgatccagagacattttccaagaaccgtgag 335

                                                                       
Query: 347 ttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            | ||||| ||||||||| | ||||| |||||||| || || || ||||| |||||||||
Sbjct: 336 cttgaggtcatccactgcagatgggcaatgcttggagctcttggctgcgtcttccctgag 395



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score =  109 bits (55), Expect = 7e-21
 Identities = 139/167 (83%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| ||||||||||| |||||||| |||||||
Sbjct: 143 tctctggcgagtcaccgagctaccttaccggagagttccccggagactacggatgggaca 202

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| |||||||| ||| | | |||||||||| | || |||||||
Sbjct: 203 ccgctggactttcagctgatcccgagacattcgcaaggaaccgtgagctagaagttatcc 262

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 263 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 309



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score =  109 bits (55), Expect = 7e-21
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| |||||||||||||||||||| |||||||| ||||| || || |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                      
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccac 361
           |||||||||||||  |||| |||||||| ||||||| ||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatccac 305



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  107 bits (54), Expect = 3e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||| |||||||||||||||||||| || 
Sbjct: 207 ggcgagccgccatcctacttgaccggtgagttcccgggtgactacgggtgggacacagcg 266

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||| |||||||| | || ||||| || |||||||||
Sbjct: 267 gggctttcggcggatccggagactttcgcgaagaacagagaattggaagtgatccactgc 326

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 327 cggtgggcaatgctgggcgctctgggttgcgttttccc 364



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score =  107 bits (54), Expect = 3e-20
 Identities = 105/122 (86%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           |||| ||||||||||| |||||||| |||||||||||||||||||||||||| |||||||
Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||| | || || || ||||| ||||||||| | | |||||||||| | || |||||||
Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 328

             
Query: 360 ac 361
           ||
Sbjct: 329 ac 330



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score =  107 bits (54), Expect = 3e-20
 Identities = 121/142 (85%), Gaps = 1/142 (0%)
 Strand = Plus / Plus

                                                                       
Query: 189 cctccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcg 248
           ||||| ||||||| ||||||||  | || |||||||||||||||||||| ||||| ||||
Sbjct: 172 cctccagcagcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcg 231

                                                                       
Query: 249 agcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggac 308
           ||||||| |||||||||| ||| ||||| || || || ||||| |||||||| || ||  
Sbjct: 232 agcccccgagctacctcagcggcgagtt-ccgggcgattacggctgggacaccgcagggg 290

                                 
Query: 309 tctctgctgaccccgagacctt 330
           ||||||||||||| ||||||||
Sbjct: 291 tctctgctgacccggagacctt 312



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score =  107 bits (54), Expect = 3e-20
 Identities = 132/158 (83%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||||||||||||||||||||||||||| 
Sbjct: 262 ggcgagccgccatcctacttgaccggtgagttccccggtgactacgggtgggacacggcg 321

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||  ||  |||||||| | ||| |||| || |||||||||
Sbjct: 322 gggctttcggcagatccagagaattttgcgaagaacagagagctggaagtgatccactgc 381

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 382 cggtgggcaatgctgggcgctctgggttgcgttttccc 419



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | ||||| |||||||| || || || || || |||||||||
Sbjct: 295 gtgatccactgcagatgggcaatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | || ||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgactggtgaattccctggtgactacggg 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 295 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| ||||| ||||||||||||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | ||||| |||||||| || || || || || |||||||||
Sbjct: 295 gtgatccactgcagatgggcaatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||  ||||||||||| | || |||||||| || ||||||||||| 
Sbjct: 216 ggcccattctctggtgaagccccaagctacttgactggtgagtttcctggtgactacgga 275

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| |||||||| || |||||||| || || ||| | |||||||||||| | |||
Sbjct: 276 tgggacactgctggactttcagctgaccctgaaacattcgctaagaaccgtgagcttgag 335

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | ||||| |||||||| || || || || || |||||||||
Sbjct: 336 gtgatccactgcagatgggccatgcttggtgctcttggatgtgtcttccctgag 389



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  107 bits (54), Expect = 3e-20
 Identities = 102/118 (86%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||| ||| ||||||||||| | ||||||||||| || ||||| ||||| |||||||
Sbjct: 390 tctctggggagtccccaagctacttgaccggtgagtttcctggtgattacggatgggaca 449

                                                                     
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttat 357
           | |||||||| || |||||||| || || ||| | |||||||||||||||||||||||
Sbjct: 450 ctgctggactttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttat 507



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  107 bits (54), Expect = 3e-20
 Identities = 141/170 (82%)
 Strand = Plus / Plus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| ||||||| ||| | ||||||||| | || |||||||| || ||||| ||||||
Sbjct: 1156 ggcccattctctggtgagtctccaagctacttgactggtgagtttcctggtgattacggg 1215

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            |||||||| || ||||| || ||||| || || || ||| | ||||||||||||||||||
Sbjct: 1216 tgggacactgccggactttcagctgatccagaaacattcgccaagaaccgtgagttggag 1275

                                                              
Query: 353  gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
            || ||||||||| | ||||| |||||||| || || ||||| || |||||
Sbjct: 1276 gtgatccactgcagatgggccatgcttggagctcttggttgtgtcttccc 1325



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 272 gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
           |||||||||||||||||||| |||||||| || ||||||||||||||||| ||||| |||
Sbjct: 217 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 276

                                                        
Query: 332 tcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           || |||||||||||| | || || ||||||| | | |||||||||
Sbjct: 277 tccaagaaccgtgagcttgaagtcatccactccagatgggctatg 321



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  105 bits (53), Expect = 1e-19
 Identities = 134/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||||||||||||||||||||| |||||||| |||||||| || || ||||| || |||
Sbjct: 163 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggac 222

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           |||||||| ||  | |||||||| ||| | ||||| ||||||||||| ||||| ||||| 
Sbjct: 223 cccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgggcaatgctg 282

                                                    
Query: 380 ggcgcactgggttgcgtgttccctgagttgctggcccgcaa 420
           || || || || ||||| ||||| ||| | || ||||||||
Sbjct: 283 ggtgctctcggctgcgtcttccccgagctccttgcccgcaa 323



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 298 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 357

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 358 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 417

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 418 ctgggttgcgttttccc 434



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  105 bits (53), Expect = 1e-19
 Identities = 125/149 (83%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| |||| || ||||||||||||||| | |||||||| |||||||||||||| || 
Sbjct: 184 ggcccattctccggtgagcccccaagctacttgaccggtgaattccccggtgactatggc 243

