ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet07c11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK111521.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 1e-52
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 137 2e-29
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 137 2e-29
4emb|AL732381.3|CNS08C94 Oryza sativa chromosome 12, . BAC OJ1112... 137 2e-29
5emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa... 137 2e-29
6gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retro... 88 2e-14
7ref|NM_100804.2| Arabidopsis thaliana unknown protein AT1G09340 ... 56 7e-05
8gb|AY070022.1| Arabidopsis thaliana putative RNA-binding protein... 56 7e-05
9gb|AY035050.1| Arabidopsis thaliana putative RNA-binding protein... 56 7e-05
10gb|AY062570.1| Arabidopsis thaliana g5bf protein (At1g09340; T31... 56 7e-05
11gb|AF428282.1|AF428282 Arabidopsis thaliana At1g09340/T31J12_6 m... 56 7e-05
12gb|AF325043.2|AF325043 Arabidopsis thaliana At1g09340 (At1g09340... 56 7e-05
13emb|BX815609.1|CNS0ABEP Arabidopsis thaliana Full-length cDNA Co... 56 7e-05
14emb|BX831023.1|CNS09ZFQ Arabidopsis thaliana Full-length cDNA Co... 56 7e-05
15gb|AY087609.1| Arabidopsis thaliana clone 37028 mRNA, complete s... 56 7e-05
16emb|Y15382.1|ATRNABIND Arabidopsis thaliana mRNA for putative RN... 56 7e-05
17emb|Y10557.1|AT55BF Arabidopsis thaliana g5bf mRNA 56 7e-05
18emb|BX815653.1|CNS0ABJP Arabidopsis thaliana Full-length cDNA Co... 52 0.001
19emb|BX815511.1|CNS0ABD7 Arabidopsis thaliana Full-length cDNA Co... 52 0.001
20ref|NM_174190.2| Bos taurus supervillin (SVIL), mRNA 44 0.25
21ref|XM_865721.1| PREDICTED: Bos taurus similar to supervillin is... 44 0.25
22gb|AF439264.1| Haloferax volcanii FtsY NG domain (ftsY) gene, co... 44 0.25
23gb|AC167222.4| Mus musculus 10 BAC RP23-261G3 (Roswell Park Canc... 44 0.25
24gb|AC026464.7| Homo sapiens chromosome 16 clone RP11-343C2, comp... 44 0.25
25gb|AY187867.1| Haloferax volcanii signal recognition particle re... 44 0.25
26gb|AC026474.7| Homo sapiens chromosome 16 clone RP11-70O5, compl... 44 0.25
27gb|AF282903.1| Homo sapiens vacuolar protein sorting factor 4A (... 44 0.25
28gb|AF025996.1|AF025996 Bos taurus supervillin mRNA, complete cds 44 0.25
29gb|AC108871.3| Oryza sativa (japonica cultivar-group) chromosome... 42 0.98
30dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.98
31gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 42 0.98
32gb|AC132108.4| Mus musculus BAC clone RP24-257B11 from chromosom... 40 3.9
33ref|XM_656833.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 3.9
34gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, com... 40 3.9
35emb|X85323.1|HSCAG24 H.sapiens mRNA for non polymorphic CAG repe... 40 3.9
36ref|XM_500190.1| Yarrowia lipolytica CLIB122, YALI0A18161g predi... 40 3.9
37emb|AL137787.11| Human DNA sequence from clone RP5-1070B1 on chr... 40 3.9
38emb|BX571661.1| Wolinella succinogenes, complete genome; segment... 40 3.9
39gb|AY160770.1| Rattus norvegicus inositol 1,4,5-trisphosphate 3-... 40 3.9
40emb|BX649432.8| Zebrafish DNA sequence from clone DKEY-208D4 in ... 40 3.9
41gb|AC007623.33| Homo sapiens 12 BAC RP11-608E13 (Roswell Park Ca... 40 3.9
42ref|XM_937007.1| PREDICTED: Homo sapiens KIAA1817 protein (KIAA1... 40 3.9
43ref|XM_042978.5| PREDICTED: Homo sapiens KIAA1817 protein (KIAA1... 40 3.9
44gb|AC007582.7| Drosophila melanogaster, chromosome 2R, region 60... 40 3.9
45gb|AC087222.21| Homo sapiens chromosome 17, clone RP11-497H17, c... 40 3.9
46gb|AC130371.4| Homo sapiens chromosome 17, clone RP11-1197K16, c... 40 3.9
47ref|NM_178094.2| Rattus norvegicus inositol 1,4,5-trisphosphate ... 40 3.9
48emb|AJ440782.1|RNO440782 Rattus norvegicus mRNA for inositol 1,4... 40 3.9
49gb|AC006416.2|T31J12 Arabidopsis thaliana chromosome 1 BAC T31J1... 40 3.9
50gb|AE003466.2| Drosophila melanogaster chromosome 2R, section 73... 40 3.9
51emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 40 3.9
52emb|AL929078.6| Zebrafish DNA sequence from clone CH211-155I15 i... 40 3.9
53dbj|AB058720.1| Homo sapiens mRNA for KIAA1817 protein, partial cds 40 3.9
54emb|AL627252.16| Mouse DNA sequence from clone RP23-272P17 on ch... 40 3.9 
>dbj|AK111521.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002M10, full
           insert sequence
          Length = 1479

