ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet07b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 747 0.0
2ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 232 7e-58
3ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
4ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
5ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
6ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
7ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
8ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
9ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 232 7e-58
10dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
11dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
12dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
13dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
14dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
15dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
16dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
17dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
18dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
19dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 232 7e-58
20dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 224 2e-55
21gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 216 4e-53
22dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 206 4e-50
23dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 206 4e-50
24gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 167 4e-38
25ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 165 1e-37
26gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 165 1e-37
27dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
28dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
29dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
30dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
31dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
32dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 1e-37
33emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 159 9e-36
34gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 157 3e-35
35gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 153 5e-34
36gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 151 2e-33
37gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 151 2e-33
38gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 151 2e-33
39dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 151 2e-33
40emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 151 2e-33
41gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 151 2e-33
42gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 145 1e-31
43gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 145 1e-31
44dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 143 5e-31
45dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 5e-31
46gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 143 5e-31
47dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 143 5e-31
48emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 141 2e-30
49emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 135 1e-28
50ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 133 5e-28
51dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 133 5e-28
52dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 133 5e-28
53dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 133 5e-28
54dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 133 5e-28
55dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
56dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
57dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
58dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
59dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
60dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 5e-28
61emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 127 3e-26
62gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 125 1e-25
63gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 125 1e-25
64dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 1e-25
65emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 123 5e-25
66gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 119 8e-24
67gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 119 8e-24
68dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 117 3e-23
69emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 115 1e-22
70gb|AY109324.1| Zea mays CL187_1 mRNA sequence 115 1e-22
71dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 111 2e-21
72emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 101 2e-18
73dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 101 2e-18
74dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 98 3e-17
75emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 96 1e-16
76ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 94 4e-16
77gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 94 4e-16
78gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 94 4e-16
79gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 94 4e-16
80gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 94 4e-16
81gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 94 4e-16
82emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 94 4e-16
83emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 94 4e-16
84gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 94 4e-16
85gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 94 4e-16
86emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 94 4e-16
87gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 94 4e-16
88gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 92 2e-15
89gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 92 2e-15
90emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 88 3e-14
91gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 88 3e-14
92emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 88 3e-14
93gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 88 3e-14
94dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 88 3e-14
95dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 88 3e-14
96ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 86 1e-13
97gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 86 1e-13
98gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 86 1e-13
99gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 86 1e-13
100emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 86 1e-13
101emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 86 1e-13
102gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 82 2e-12
103gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 82 2e-12
104emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 82 2e-12
105gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 82 2e-12
106gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 82 2e-12
107dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 82 2e-12
108dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 82 2e-12
109dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 82 2e-12
110dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 82 2e-12
111dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 80 6e-12
112ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 78 3e-11
113ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 78 3e-11
114ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 78 3e-11
115ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 78 3e-11
116gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 78 3e-11
117gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 78 3e-11
118emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 78 3e-11
119gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 78 3e-11
120gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 78 3e-11
121gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 78 3e-11
122gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 78 3e-11
123gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 78 3e-11
124gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 78 3e-11
125gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 78 3e-11
126gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 78 3e-11
127gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 78 3e-11
128gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 78 3e-11
129gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 78 3e-11
130gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 78 3e-11
131gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 78 3e-11
132gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 78 3e-11
133gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 78 3e-11
134gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 78 3e-11
135gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 78 3e-11
136gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 78 3e-11
137emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
138emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
139emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 78 3e-11
140emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 78 3e-11
141emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 78 3e-11
142gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 76 1e-10
143emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 76 1e-10
144gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 76 1e-10
145emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 76 1e-10
146dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 76 1e-10
147gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 74 4e-10
148gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 74 4e-10
149gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 74 4e-10
150emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 74 4e-10
151gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 74 4e-10
152gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 74 4e-10
153ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 70 6e-09
154gb|AC147802.2| Oryza sativa chromosome 3 BAC OSJNBb0013C14 genom... 70 6e-09
155gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 70 6e-09
156gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 70 6e-09
157gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 70 6e-09
158gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 6e-09
159gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 70 6e-09
160gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 70 6e-09
161gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 70 6e-09
162gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 70 6e-09
163gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 70 6e-09
164gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 70 6e-09
165emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
166emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
167emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 70 6e-09
168gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 70 6e-09
169emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 70 6e-09
170emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 70 6e-09
171emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 70 6e-09
172gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 70 6e-09
173gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 70 6e-09
174gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 68 2e-08
175gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 66 1e-07
176gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 64 4e-07
177ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 62 2e-06
178gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 62 2e-06
179gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 62 2e-06
180gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 62 2e-06
181gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 62 2e-06
182gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 62 2e-06
183gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 62 2e-06
184emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
185emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
186gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 62 2e-06
187dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
188emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 62 2e-06
189gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 62 2e-06
190gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 62 2e-06
191gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 62 2e-06
192emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 62 2e-06
193gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 60 6e-06
194dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 58 2e-05
195ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll bindi... 56 9e-05
196ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ p... 56 9e-05
197ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll bindi... 56 9e-05
198gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 56 9e-05
199gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence 56 9e-05
200emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 56 9e-05
201gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b bin... 56 9e-05
202gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 ma... 56 9e-05
203gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genom... 56 9e-05
204gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 56 9e-05
205gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b bin... 56 9e-05
206gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, com... 56 9e-05
207gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 56 9e-05
208gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, com... 56 9e-05
209emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
210emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
211emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
212emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
213emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
214emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
215emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
216emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
217emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
218emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
219emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
220emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
221emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
222emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
223emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
224gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 56 9e-05
225gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA... 56 9e-05
226gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA... 56 9e-05
227gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA... 56 9e-05
228emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 56 9e-05
229gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlor... 56 9e-05
230gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 56 9e-05
231gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 56 9e-05
232gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 56 9e-05
233dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 56 9e-05
234gb|AY954742.1| Ostreococcus tauri chloroplast prasinophyte chlor... 54 4e-04
235gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 54 4e-04
236emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 54 4e-04
237gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 54 4e-04
238gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 54 4e-04
239gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 54 4e-04
240emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 54 4e-04
241emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 54 4e-04
242gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 54 4e-04
243gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 54 4e-04
244dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 54 4e-04
245gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 52 0.001
246emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 52 0.001
247emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 52 0.001
248emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 52 0.001
249gb|M64619.1|PEACAB66 Pea cab gene, complete cds 52 0.001
250gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 52 0.001
251gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 52 0.001
252gb|AY954741.1| Ostreococcus tauri chloroplast prasinophyte chlor... 50 0.006
253gb|AY954733.1| Ostreococcus tauri chloroplast prasinophyte chlor... 50 0.006
254gb|AY954730.1| Ostreococcus tauri chloroplast prasinophyte chlor... 50 0.006
255emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 50 0.006
256emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 50 0.006
257emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 50 0.006
258emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 50 0.006
259emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 50 0.006
260emb|X16536.1|GMCAB5 G.max DNA for Cab5 50 0.006
261gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 50 0.006
262gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 50 0.006
263dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 50 0.006
264gb|AY954735.1| Ostreococcus tauri chloroplast light-harvesting c... 48 0.023
265emb|X61915.1|PTCABP P.thunbergii cab gene 48 0.023
266gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 48 0.023
267gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.090
268gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 46 0.090
269dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.090
270dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.090
271gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 46 0.090
272dbj|AP005148.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.090
273emb|X76632.1|PPCAB P.patens (Hedw.) B.S.G. partial mRNA for chlo... 46 0.090
274emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 46 0.090
275gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 46 0.090
276dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 46 0.090
277gb|AY658879.1| Synthetic construct Peudomonas aeruginosa clone F... 44 0.36
278dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
279gb|AE004728.1| Pseudomonas aeruginosa PAO1, section 289 of 529 o... 44 0.36
280gb|AF210249.1|AF210249 Streptomyces verticillus bleomycin biosyn... 44 0.36
281dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
282emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 44 0.36
283gb|AY105356.1| Zea mays PCO075138 mRNA sequence 44 0.36
284ref|NM_120231.3| Arabidopsis thaliana chlorophyll binding AT5G01... 42 1.4
285gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 42 1.4
286gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 42 1.4
287emb|CR716896.2|CNS0GG3T Tetraodon nigroviridis full-length cDNA 42 1.4
288emb|CR706280.2|CNS0G7X0 Tetraodon nigroviridis full-length cDNA 42 1.4
289gb|BT000363.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.4
290emb|X85969.1|SCSECAPT S.coelicolor secD, secF & apt genes 42 1.4
291emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 42 1.4
292emb|BX640433.1| Bordetella parapertussis strain 12822, complete ... 42 1.4
293emb|BX640418.1| Bordetella pertussis strain Tohama I, complete g... 42 1.4
294emb|AL939109.1|SCO939109 Streptomyces coelicolor A3(2) complete ... 42 1.4
295emb|AL161946.1|ATF7A7 Arabidopsis thaliana DNA chromosome 5, BAC... 42 1.4
296ref|NM_205496.1| Gallus gallus golgi apparatus protein 1 (GLG1),... 42 1.4