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| || |||||||| |||||||| || |||||  | |||||||||||| | || 
Sbjct: 244 tgggacactgccggactctcagctgacccagaaacctttgccaagaaccgtgagctcgaa 303

                                        
Query: 353 gttatccactgccgctgggctatgcttgg 381
           || |||||||   | ||||||||||||||
Sbjct: 304 gtgatccactcaagatgggctatgcttgg 332



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                        
Query: 272  gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
            |||||||||||||||||||| |||||||| || ||||||||||||||||| ||||| |||
Sbjct: 1533 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 1592

                                                         
Query: 332  tcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
            || |||||||||||| | || || ||||||| | | |||||||||
Sbjct: 1593 tccaagaaccgtgagcttgaagtcatccactccagatgggctatg 1637



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score =  105 bits (53), Expect = 1e-19
 Identities = 173/213 (81%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 356 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 415

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||||
Sbjct: 476 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggct 535

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 536 atgctcggagccctaggctgcgtcttccctgag 568



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                        
Query: 266  accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
            |||||||||||||||||||||||||||||||||||||| || || || || || || |||
Sbjct: 1376 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 1435

                                                                        
Query: 326  accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
            || ||  |||||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 1436 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 1495

                             
Query: 386  ctgggttgcgtgttccc 402
            ||||||||||| |||||
Sbjct: 1496 ctgggttgcgttttccc 1512



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                        
Query: 272  gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
            |||||||||||||||||||| |||||||| || ||||||||||||||||| ||||| |||
Sbjct: 935  gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 994

                                                         
Query: 332  tcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
            || |||||||||||| | || || ||||||| | | |||||||||
Sbjct: 995  tccaagaaccgtgagcttgaagtcatccactccagatgggctatg 1039



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                        
Query: 272  gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
            |||||||||||||||||||| |||||||| || ||||||||||||||||| ||||| |||
Sbjct: 1236 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 1295

                                                         
Query: 332  tcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
            || |||||||||||| | || || ||||||| | | |||||||||
Sbjct: 1296 tccaagaaccgtgagcttgaagtcatccactccagatgggctatg 1340



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                        
Query: 272  gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
            ||||||||||| |||||||||||||||||||| || ||||| || ||||| |||||||||
Sbjct: 950  gagttccccggcgactacgggtgggacacggccggcctctccgccgacccggagaccttc 1009

                                                                 
Query: 332  tcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgc 384
             | |||||||| ||| ||||||| |||||| |||| ||||| ||||| |||||
Sbjct: 1010 gccaagaaccgcgagctggaggtcatccacagccggtgggccatgctcggcgc 1062



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  103 bits (52), Expect = 5e-19
 Identities = 154/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||||||||||||   |||||| |||||||||||||| || |||||||| 
Sbjct: 419 ggcccattctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggc 478

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| ||||| || || || ||||| || |||||| | |||||||||||  | || 
Sbjct: 479 tgggacactgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaa 538

                                                                       
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctg 412
           || ||||||| | | ||||| ||||| || ||  |||| ||||| ||||| |||||||||
Sbjct: 539 gtgatccactccaggtgggccatgctcggagccttgggctgcgtcttcccggagttgctg 598

                   
Query: 413 gcccgcaa 420
            |||||||
Sbjct: 599 tcccgcaa 606



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  103 bits (52), Expect = 5e-19
 Identities = 103/120 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| ||||||||||| |||||||||||||||||||| || |||   || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                                       
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgct 378
           ||||||||||||| | |||||||| ||| ||||||| |||||| | |||||||| |||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatccacgggcgctgggcgatgct 497



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 252 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 311

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 312 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 371

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 372 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 418



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           |||| |||||||| || ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 13  tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||  | | |||||||||| | || |||||||
Sbjct: 73  cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 133 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 179



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 238 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 297

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 298 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 357

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 358 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 238 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 297

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 298 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 357

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 358 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 185 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 244

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 245 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 304

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 305 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 237 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 296

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 297 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 356

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 357 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 403



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 185 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 244

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 245 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 304

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 305 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 231 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 290

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 291 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 350

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 351 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 397



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 237 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 296

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 297 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 356

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 357 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 403



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 223 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 282

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 283 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 342

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 343 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 389



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score =  101 bits (51), Expect = 2e-18
 Identities = 138/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 330 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 389

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 390 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 449

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 450 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 496



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score =  101 bits (51), Expect = 2e-18
 Identities = 120/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| || ||||| ||||||||||| ||||| |||||||| ||||||||||| ||||||
Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || || || ||| | |||||||||||| | ||||| ||||||||| | ||||| ||||||
Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgctt 345

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           || || || || ||||| |||||
Sbjct: 346 ggtgcccttggatgcgttttccc 368



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 131/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||| |||||||||||||||||||| || 
Sbjct: 207 ggcgagccgccatcctacttgaccggtgagttcccgggtgactacgggtgggacactgcg 266

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  |||||||| | || ||||| || |||||||||
Sbjct: 267 gggctttcggcggatccggagacttttgcgaagaacagagaattggaagtgatccactgc 326

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 327 cggtgggcaatgctgggcgctctgggttgcgttttccc 364



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 158/194 (81%)
 Strand = Plus / Plus

                                                                       
Query: 227 tacctcggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgac 286
           |||||||||||  |||| |||||| ||||    ||||||||||| |||||| |||| |||
Sbjct: 80  tacctcggccccttctccggcgaggccccctcatacctcaccggcgagttcgccggcgac 139

                                                                       
Query: 287 tacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgag 346
           ||||| |||||||| || || ||||| || ||||||||||||||| | |||||||| |||
Sbjct: 140 tacggctgggacaccgccgggctctccgccgaccccgagaccttcgccaagaaccgcgag 199

                                                                       
Query: 347 ttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            ||||||| ||||||    | ||||| ||||| ||||| || || ||||| ||||| |||
Sbjct: 200 ctggaggtgatccacgcgaggtgggccatgctcggcgcgctcggctgcgtcttccccgag 259

                         
Query: 407 ttgctggcccgcaa 420
            |||| ||||||||
Sbjct: 260 ctgctcgcccgcaa 273



to top

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 104/122 (85%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           |||||||||||||||||||| |||||||| || |||||||| ||||||||||| ||||||
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| | |  ||||||||  | ||||| ||||| ||||| ||||| ||||||
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgctt 380

             
Query: 380 gg 381
           ||
Sbjct: 381 gg 382



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 137/166 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||| | || |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 252 tctctggcgagtcacccagctaccttaccggagagttccctggagactacggatgggaca 311