 Score =  214 bits (108), Expect = 1e-52
 Identities = 180/204 (88%)
 Strand = Plus / Plus

                                                                       
Query: 92  tctccatctcagcccagaataggagacggtcatggcagccgaggggggccagaatgcagg 151
           ||||||||||| |||||  ||||||  ||||||||||||| |||||||| || |||||||
Sbjct: 166 tctccatctcaacccaggctaggaggaggtcatggcagccaaggggggcaaggatgcagg 225

                                                                       
Query: 152 tggcagcagctgcagactccaagaacattctgatcatggggggcaccaggttcattggtc 211
           | |||||||||||||||||||||||||||||  | |||||||| ||||||||||||||| 
Sbjct: 226 tagcagcagctgcagactccaagaacattcttgtgatggggggaaccaggttcattggtg 285

                                                                       
Query: 212 tcttcctgtccagaaaacttgtccaggagggacaccaggtcacattgttcaccagaggaa 271
           ||||| |||||||    |||||| ||||||| |||||||||||||||||||| |||||||
Sbjct: 286 tcttcttgtccaggctccttgtcaaggaggggcaccaggtcacattgttcactagaggaa 345

                                   
Query: 272 aggcacccataacccagcagttgc 295
           |||| ||||| |||||||||||||
Sbjct: 346 aggcccccattacccagcagttgc 369
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  137 bits (69), Expect = 2e-29
 Identities = 117/133 (87%)
 Strand = Plus / Plus

                                                                            
Query: 119      ggtcatggcagccgaggggggccagaatgcaggtggcagcagctgcagactccaagaaca 178
                ||||||||||||| |||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 13148282 ggtcatggcagccaaggggggcaaggatgcaggtagcagcagctgcagactccaagaaca 13148341

                                                                            
Query: 179      ttctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaacttgtccagg 238
                ||||  | |||||||| ||||||||||||||| ||||| |||||||    |||||| |||
Sbjct: 13148342 ttcttgtgatggggggaaccaggttcattggtgtcttcttgtccaggctccttgtcaagg 13148401

                             
Query: 239      agggacaccaggt 251
                |||| ||||||||
Sbjct: 13148402 aggggcaccaggt 13148414



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                                
Query: 248      aggtcacattgttcaccagaggaaaggcacccataacccagcagttgc 295
                |||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 13148507 aggtcacattgttcactagaggaaaggcccccattacccagcagttgc 13148554
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  137 bits (69), Expect = 2e-29
 Identities = 117/133 (87%)
 Strand = Plus / Plus

                                                                            
Query: 119      ggtcatggcagccgaggggggccagaatgcaggtggcagcagctgcagactccaagaaca 178
                ||||||||||||| |||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 13102556 ggtcatggcagccaaggggggcaaggatgcaggtagcagcagctgcagactccaagaaca 13102615

                                                                            
Query: 179      ttctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaacttgtccagg 238
                ||||  | |||||||| ||||||||||||||| ||||| |||||||    |||||| |||
Sbjct: 13102616 ttcttgtgatggggggaaccaggttcattggtgtcttcttgtccaggctccttgtcaagg 13102675

                             
Query: 239      agggacaccaggt 251
                |||| ||||||||
Sbjct: 13102676 aggggcaccaggt 13102688



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                                
Query: 248      aggtcacattgttcaccagaggaaaggcacccataacccagcagttgc 295
                |||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 13102781 aggtcacattgttcactagaggaaaggcccccattacccagcagttgc 13102828
to top
>emb|AL732381.3|CNS08C94 Oryza sativa chromosome 12, . BAC OJ1112_F01 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 193499