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | ||||| || || |||||||||||||| ||| | | |||||||||| | || |||||||
Sbjct: 312 cagctggtctatccgctgaccccgagacattcgcaaggaaccgtgagctagaagttatcc 371

                                                         
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctga 405
           || || | ||||| ||||| || || || || ||||| ||||||||
Sbjct: 372 acagcaggtgggccatgctcggagccctaggctgcgtcttccctga 417



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 110/130 (84%)
 Strand = Plus / Plus

                                                                       
Query: 252 ccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactct 311
           ||||||||||| | |||||||| ||||||||||| ||||||||||| || |||||||| |
Sbjct: 256 ccccaagctacttgaccggtgaattccccggtgattacgggtgggatactgctggacttt 315

                                                                       
Query: 312 ctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctggg 371
           | || ||||| || |||||  | |||||||||||  | ||||| ||||||||| | ||||
Sbjct: 316 cagcagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatggg 375

                     
Query: 372 ctatgcttgg 381
           ||||||||||
Sbjct: 376 ctatgcttgg 385



to top

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| ||||| ||||||||||| 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| ||| | |||||||||||||| || || || || || |||||||||
Sbjct: 295 gtgatccattgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 348



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 140/170 (82%)
 Strand = Plus / Plus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| ||||||| ||| ||||||||||| | || ||||||||||| ||||| || || 
Sbjct: 1631 ggcccattctctggtgagtccccaagctacttgacgggtgagttccctggtgattatgga 1690

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            |||||||| |||||||| || ||||| || || || ||  | ||||||||||||||||||
Sbjct: 1691 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 1750

                                                              
Query: 353  gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
            || ||||| ||| | ||||| |||||||| || || ||||| || |||||
Sbjct: 1751 gtgatccattgcagatgggccatgcttggagctcttggttgtgtcttccc 1800



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 139 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 198

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 319 atgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 174 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 233

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 354 atgctcggagccctaggctgcgtcttccctgag 386



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 189 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 248

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 369 atgctcggagccctaggctgcgtcttccctgag 401



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 194 ggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgagccc 253
           |||||||||||||||||| |||| || ||    ||| | || ||| ||||||||||  | 
Sbjct: 85  ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 144

                                                                       
Query: 254 ccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctct 313
           || |||||||| ||||| ||||||||||| |||||||| |||||||| || ||||| || 
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 314 gctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggct 373
           |||||||||||||| ||| | | |||||||||  | || ||||||||| || | ||||| 
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                                            
Query: 374 atgcttggcgcactgggttgcgtgttccctgag 406
           ||||| || || || || ||||| |||||||||
Sbjct: 265 atgctcggagccctaggctgcgtcttccctgag 297



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                        
Query: 269  ggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagacc 328
            ||||||||||| ||||| |||||||||||||| |||||||| || |||||||| ||||| 
Sbjct: 945  ggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagagaca 1004

                                                                 
Query: 329  ttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttgg 381
            ||| | | |||||||||| | ||||| ||||| ||||| ||||| ||||||||
Sbjct: 1005 ttcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgcttgg 1057



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 125/149 (83%), Gaps = 1/149 (0%)
 Strand = Plus / Minus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| ||||| ||||||||||||
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                                        
Query: 353 gttatccactgccgctgggctatgcttgg 381
           || ||||||||| | ||| ||||||||||
Sbjct: 498 gtgatccactgcagatgg-ctatgcttgg 471



to top

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| |||||||||  ||||||||| ||||| ||||| |||||||| || 
Sbjct: 117 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 176

                                                                
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtga 345
           |||||||| ||||| || ||||||||||| ||||||||  | |||||||||||
Sbjct: 177 tgggacactgctgggctttctgctgacccagagacctttgccaagaaccgtga 229



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 124/149 (83%)
 Strand = Plus / Plus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| |||| || ||| ||||||||||| | |||||||| || ||||||||||| |||
Sbjct: 4509 ggcccattctccggtgagtccccaagctacttgaccggtgaatttcccggtgactatggg 4568

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            ||||| || |||||||| || || || || || |||||  | |||||||||||| | |||
Sbjct: 4569 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgagctcgag 4628

                                         
Query: 353  gttatccactgccgctgggctatgcttgg 381
            || ||||||||| | ||||||||||||||
Sbjct: 4629 gtgatccactgcagatgggctatgcttgg 4657



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Plus

                                                                        
Query: 233  ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
            |||||| |||| || ||| ||||||||||| | |||||||| ||||| ||||| ||||||
Sbjct: 7049 ggcccattctccggtgaggccccaagctacttgaccggtgaattcccaggtgattacggg 7108

                                                                        
Query: 293  tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
            ||||| || |||||||| || || || || || |||||  | |||||||||||  | |||
Sbjct: 7109 tgggatactgctggactttcagcggatccagaaacctttgccaagaaccgtgaactcgag 7168

                                                                  
Query: 353  gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
            || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 7169 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 7222



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                        
Query: 269  ggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagacc 328
            ||||| ||||| |||||||| |||||||| || |||||||| || || ||||| || || 
Sbjct: 2092 ggtgaattccctggtgactatgggtgggatactgctggactttcagccgacccagaaact 2151

                                                                 
Query: 329  ttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttgg 381
            ||  | |||||||||||  | ||||| || |||||| | ||||||||||||||
Sbjct: 2152 tttgccaagaaccgtgaactcgaggtgattcactgcagatgggctatgcttgg 2204



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 375 gccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 313 gccatgctcggagccctaggctgcgttttccctgag 348



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 375 gccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 375 gccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 375 gccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 375 gccatgctcggagccctaggctgcgttttccctgag 410



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 433 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 492

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 493 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 552

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 553 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 612

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 613 gccatgctcggagccctaggctgcgttttccctgag 648



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 174/216 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tccggcagcccatggtacggagctgatcgcgtgctctacctcggcccactctctggcgag 250
           ||||||||||||||||||||| | || || ||    ||| | || ||| |||| || |||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 251 cccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggctggactc 310
           || || ||||||||||| || |||||||||||||| |||||||||||||| || || || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 311 tctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgg 370
           || || || |||||||||||| | | |||||||||| | || ||||||||| || | |||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                                               
Query: 371 gctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||| || || || || ||||| |||||||||
Sbjct: 313 gccatgctcggagccctaggctgcgttttccctgag 348



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           |||| |||||||| || |||||||| ||||| ||||||||||||||||| || |||||||
Sbjct: 13  tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | || || || || ||||| || ||||||||| | | |||||||||| | || |||||||
Sbjct: 73  ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132

                                                          
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || || | ||||| ||||| || || || || ||||| |||||||||
Sbjct: 133 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 179



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacgg 302
           ||||||||||||| |||||||| || || |||||||||||||||||||| |||||||| |
Sbjct: 181 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 240

                                                                       
Query: 303 ctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccact 362
           | || || || |||||||| |||||||||  |    |||| ||| ||||| | |||||| 
Sbjct: 241 ccggtctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 300

                                                              
Query: 363 gccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctgg 413
            ||||||||| ||||| ||||| ||||| ||| | ||||| ||| ||||||
Sbjct: 301 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgg 351



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 80/91 (87%)
 Strand = Plus / Plus

                                                                       
Query: 272 gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
           |||||||| ||||||||||| |||||||| |||||||| ||||||||||| ||||| |||
Sbjct: 269 gagttcccaggtgactacggttgggacactgctggactttctgctgacccagagacattc 328

                                          
Query: 332 tcgaagaaccgtgagttggaggttatccact 362
            | |||||||||||| | || ||||||||||
Sbjct: 329 gccaagaaccgtgagcttgaagttatccact 359



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 140/171 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 ctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacgg 302
           ||||||||||||| |||||||| || || |||||||||||||||||||| |||||||| |
Sbjct: 241 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 182

                                                                       
Query: 303 ctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccact 362
           | || || || |||||||| |||||||||  |    |||| ||| ||||| | |||||| 
Sbjct: 181 ccggcctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 122

                                                              
Query: 363 gccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctgg 413
            ||||||||| ||||| ||||| ||||| ||| | ||||| ||| ||||||
Sbjct: 121 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgg 71



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||| |||||||||||||||||||| || 
Sbjct: 196 ggcgagccgccatcctacttgaccggtgagttcccgggtgactacgggtgggacacwgcg 255

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  |||||||| | ||  |||| || |||||||||
Sbjct: 256 gggctttcggcggatccggagacttttgcgaagaacagagaactggaagtgatccactgc 315

                                                              
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctggcc 415
           || ||||| ||||| ||||| ||||||||||| ||||| ||| | ||||||
Sbjct: 316 cggtgggcaatgctgggcgctctgggttgcgttttcccggagcttctggcc 366



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||||||||||||||||||||||||||| || || || || || 
Sbjct: 303 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcggcggat 362

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| |||||||| | ||| |||| || ||||||| ||| ||||| ||||| 
Sbjct: 363 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgctg 422

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           ||||| || || ||||| |||||
Sbjct: 423 ggcgctctcgggtgcgtattccc 445



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||||||||||||||||||||||||||| || || || || || 
Sbjct: 296 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcggcggat 355

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| |||||||| | ||| |||| || ||||||| ||| ||||| ||||| 
Sbjct: 356 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgctg 415

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           ||||| || || ||||| |||||
Sbjct: 416 ggcgctctcgggtgcgtattccc 438



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| ||||||| |||||||||||||||||| |||||||| ||||| ||||||||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                      
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgct 378
           || || || ||| | |||||||||||| | ||||| |||||| || | ||||| |||||
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgct 151



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 140/171 (81%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacgg 302
           ||||||||||||| |||||||| || || |||||||||||||||||||| |||||||| |
Sbjct: 165 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 224

                                                                       
Query: 303 ctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccact 362
           | || || || |||||||| |||||||||  |    |||| ||| ||||| | |||||| 
Sbjct: 225 ccggtctgtccgctgacccggagaccttcaagcgctaccgcgagctggagctgatccacg 284

                                                              
Query: 363 gccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctgg 413
            ||||||||| ||||| ||||| ||||| ||| | ||||| ||| ||||||
Sbjct: 285 cccgctgggccatgctcggcgctctgggctgcatcttccccgagctgctgg 335



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| || || ||||| ||||||
Sbjct: 219 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 278

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || || ||  | |||||||||||  | |||
Sbjct: 279 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgag 338

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 339 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 392



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||| |||||||||||||||||||| || 
Sbjct: 207 ggcgagccgccatcctacttgaccggtgagttcccgggtgactacgggtgggacactgcg 266

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  |||||||| | ||  |||| || |||||||||
Sbjct: 267 gggctttcggcggatccggagacttttgcgaagaacagagaactggaagtgatccactgc 326

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 327 cggtgggcaatgctgggcgctctgggttgcgttttccc 364



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||||||||||||||||||| | |||||||||||||| || |||||||| 
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                 
Query: 293 tgggacacggctggactctctgctgaccccgagacctt 330
           |||||||| || || || || |||||||| || |||||
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctt 269



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| |||||||||  ||||||||| ||||| ||||| |||||||| || 
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                 
Query: 293 tgggacacggctggactctctgctgaccccgagacctt 330
           |||||||| ||||| || ||||||||||| ||||||||
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctt 599



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||| ||| | |||||||| ||||| |||||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgaccggtgaattccctggtgactatggc 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || |||||  | |||||||||||  | |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactagag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 295 gtgatccactgcaggtgggctatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 142/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||| ||| | || ||||| ||||| |||||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgactggtgaattccctggtgactatgga 234

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| ||||||||  | |||||||||||  | |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgagacctttgccaagaaccgtgaacttgag 294

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 295 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 78/89 (87%)
 Strand = Plus / Plus

                                                                       
Query: 243 ctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacgg 302
           ||||||||||||| |||||||| || || |||||||||||||||||||| |||||||| |
Sbjct: 179 ctggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccg 238

                                        
Query: 303 ctggactctctgctgaccccgagaccttc 331
           | || || || |||||||| |||||||||
Sbjct: 239 ccggtctgtccgctgacccggagaccttc 267



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||| ||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || ||||||||||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcgcy 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  |||||||| | ||  |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgctgggcgct 347

                            
Query: 386 ctgggttgcgtgttccc 402
           ||||||||||| |||||
Sbjct: 348 ctgggttgcgttttccc 364



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 224 ctctacctcggcccactctctggcgagcccccaagctacctcaccggtgagttccccggt 283
           |||||||| |||||| |||||||    ||||||  ||||||||| ||||||||||| |||
Sbjct: 687 ctctacctgggcccattctctggttctcccccatcctacctcactggtgagttccctggt 746

                                                                       
Query: 284 gactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgt 343
           ||||| ||||||||||| ||||| || || || ||||| ||||||||| | |||||| | 
Sbjct: 747 gactatgggtgggacacagctggtctgtccgcagacccagagaccttcgccaagaacagg 806