 Score =  137 bits (69), Expect = 2e-29
 Identities = 117/133 (87%)
 Strand = Plus / Minus

                                                                          
Query: 119    ggtcatggcagccgaggggggccagaatgcaggtggcagcagctgcagactccaagaaca 178
              ||||||||||||| |||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 182461 ggtcatggcagccaaggggggcaaggatgcaggtagcagcagctgcagactccaagaaca 182402

                                                                          
Query: 179    ttctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaacttgtccagg 238
              ||||  | |||||||| ||||||||||||||| ||||| |||||||    |||||| |||
Sbjct: 182401 ttcttgtgatggggggaaccaggttcattggtgtcttcttgtccaggctccttgtcaagg 182342

                           
Query: 239    agggacaccaggt 251
              |||| ||||||||
Sbjct: 182341 aggggcaccaggt 182329



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                              
Query: 248    aggtcacattgttcaccagaggaaaggcacccataacccagcagttgc 295
              |||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 182236 aggtcacattgttcactagaggaaaggcccccattacccagcagttgc 182189
to top
>emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa0037L20 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 178827

 Score =  137 bits (69), Expect = 2e-29
 Identities = 117/133 (87%)
 Strand = Plus / Plus

                                                                          
Query: 119    ggtcatggcagccgaggggggccagaatgcaggtggcagcagctgcagactccaagaaca 178
              ||||||||||||| |||||||| || |||||||| |||||||||||||||||||||||||
Sbjct: 137485 ggtcatggcagccaaggggggcaaggatgcaggtagcagcagctgcagactccaagaaca 137544

                                                                          
Query: 179    ttctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaacttgtccagg 238
              ||||  | |||||||| ||||||||||||||| ||||| |||||||    |||||| |||
Sbjct: 137545 ttcttgtgatggggggaaccaggttcattggtgtcttcttgtccaggctccttgtcaagg 137604

                           
Query: 239    agggacaccaggt 251
              |||| ||||||||
Sbjct: 137605 aggggcaccaggt 137617



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                              
Query: 248    aggtcacattgttcaccagaggaaaggcacccataacccagcagttgc 295
              |||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 137710 aggtcacattgttcactagaggaaaggcccccattacccagcagttgc 137757
to top
>gb|DQ002407.1| Zea mays copia retrotransposon opie1, gypsy retrotransposon grande1,
             xilon1 retrotransposon, helitron B73_14578, gypsy
             retrotransposon huck1 and ruda retrotransposon, complete
             sequence
          Length = 152384

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                         
Query: 146   tgcaggtggcagcagctgcagactccaagaacattctgatcatggggggcaccaggttca 205
             |||||||  |||| ||||| |||||||||||||||||| |||||||||| || |||||||
Sbjct: 24025 tgcaggtctcagcggctgcggactccaagaacattctggtcatgggggggactaggttca 23966

                                                             
Query: 206   ttggtctcttcctgtccagaaaacttgtccaggagggacaccaggtca 253
             | ||  |||||||||||||    |||||| ||||||| ||||||||||
Sbjct: 23965 tcggggtcttcctgtccaggctccttgtcaaggagggccaccaggtca 23918



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                          
Query: 247   caggtcacattgttcaccagaggaaaggcacccataacccagcag 291
             |||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 23818 caggtcacattgttcaccaggggaaaggcacccataactcagcag 23774
to top
>ref|NM_100804.2| Arabidopsis thaliana unknown protein AT1G09340 mRNA, complete cds
          Length = 1423

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 247 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 306

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 307 gtcaaagagggacatcaggttacattgttcac 338
to top
>gb|AY070022.1| Arabidopsis thaliana putative RNA-binding protein (At1g09340) mRNA,
           complete cds
          Length = 1168

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 160 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 219

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 220 gtcaaagagggacatcaggttacattgttcac 251
to top
>gb|AY035050.1| Arabidopsis thaliana putative RNA-binding protein (At1g09340) mRNA,
           complete cds
          Length = 1448

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 234 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 293

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 294 gtcaaagagggacatcaggttacattgttcac 325
to top
>gb|AY062570.1| Arabidopsis thaliana g5bf protein (At1g09340; T31J12.6) mRNA,
           complete cds
          Length = 1228

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 172 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 231

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 232 gtcaaagagggacatcaggttacattgttcac 263
to top
>gb|AF428282.1|AF428282 Arabidopsis thaliana At1g09340/T31J12_6 mRNA, complete cds
          Length = 1234