                            
Query: 344 gagttggaggttatcca 360
           ||| ||||||| |||||
Sbjct: 807 gagctggaggtgatcca 823



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| ||||| || ||||||||||||||||| |||||||| |||||||| || ||||||
Sbjct: 517 tacctgaccggagaattccccggtgactacggatgggacactgctggactatcagctgac 576

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || || |||||| | | |||||| ||| ||||||| || ||| || | ||||| ||||||
Sbjct: 577 ccggaaaccttcgccaggaaccgggagctggaggtgattcacagcagatgggccatgctt 636

                   
Query: 380 ggcgcact 387
           || |||||
Sbjct: 637 ggtgcact 644



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 128/156 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| ||||| ||||||||||| |||||||||||||| || || ||  |||| || |||
Sbjct: 232 tacctgaccggcgagttccccggcgactacgggtgggagaccgccggcgtctcggccgac 291

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| ||   ||||| ||| ||||||| ||||||| ||| ||||| ||||| 
Sbjct: 292 ccggagacattcgcgcgcaaccgggagctggaggtgatccactcccggtgggcgatgctg 351

                                               
Query: 380 ggcgcactgggttgcgtgttccctgagttgctggcc 415
           ||||| ||||| ||||||||||| ||| | ||||||
Sbjct: 352 ggcgcgctgggctgcgtgttcccggagatcctggcc 387



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           |||||||| ||||| ||||| |||||||| || |||||||| ||||| ||||| ||||||
Sbjct: 264 tacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagctgac 323

                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactg 363
           |||||||| ||  | |||||||||||| | ||||| ||||||||
Sbjct: 324 cccgagacttttgctaagaaccgtgagcttgaggtgatccactg 367



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| | |||  |||||| |||||||| || |||||||||||||| 
Sbjct: 193 ggcccattctctggtgagtcgccatcctaccttaccggtgaatttcccggtgactacggc 252

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| ||||| || || |||||||| ||||| ||  | |||||||||||| | |||
Sbjct: 253 tgggacactgctgggctttcggctgaccctgagacttttactaagaaccgtgagctcgag 312

                                   
Query: 353 gttatccactgccgctgggctatg 376
           || || || ||||| |||||||||
Sbjct: 313 gtgattcattgccgatgggctatg 336



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 148/183 (80%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| |||| |||||||| || |||||||| |||||  |||||||||| |||||||| 
Sbjct: 250 ggcccattctccggcgagccaccgagctaccttaccggacagttccccggagactacgga 309

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| || || ||||| || |  |||||||| |||  || |||||||||| | || 
Sbjct: 310 tgggacaccgcaggtctctcagccgtacccgagacgttcgtgaggaaccgtgagctagaa 369

                                                                       
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgagttgctg 412
           |||||||||||| | ||||| ||||| || || || || ||||| ||||| ||| || ||
Sbjct: 370 gttatccactgcaggtgggccatgctcggtgccctaggctgcgtcttcccggagctgttg 429

              
Query: 413 gcc 415
           |||
Sbjct: 430 gcc 432



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 133/163 (81%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||| ||| | ||||| ||| | || ||||| ||||| |||||||| || |||||||
Sbjct: 255 tctctggtgagtctccaagttacttgacgggtgaattccctggtgactatggatgggaca 314

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| || || || ||  | ||||| |||||||||||||| ||||
Sbjct: 315 ctgctggactttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatcc 374

                                                      
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccc 402
           ||||| | |||||||||||||| || || ||||| || |||||
Sbjct: 375 actgcagatgggctatgcttggagctcttggttgtgtcttccc 417



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| ||||| ||||||||||| |||||||| |||||||| ||||| || || || |||
Sbjct: 253 tacctgaccggagagttccccggcgactacggatgggacactgctgggctgtcggcggac 312

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| | | |||||||||| ||||||| |||||||   | ||||| ||||| 
Sbjct: 313 ccagagactttcgccaggaaccgtgagctggaggtgatccactcgaggtgggccatgctc 372

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           ||||| || |||||||| |||||
Sbjct: 373 ggcgctctcggttgcgtcttccc 395



to top

>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100
           (LHCB2.1) mRNA, complete cds
          Length = 1068

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 262 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 321

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 322 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 379



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||| || |||||||||||||| || |||||| | || ||||||
Sbjct: 745 tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||  | |||||||||||| | ||||| ||||||||  | ||||||||||||
Sbjct: 805 ccagagacatttgccaagaaccgtgagcttgaggtgatccactgtaggtgggctatgctt 864

             
Query: 380 gg 381
           ||
Sbjct: 865 gg 866



to top

>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence
          Length = 1047

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 347 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 406

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 407 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 464



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Plus

                                                                       
Query: 245 ggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggacacggct 304
           |||||||| |||  |||| | |||||||||||||| ||||||||||||||||||||||| 
Sbjct: 204 ggcgagccgccatcctacttgaccggtgagttcccaggtgactacgggtgggacacggcg 263

                                                                       
Query: 305 ggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatccactgc 364
           || || || || || || ||||| ||  ||| |||| | ||  |||| || |||||| ||
Sbjct: 264 gggctttcggcggatccggagacttttgcgaggaacagagaactggaagtgatccacagc 323

                                                 
Query: 365 cgctgggctatgcttggcgcactgggttgcgtgttccc 402
           || ||||| ||||| ||||| ||||||||||| |||||
Sbjct: 324 cggtgggcaatgctgggcgccctgggttgcgttttccc 361



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  | |||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 288 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 347

                                         
Query: 386 ctgggttgcgtgttccctgagttgctggcc 415
           ||||| ||||| ||||| ||| | ||||||
Sbjct: 348 ctgggctgcgttttcccggagctcctggcc 377



to top

>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete
            sequence
          Length = 13145

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 259  ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
            |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 5600 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 5541

                                                                      
Query: 319  ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
            ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 5540 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 5483



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||| || ||||| ||||||||||| |||||||| || ||||||
Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||  | |||||||||||| | || || |||||| || | ||||| ||||||
Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgctt 343

                                     
Query: 380 ggcgcactgggttgcgtgttccctga 405
           || ||||| || || || ||||||||
Sbjct: 344 ggtgcactaggctgtgtcttccctga 369



to top

>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 1001

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 260 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 319

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 320 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 377



to top

>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 943

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 255 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 314

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 315 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 372



to top

>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS37ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 980

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 240 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 299

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 300 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 357



to top

>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS18ZH11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 912

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 283 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 340



to top

>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 859

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 238 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 297

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 298 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 355



to top

>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 941

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 238 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 297

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 298 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 355



to top

>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZD09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 964

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 252 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 311

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 312 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 369



to top

>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 914

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 221 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 280

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 281 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 338



to top

>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 917

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 283 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 340



to top

>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 922

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 283 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 340



to top

>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 243 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 302

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 303 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 360



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 ggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagacc 328
           ||||| ||||| ||||||||||| |||||||| |||||||| || || ||||| ||||| 
Sbjct: 211 ggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgagaca 270

                                                                       
Query: 329 ttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgcactg 388
           ||  |||| ||| ||||| | ||||| |||||| |||| ||||| |||||||| ||||||
Sbjct: 271 tttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtgcactg 330

             
Query: 389 gg 390
           ||
Sbjct: 331 gg 332



to top

>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds
          Length = 967

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 250 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 309

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 310 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 367



to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 259 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 318

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||||||| | || || |||||| || | |||||||||
Sbjct: 319 cccggagacattcgctaagaaccgtgagcttgaagtaatccacagcagatgggctatg 376



to top

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||| ||||||||||| |||||||| |||||| | || ||||||
Sbjct: 258 tacctgaccggtgaattccctggtgactacggatgggacacagctggattatcagctgac 317

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || || |||||  | | |||||||||||||||||| || ||| || | ||||| ||||||
Sbjct: 318 cctgaaacctttgccaggaaccgtgagttggaggtgattcacagcagatgggccatgctt 377

             
Query: 380 gg 381
           ||
Sbjct: 378 gg 379



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 272 gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
           |||||||| ||||||||||| |||||||| |||||||| || || ||||| || ||||||
Sbjct: 289 gagttccctggtgactacggttgggacactgctggactatcagcagaccctgaaaccttc 348

                                                                       
Query: 332 tcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgcactgggt 391
            | |||||||||||| | ||||| |||||||   | ||||| |||||||| || ||||| 
Sbjct: 349 gctaagaaccgtgagctcgaggtgatccactctaggtgggcaatgcttggtgccctggga 408

                         
Query: 392 tgcgtgttccctga 405
           || || ||||||||
Sbjct: 409 tgtgtattccctga 422



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 262 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 321

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  | |||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 322 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 381

                                         
Query: 386 ctgggttgcgtgttccctgagttgctggcc 415
           ||||| ||||| ||||| ||| | ||||||
Sbjct: 382 ctgggctgcgttttcccggagctcctggcc 411



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 123/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| ||||||||||||||||||||||| || || || || || || |||
Sbjct: 259 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 318

                                                                       
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgca 385
           || ||  | |||||| | ||| |||| || |||||| |||| ||||| ||||| ||||| 
Sbjct: 319 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgct 378

                                         
Query: 386 ctgggttgcgtgttccctgagttgctggcc 415
           ||||| ||||| ||||| ||| | ||||||
Sbjct: 379 ctgggctgcgttttcccggagctcctggcc 408



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 272 gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
           |||||||| ||||||||||| |||||||| |||||||| ||||||||||| ||||| |||
Sbjct: 268 gagttcccaggtgactacggatgggacactgctggactttctgctgacccagagacattc 327

                         
Query: 332 tcgaagaaccgtga 345
            | |||||||||||
Sbjct: 328 gccaagaaccgtga 341



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           |||||||| |||||||| || ||||| ||||| |||||||| ||||| || |||||||| 
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           |||||||| ||| | |||||||||||| | ||||| || ||| || | ||||| ||||||
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgctt 347

             
Query: 380 gg 381
           ||
Sbjct: 348 gg 349



to top

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                         
Query: 260   tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
             ||||| || ||||| ||||| ||||||||||| |||||||| |||||| | || ||||||
Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166

                                                                         
Query: 320   cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
             ||||| |||||| | |||||||||||| | ||||| || ||| || | ||||| ||||||
Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgctt 40226

               
Query: 380   gg 381
             ||
Sbjct: 40227 gg 40228



to top

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           |||||||| || || ||||| ||||| ||||| |||||||| ||||| ||||| ||||||
Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||||||  | |||||||||||| | || |||||||| |   | ||||| ||||||
Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccattcaagatgggccatgctt 662

                                     
Query: 380 ggcgcactgggttgcgtgttccctga 405
           || || ||||| ||||| ||||||||
Sbjct: 663 ggtgctctgggctgcgttttccctga 688



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | |||||||| || || ||||| ||||||
Sbjct: 365 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 424

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| || || ||  | |||||||||||  | || 
Sbjct: 425 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgaa 484

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||| | |||||||||||||| || || || || || |||||||||
Sbjct: 485 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 538



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 117/142 (82%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||| ||| | ||||||||| | || ||||||||||| |||||||| || ||||| |
Sbjct: 624 tctctggtgagtctccaagctacttgactggtgagttccctggtgactatggatgggata 683

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| || || || ||  | |||||||||||||||||||| ||||
Sbjct: 684 ctgctggactttcagctgatcctgaaacttttgccaagaaccgtgagttggaggtgatcc 743

                                 
Query: 360 actgccgctgggctatgcttgg 381
           ||||  | ||||| ||||||||
Sbjct: 744 actgtagatgggccatgcttgg 765



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 279 ccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaaga 338
           |||| |||||||||||||||||||| || || || || ||||| ||||| ||| ||  ||
Sbjct: 1   ccggcgactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgcgga 60

                                                                       
Query: 339 accgtgagttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgt 398
           |||| ||| ||||||| |||||||  || ||||| ||||| ||||| ||||| |||||||
Sbjct: 61  accgcgagctggaggtgatccactcgcggtgggcgatgctgggcgcgctggggtgcgtgt 120

                            
Query: 399 tccctgagttgctggcc 415
           |||| ||| | ||||||
Sbjct: 121 tcccggagatcctggcc 137



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 125/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 179 aagcaggtttcctccggcagcccatggtacggagctgatcgcgtgctctacctcggccca 238
           |||||||  |||||||| ||||||||||||||  | || |||||    ||| | ||||||
Sbjct: 146 aagcaggcctcctccggaagcccatggtacggcccagaccgcgtcaagtacttgggccca 205

                                                                       
Query: 239 ctctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggac 298
            ||||||||||||||||   ||||||||| || |||||||| ||||||||||| ||||||
Sbjct: 206 ttctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggctgggac 265

                                            
Query: 299 acggctggactctctgctgaccccgagaccttc 331
           || ||||| || || || ||||| || ||||||
Sbjct: 266 actgctgggctttcggccgacccagaaaccttc 298



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           |||||||||||||| |||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 402 accggtgagttccctggtgactatggttgggacactgctggactctcagctgatcccgag 461