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 177 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 236

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 237 gtcaaagagggacatcaggttacattgttcac 268
to top
>gb|AF325043.2|AF325043 Arabidopsis thaliana At1g09340 (At1g09340/T31J12_6) mRNA, complete
           cds
          Length = 1310

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 164 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 223

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 224 gtcaaagagggacatcaggttacattgttcac 255
to top
>emb|BX815609.1|CNS0ABEP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS77ZE10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1328

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 228 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 287

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 288 gtcaaagagggacatcaggttacattgttcac 319
to top
>emb|BX831023.1|CNS09ZFQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS4ZG05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1259

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 158 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 217

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 218 gtcaaagagggacatcaggttacattgttcac 249
to top
>gb|AY087609.1| Arabidopsis thaliana clone 37028 mRNA, complete sequence
          Length = 1337

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 248 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 307

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 308 gtcaaagagggacatcaggttacattgttcac 339
to top
>emb|Y15382.1|ATRNABIND Arabidopsis thaliana mRNA for putative RNA binding protein
          Length = 1291

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 176 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 235

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 236 gtcaaagagggacatcaggttacattgttcac 267
to top
>emb|Y10557.1|AT55BF Arabidopsis thaliana g5bf mRNA
          Length = 1253

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 172 aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
           ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 177 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 236

                                           
Query: 232 gtccaggagggacaccaggtcacattgttcac 263
           ||| | |||||||| ||||| |||||||||||
Sbjct: 237 gtcaaagagggacatcaggttacattgttcac 268
to top
>emb|BX815653.1|CNS0ABJP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS7ZH07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1300

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 202 ttcattggtctcttcctgtccagaaaacttgtccaggagggacaccaggtcacattgttc 261
           ||||||||||| ||| ||||||| |  |||||| | |||||||| ||||| |||||||||
Sbjct: 257 ttcattggtctgttcttgtccaggatccttgtcaaagagggacatcaggttacattgttc 316

             
Query: 262 ac 263
           ||
Sbjct: 317 ac 318
to top
>emb|BX815511.1|CNS0ABD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS69ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1245

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 202 ttcattggtctcttcctgtccagaaaacttgtccaggagggacaccaggtcacattgttc 261
           ||||||||||| ||| ||||||| |  |||||| | |||||||| ||||| |||||||||
Sbjct: 253 ttcattggtctgttcttgtccaggatccttgtcaaagagggacatcaggttacattgttc 312

             
Query: 262 ac 263
           ||
Sbjct: 313 ac 314
to top
>ref|NM_174190.2| Bos taurus supervillin (SVIL), mRNA
          Length = 6461

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 32   tctccctgaagagcagcctctt 53
            ||||||||||||||||||||||
Sbjct: 1136 tctccctgaagagcagcctctt 1115
to top
>ref|XM_865721.1| PREDICTED: Bos taurus similar to supervillin isoform 2 (LOC614278),
            mRNA
          Length = 3852

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 32   tctccctgaagagcagcctctt 53
            ||||||||||||||||||||||
Sbjct: 2548 tctccctgaagagcagcctctt 2527
to top
>gb|AF439264.1| Haloferax volcanii FtsY NG domain (ftsY) gene, complete cds
          Length = 801

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 78  cggcggcgcggccatctccatc 99
           ||||||||||||||||||||||
Sbjct: 666 cggcggcgcggccatctccatc 687
to top
>gb|AC167222.4| Mus musculus 10 BAC RP23-261G3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 198762

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 203   tcattggtctcttcctgtccag 224
             ||||||||||||||||||||||
Sbjct: 64372 tcattggtctcttcctgtccag 64393
to top
>gb|AC026464.7| Homo sapiens chromosome 16 clone RP11-343C2, complete sequence
          Length = 190185

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 134   ggggggccagaatgcaggtggcagca 159
             ||||| ||||||||||||||||||||
Sbjct: 48271 gggggcccagaatgcaggtggcagca 48296
to top
>gb|AY187867.1| Haloferax volcanii signal recognition particle receptor-like protein
            (ftsY) gene, complete cds
          Length = 1371

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 78   cggcggcgcggccatctccatc 99
            ||||||||||||||||||||||
Sbjct: 1236 cggcggcgcggccatctccatc 1257
to top
>gb|AC026474.7| Homo sapiens chromosome 16 clone RP11-70O5, complete sequence
          Length = 196220