                
Query: 326 acctt 330
           |||||
Sbjct: 462 acctt 466



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 279 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 338

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 339 gaaccgtgagcttgaagtaatccacagcagatgggctatg 378



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 277  ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
            |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 1861 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 1802

                                                    
Query: 337  gaaccgtgagttggaggttatccactgccgctgggctatg 376
            |||||||||| | || || |||||| || | |||||||||
Sbjct: 1801 gaaccgtgagcttgaagtaatccacagcagatgggctatg 1762



to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 219 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 278

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 279 gaaccgtgagcttgaagtaatccacagcagatgggctatg 318



to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                         
Query: 277   ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
             |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 81584 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 81525

                                                     
Query: 337   gaaccgtgagttggaggttatccactgccgctgggctatg 376
             |||||||||| | || || |||||| || | |||||||||
Sbjct: 81524 gaaccgtgagcttgaagtaatccacagcagatgggctatg 81485



to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 219 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 278

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 279 gaaccgtgagcttgaagtaatccacagcagatgggctatg 318



to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 279 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 338

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 339 gaaccgtgagcttgaagtaatccacagcagatgggctatg 378



to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 277 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 336

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 337 gaaccgtgagcttgaagtaatccacagcagatgggctatg 376



to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 260 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 319

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 320 gaaccgtgagcttgaagtaatccacagcagatgggctatg 359



to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 268 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 327

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 328 gaaccgtgagcttgaagtaatccacagcagatgggctatg 367



to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 262 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 321

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 322 gaaccgtgagcttgaagtaatccacagcagatgggctatg 361



to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 267 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 326

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 327 gaaccgtgagcttgaagtaatccacagcagatgggctatg 366



to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 255 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 314

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 315 gaaccgtgagcttgaagtaatccacagcagatgggctatg 354



to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 269 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 328

                                                   
Query: 337 gaaccgtgagttggaggttatccactgccgctgggctatg 376
           |||||||||| | || || |||||| || | |||||||||
Sbjct: 329 gaaccgtgagcttgaagtaatccacagcagatgggctatg 368



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                         
Query: 260   tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
             ||||| ||||| |||||||| || |||||||||||||||||||| || || || || |||
Sbjct: 79568 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 79509

                                                                         
Query: 320   cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
             || ||||| ||| ||| |||| | ||| ||||||| |||||||  || ||||| ||||| 
Sbjct: 79508 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 79449

                                    
Query: 380   ggcgcactgggttgcgtgttccc 402
             || || ||||| ||||| |||||
Sbjct: 79448 ggggcgctgggctgcgtcttccc 79426



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                            
Query: 260      tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
                ||||| ||||| |||||||| || |||||||||||||||||||| || || || || |||
Sbjct: 21808248 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21808307

                                                                            
Query: 320      cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
                || ||||| ||| ||| |||| | ||| ||||||| |||||||  || ||||| ||||| 
Sbjct: 21808308 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 21808367

                                       
Query: 380      ggcgcactgggttgcgtgttccc 402
                || || ||||| ||||| |||||
Sbjct: 21808368 ggggcgctgggctgcgtcttccc 21808390



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 131     ctcttcggcgaggcccgcgtcaccat 156
               |||||||||||||||||| |||||||
Sbjct: 3503741 ctcttcggcgaggcccgcatcaccat 3503766



to top

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 114/139 (82%)
 Strand = Plus / Plus

                                                                       
Query: 282 gtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaacc 341
           |||| ||||| |||||||| ||||||||||| |||||||| || |||||  | |||||||
Sbjct: 1   gtgattacggttgggacactgctggactctcagctgacccagaaacctttgccaagaacc 60

                                                                       
Query: 342 gtgagttggaggttatccactgccgctgggctatgcttggcgcactgggttgcgtgttcc 401
           ||||| | ||||| ||||| ||| | ||||| ||| | |||||| | ||||| || ||||
Sbjct: 61  gtgagcttgaggtgatccattgcagatgggccatgttgggcgcattaggttgtgtattcc 120

                              
Query: 402 ctgagttgctggcccgcaa 420
           | |||||| | ||||||||
Sbjct: 121 cagagttgttagcccgcaa 139



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                            
Query: 260      tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
                ||||| ||||| |||||||| || |||||||||||||||||||| || || || || |||
Sbjct: 21801277 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21801336

                                                                            
Query: 320      cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
                || ||||| ||| ||| |||| | ||| ||||||| |||||||  || ||||| ||||| 
Sbjct: 21801337 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 21801396

                                       
Query: 380      ggcgcactgggttgcgtgttccc 402
                || || ||||| ||||| |||||
Sbjct: 21801397 ggggcgctgggctgcgtcttccc 21801419



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 131     ctcttcggcgaggcccgcgtcaccat 156
               |||||||||||||||||| |||||||
Sbjct: 3503852 ctcttcggcgaggcccgcatcaccat 3503877



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 272 gagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttc 331
           |||||||| |||||||| || |||||||| ||||| || ||||||||||| ||||| || 
Sbjct: 231 gagttcccaggtgactatggttgggacactgctgggctttctgctgacccagagacattt 290

                                                                       
Query: 332 tcgaagaaccgtgagttggaggttatccactgccgctgggctatgcttggcgcactgggt 391
            |||| ||||||||  ||||||| |||||| || | ||||||||| | || ||| |||| 
Sbjct: 291 gcgaaaaaccgtgaactggaggtaatccacagcaggtgggctatgttgggagcattggga 350

                      
Query: 392 tgcgtgttccc 402
           || ||||||||
Sbjct: 351 tgtgtgttccc 361



to top

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           ||||||||| ||||| ||||| |||||||| || |||||||| ||||| || ||||||||
Sbjct: 525 ctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgctga 584

                                      
Query: 319 ccccgagaccttctcgaagaaccgtga 345
           ||| ||||||||  | |||||||||||
Sbjct: 585 cccagagacctttgccaagaaccgtga 611



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| |||||||| ||||| ||||||||||||||||||||||| || || || || || 
Sbjct: 242 tacctaaccggtgaattcccgggtgactacgggtgggacacggcggggctgtcggcagat 301

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| |||||||| | ||| |||| || |||||| |||| ||||| ||| | 
Sbjct: 302 ccggagacgttcgcgaagaacagagagctggaagtgatccacggccgatgggccatgttg 361

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           || || ||||| ||||| |||||
Sbjct: 362 ggtgctctgggctgcgtattccc 384



to top

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                       
Query: 269  ggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgagac 327
            ||||||||||| ||||||||||| |||||||| ||||||||||| |||||||| |||||
Sbjct: 2322 ggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgagac 2380



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 126/155 (81%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||||||||| ||   ||||||||| || |||||||||||||| ||||| |||||||
Sbjct: 271 tctctggcgagccaccttcctacctcactggcgagttccccggtgattacggctgggaca 330

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||  | || || ||||| || |||||| | ||||| || ||| ||||||| ||||
Sbjct: 331 ctgctggcttgtcggcggacccagaaaccttcgctaagaatcgggagctggaggtcatcc 390

                                              
Query: 360 actgccgctgggctatgcttggcgcactgggttgc 394
           |||  || ||||| ||| | || ||||||||||||
Sbjct: 391 actcacggtgggccatgttgggtgcactgggttgc 425



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 tacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctgac 319
           ||||| ||||| |||||||| || |||||||||||||||||||| || || || || |||
Sbjct: 236 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 295

                                                                       
Query: 320 cccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatgctt 379
           || ||||| ||| ||| |||| | ||| ||||||| |||||||  || ||||| ||||| 
Sbjct: 296 ccggagacgttcgcgaggaacagggagctggaggtgatccactcgcggtgggcgatgctg 355

                                  
Query: 380 ggcgcactgggttgcgtgttccc 402
           || || ||||| ||||| |||||
Sbjct: 356 ggggcgctgggctgcgtcttccc 378



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           ||||| |||||||| ||||||||||| |||||||| |||||||| ||||| || || |||
Sbjct: 98  accggagagttcccaggtgactacggttgggacactgctggactttctgccgatccagag 157

                                                              
Query: 326 accttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           || ||  | |||||||||||| | || |||||||||| | | |||||||||
Sbjct: 158 acatttgccaagaaccgtgagcttgaagttatccactccagatgggctatg 208



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| |||||||||   ||||| || ||||| ||||| |||||||| || 
Sbjct: 163 ggcccattctctggtgagcccccatcttaccttactggtgaattccctggtgactatggc 222

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| ||||| || || |||||||| || |||||  | |||||||||||| | || 
Sbjct: 223 tgggacactgctgggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaa 282

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||| | | ||||| |||||||| || || || || || |||||||||
Sbjct: 283 gtgatccactccagatgggccatgcttggagctcttgggtgtgtcttccctgag 336



to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                       
Query: 277 ccccggtgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaa 336
           |||||| |||||||| |||||||| ||||||||||| |||||||| ||||| ||| | ||
Sbjct: 250 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 309

                     
Query: 337 gaaccgtgag 346
           ||||||||||
Sbjct: 310 gaaccgtgag 319



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 134/166 (80%)
 Strand = Plus / Plus

                                                                       
Query: 240 tctctggcgagcccccaagctacctcaccggtgagttccccggtgactacgggtgggaca 299
           ||||||| ||| | ||||||||| | || |||||||||||  ||||||| || ||||| |
Sbjct: 418 tctctggtgaggcaccaagctacttgactggtgagttccctagtgactatggatgggata 477

                                                                       
Query: 300 cggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggaggttatcc 359
           | |||||||| || ||||| || || || ||  | |||||||||||| ||||||| ||||
Sbjct: 478 ctgctggactttcggctgatcctgaaacttttgccaagaaccgtgagctggaggtcatcc 537

                                                         
Query: 360 actgccgctgggctatgcttggcgcactgggttgcgtgttccctga 405
           ||||  | ||||| |||||||| || || ||||| || ||||||||
Sbjct: 538 actgtagatgggccatgcttggagctcttggttgtgtcttccctga 583



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| ||| ||||||||||| | || ||||||||||| |||||||| || 
Sbjct: 299 ggcccattctctggtgaggccccaagctacttgactggtgagttccctggtgactatgga 358

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           ||||| || |||||||| || || ||||| |  || ||| | ||||||||  |  |||||
Sbjct: 359 tgggatactgctggactttcagccgacccagcaactttcgccaagaaccggaaactggag 418

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||||  | ||| | |||||||| || || |||||||| |||||||||
Sbjct: 419 gtaatccactgtagatggaccatgcttggagctcttggttgcgtcttccctgag 472



to top

>gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlorophyll a/b binding
           protein (At2g05100) mRNA, complete cds
          Length = 829

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 98/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 259 ctacctcaccggtgagttccccggtgactacgggtgggacacggctggactctctgctga 318
           |||||| ||||| || | |||||| |||||||| |||||||| ||||||||||| |||||
Sbjct: 201 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 260

                                                                     
Query: 319 ccccgagaccttctcgaagaaccgtgagttggaggttatccactgccgctgggctatg 376
           ||| ||||| ||| | |||||||| ||| | || || |||||| || | |||||||||
Sbjct: 261 cccggagacattcgctaagaaccgcgagcttgaagtaatccacagcagatgggctatg 318



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 266 accggtgagttccccggtgactacgggtgggacacggctggactctctgctgaccccgag 325
           ||||| |||||||||||||||||||| ||||| || ||||| || || ||||||||||||
Sbjct: 399 accggcgagttccccggtgactacggctgggataccgctggcctgtccgctgaccccgag 458

                 
Query: 326 accttc 331
           ||||||
Sbjct: 459 accttc 464



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 140/174 (80%)
 Strand = Plus / Plus

                                                                       
Query: 233 ggcccactctctggcgagcccccaagctacctcaccggtgagttccccggtgactacggg 292
           |||||| ||||||| |||||||||   ||||| || ||||| ||||| |||||||| || 
Sbjct: 219 ggcccattctctggtgagcccccatcttaccttactggtgaattccctggtgactatggc 278

                                                                       
Query: 293 tgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgtgagttggag 352
           |||||||| ||||| || || |||||||| || |||||  | |||||||||||| | || 
Sbjct: 279 tgggacactgctgggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaa 338

                                                                 
Query: 353 gttatccactgccgctgggctatgcttggcgcactgggttgcgtgttccctgag 406
           || ||||||| | | ||||| |||||||| || || || || || |||||||||
Sbjct: 339 gtgatccactccagatgggccatgcttggagctcttgggtgtgtcttccctgag 392


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,707,605
Number of Sequences: 3902068
Number of extensions: 2707605
Number of successful extensions: 53424
Number of sequences better than 10.0: 377
Number of HSP's better than 10.0 without gapping: 378
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 52600
Number of HSP's gapped (non-prelim): 798
length of query: 420
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 398
effective length of database: 17,147,199,772
effective search space: 6824585509256
effective search space used: 6824585509256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top