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 134   ggggggccagaatgcaggtggcagca 159
             ||||| ||||||||||||||||||||
Sbjct: 95426 gggggcccagaatgcaggtggcagca 95401
to top
>gb|AF282903.1| Homo sapiens vacuolar protein sorting factor 4A (VPS4A) gene, complete
             cds
          Length = 17315

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 134   ggggggccagaatgcaggtggcagca 159
             ||||| ||||||||||||||||||||
Sbjct: 13353 gggggcccagaatgcaggtggcagca 13378
to top
>gb|AF025996.1|AF025996 Bos taurus supervillin mRNA, complete cds
          Length = 6461

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 32   tctccctgaagagcagcctctt 53
            ||||||||||||||||||||||
Sbjct: 1136 tctccctgaagagcagcctctt 1115
to top
>gb|AC108871.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
              OSJNBb0077M24, complete sequence
          Length = 128920

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 49     ctcttcctgtcttcccccctt 69
              |||||||||||||||||||||
Sbjct: 117366 ctcttcctgtcttcccccctt 117346
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 49       ctcttcctgtcttcccccctt 69
                |||||||||||||||||||||
Sbjct: 20682358 ctcttcctgtcttcccccctt 20682338
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 49       ctcttcctgtcttcccccctt 69
                |||||||||||||||||||||
Sbjct: 20992593 ctcttcctgtcttcccccctt 20992573
to top
>gb|AC132108.4| Mus musculus BAC clone RP24-257B11 from chromosome 3, complete sequence
          Length = 162109

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   ctccaagaacattctgatca 187
             ||||||||||||||||||||
Sbjct: 80384 ctccaagaacattctgatca 80365
to top
>ref|XM_656833.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4321.2), mRNA
          Length = 3537

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   gcctcttcctgtcttccccccttt 70
            ||||||||||||| ||||||||||
Sbjct: 2374 gcctcttcctgtcctccccccttt 2397
to top
>gb|AC124721.4| Mus musculus chromosome 10 clone RP23-387G19, complete sequence
          Length = 216612

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     ctcttcctgtcttcccccct 68
              ||||||||||||||||||||
Sbjct: 155613 ctcttcctgtcttcccccct 155594
to top
>emb|X85323.1|HSCAG24 H.sapiens mRNA for non polymorphic CAG repeat (CAG24)
          Length = 298

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 147 gcaggtggcagcagctgcag 166
           ||||||||||||||||||||
Sbjct: 116 gcaggtggcagcagctgcag 135
to top
>ref|XM_500190.1| Yarrowia lipolytica CLIB122, YALI0A18161g predicted mRNA
          Length = 1158

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 82  ggcgcggccatctccatctc 101
           ||||||||||||||||||||
Sbjct: 979 ggcgcggccatctccatctc 998
to top
>emb|AL137787.11| Human DNA sequence from clone RP5-1070B1 on chromosome Xq22.1-23
             Contains the 3' end of a novel gene, a novel gene
             (KIAA1817) and the 5' end of the PRPS1  for phosphoribosyl
             pyrophosphate synthetase 1 (PRSI) gene, complete sequence
          Length = 89446

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   gcaggtggcagcagctgcag 166
             ||||||||||||||||||||
Sbjct: 52897 gcaggtggcagcagctgcag 52916
to top
>emb|BX571661.1| Wolinella succinogenes, complete genome; segment 5/7
          Length = 346613

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 35     ccctgaagagcagcctcttcctgtcttc 62
              |||||||||| |||||||||||| ||||
Sbjct: 316624 ccctgaagagaagcctcttcctgccttc 316651
to top
>gb|AY160770.1| Rattus norvegicus inositol 1,4,5-trisphosphate 3-kinase C (Ip3kc)
           mRNA, complete cds
          Length = 3550

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  cggccatctccatctcagcc 105
           ||||||||||||||||||||
Sbjct: 763 cggccatctccatctcagcc 744
to top
>emb|BX649432.8| Zebrafish DNA sequence from clone DKEY-208D4 in linkage group 3,
             complete sequence
          Length = 105788

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ccaggttcattggtctcttc 216
             ||||||||||||||||||||
Sbjct: 50987 ccaggttcattggtctcttc 51006
to top
>gb|AC007623.33| Homo sapiens 12 BAC RP11-608E13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 87201

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   aggagacggtcatggcagcc 131
             ||||||||||||||||||||
Sbjct: 64675 aggagacggtcatggcagcc 64656
to top
>ref|XM_937007.1| PREDICTED: Homo sapiens KIAA1817 protein (KIAA1817), mRNA
          Length = 7303

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 147  gcaggtggcagcagctgcag 166
            ||||||||||||||||||||
Sbjct: 5325 gcaggtggcagcagctgcag 5344
to top
>ref|XM_042978.5| PREDICTED: Homo sapiens KIAA1817 protein (KIAA1817), mRNA
          Length = 7303

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 147  gcaggtggcagcagctgcag 166
            ||||||||||||||||||||
Sbjct: 5325 gcaggtggcagcagctgcag 5344
to top
>gb|AC007582.7| Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone
              BACR17E16, complete sequence
          Length = 180162

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    cagcccagaataggagacgg 120
              ||||||||||||||||||||
Sbjct: 126692 cagcccagaataggagacgg 126711
to top
>gb|AC087222.21| Homo sapiens chromosome 17, clone RP11-497H17, complete sequence
          Length = 70000

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   ggggccagaatgcaggtggc 155
             ||||||||||||||||||||
Sbjct: 56285 ggggccagaatgcaggtggc 56304
to top
>gb|AC130371.4| Homo sapiens chromosome 17, clone RP11-1197K16, complete sequence
          Length = 195613

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    ggggccagaatgcaggtggc 155
              ||||||||||||||||||||
Sbjct: 194575 ggggccagaatgcaggtggc 194556
to top
>ref|NM_178094.2| Rattus norvegicus inositol 1,4,5-trisphosphate 3-kinase C (Itpkc),
           mRNA
          Length = 3550

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  cggccatctccatctcagcc 105
           ||||||||||||||||||||
Sbjct: 763 cggccatctccatctcagcc 744
to top
>emb|AJ440782.1|RNO440782 Rattus norvegicus mRNA for inositol 1,4,5-trisphosphate 3-kinase
           (ip3k-c gene), isoform C
          Length = 3309

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 86  cggccatctccatctcagcc 105
           ||||||||||||||||||||
Sbjct: 517 cggccatctccatctcagcc 498
to top
>gb|AC006416.2|T31J12 Arabidopsis thaliana chromosome 1 BAC T31J12 sequence, complete
             sequence
          Length = 16549

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                         
Query: 172   aagaacattctgatcatggggggcaccaggttcattggtctcttcctgtccagaaaactt 231
             ||||| |||||||| ||||| || ||  | ||||||||||| ||| ||||||| |  |||
Sbjct: 14044 aagaagattctgataatgggtggtactcgattcattggtctgttcttgtccaggatcctt 14103

                                 
Query: 232   gtccaggagggacaccaggt 251
             ||| | |||||||| |||||
Sbjct: 14104 gtcaaagagggacatcaggt 14123
to top
>gb|AE003466.2| Drosophila melanogaster chromosome 2R, section 73 of 73 of the complete
             sequence
          Length = 228008

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   cagcccagaataggagacgg 120
             ||||||||||||||||||||
Sbjct: 34782 cagcccagaataggagacgg 34763
to top
>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 82      ggcgcggccatctccatctc 101
               ||||||||||||||||||||
Sbjct: 1888410 ggcgcggccatctccatctc 1888391
to top
>emb|AL929078.6| Zebrafish DNA sequence from clone CH211-155I15 in linkage group 3,
             complete sequence
          Length = 171571

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ccaggttcattggtctcttc 216
             ||||||||||||||||||||
Sbjct: 49000 ccaggttcattggtctcttc 49019
to top
>dbj|AB058720.1| Homo sapiens mRNA for KIAA1817 protein, partial cds
          Length = 4928

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 147  gcaggtggcagcagctgcag 166
            ||||||||||||||||||||
Sbjct: 2944 gcaggtggcagcagctgcag 2963
to top
>emb|AL627252.16| Mouse DNA sequence from clone RP23-272P17 on chromosome 11, complete
             sequence
          Length = 137878

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    ctccctgaagagcagcctct 52
             ||||||||||||||||||||
Sbjct: 42152 ctccctgaagagcagcctct 42171


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,141,792
Number of Sequences: 3902068
Number of extensions: 3141792
Number of successful extensions: 71911
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71675
Number of HSP's gapped (non-prelim): 235
length of query: 296
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 274
effective length of database: 17,147,199,772
effective search space: 4698332737528
effective search space used: 4698332737528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top