297gb|AY133566.1| Arabidopsis thaliana At5g01530/F7A7_50 mRNA, comp... 42 1.4
298gb|AY092980.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.4
299gb|AY081680.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.4
300gb|AY059861.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 42 1.4
301gb|AY057641.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 42 1.4
302gb|AC093211.3| Homo sapiens chromosome 5 clone CTD-2020P3, compl... 42 1.4
303gb|U48395.1|GGU48395 Gallus gallus mutant cysteine-rich FGF rece... 42 1.4
304gb|AY998092.1| Bordetella bronchiseptica RB50 clone Psp54 unknow... 42 1.4
305gb|AY048300.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 42 1.4
306gb|AY048262.1| Arabidopsis thaliana AT5g01530/F7A7_50 mRNA, comp... 42 1.4
307gb|AC026749.5|AC026749 Homo sapiens chromosome 5 clone RP11-415K... 42 1.4
308gb|AF370474.1|AF370474 Arabidopsis thaliana chlorophyll a/b-bind... 42 1.4
309emb|BX833597.1|CNS0A1R6 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
310emb|BX831442.1|CNS0A1WM Arabidopsis thaliana Full-length cDNA Co... 42 1.4
311emb|BX830127.1|CNS0A1XL Arabidopsis thaliana Full-length cDNA Co... 42 1.4
312emb|BX830573.1|CNS0A06T Arabidopsis thaliana Full-length cDNA Co... 42 1.4
313emb|BX831299.1|CNS09ZIA Arabidopsis thaliana Full-length cDNA Co... 42 1.4
314emb|BX831064.1|CNS09ZJ3 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
315emb|BX830905.1|CNS09ZE8 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
316emb|BX830685.1|CNS09ZE5 Arabidopsis thaliana Full-length cDNA Co... 42 1.4
317emb|BX841630.1|CNS09YKO Arabidopsis thaliana Full-length cDNA Co... 42 1.4
318dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 42 1.4
319gb|AC010491.4| Homo sapiens chromosome 5 clone CTD-2335I23, comp... 42 1.4
320gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 42 1.4
321dbj|AB180673.1| Salmonella enterica subsp. enterica serovar Ente... 42 1.4
322emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 42 1.4
323emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 42 1.4
324emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 42 1.4
325emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 42 1.4
326emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 42 1.4
327emb|X16535.1|GMCAB4 G.max DNA for Cab4 42 1.4
328emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 42 1.4
329emb|X71878.1|ATLHCB4 A.thaliana Lhcb4 gene 42 1.4
330gb|U73818.1|CRU73818 Chlamydomonas reinhardtii LRG5 gene, comple... 42 1.4
331gb|BC015392.1| Homo sapiens family with sequence similarity 105,... 42 1.4
332gb|AE015451.1| Pseudomonas putida KT2440 complete genome 42 1.4
333gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 42 1.4
334gb|U73817.1|CRU73817 Chlamydomonas reinhardtii LRG5 mRNA, comple... 42 1.4
335gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 42 1.4
336gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 42 1.4
337gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 42 1.4
338gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 42 1.4
339gb|M95766.1|CHKFGFR Chicken cysteine-rich fibroblast growth fact... 42 1.4
340gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 42 1.4
341dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 42 1.4
342dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 42 1.4
343dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 42 1.4
344gb|AC136217.4| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
345ref|NM_194793.1| Oryza sativa (japonica cultivar-group) putative... 40 5.6
346ref|XM_527497.1| PREDICTED: Pan troglodytes similar to hairy/enh... 40 5.6
347ref|NM_196400.1| Oryza sativa (japonica cultivar-group) putative... 40 5.6
348ref|XM_477747.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.6
349gb|BT020068.1| Homo sapiens hairy/enhancer-of-split related with... 40 5.6
350gb|BT020067.1| Homo sapiens hairy/enhancer-of-split related with... 40 5.6
351gb|BT020066.1| Synthetic construct Homo sapiens hairy/enhancer-o... 40 5.6
352gb|AC108872.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
353gb|AC124142.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
354gb|AC148814.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
355ref|XM_368171.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 40 5.6
356gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 40 5.6
357ref|XM_581531.2| PREDICTED: Bos taurus similar to hairy/enhancer... 40 5.6
358gb|DQ249342.1| Streptomyces hygroscopicus subsp. duamyceticus st... 40 5.6
359gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 40 5.6
360gb|AF040570.3| Amycolatopsis mediterranei rifamycin biosynthetic... 40 5.6
361gb|AC137751.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
362ref|XM_539911.2| PREDICTED: Canis familiaris similar to GTPase, ... 40 5.6
363gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence 40 5.6
364gb|AF143772.2| Mycobacterium avium strain 2151 glycopeptidolipid... 40 5.6
365emb|AL356740.19| Human DNA sequence from clone RP11-120K24 on ch... 40 5.6
366emb|AL078594.36|HSDJ293L8 Human DNA sequence from clone RP1-293L... 40 5.6
367ref|XM_965985.1| PREDICTED: Tribolium castaneum similar to CG104... 40 5.6
368emb|X78346.1|RCPUTRA Rhodobacter capsulatus selD, putR & putA genes 40 5.6
369emb|X74371.1|OCKK3 O.cuniculus keratin K3 gene 40 5.6
370emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.6
371emb|BX640429.1| Bordetella parapertussis strain 12822, complete ... 40 5.6
372emb|AL663016.5|OSJN00216 Oryza sativa genomic DNA, chromosome 4,... 40 5.6
373emb|AJ223012.1|AMM223012 Amycolatopsis mediterranei genes encodi... 40 5.6
374gb|BC007707.2| Homo sapiens hairy/enhancer-of-split related with... 40 5.6
375gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 5.6
376gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.6
377gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 gen... 40 5.6
378gb|AC090873.4| Oryza sativa chromosome 10 clone OSJNBa0029P06, c... 40 5.6
379gb|AF232238.1|AF232238 Homo sapiens HES-related repressor protei... 40 5.6
380ref|NM_012259.1| Homo sapiens hairy/enhancer-of-split related wi... 40 5.6
381gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.6
382gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 5.6
383dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
384dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
385dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
386dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
387dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
388emb|BX817733.1|CNS0AE6W Arabidopsis thaliana Full-length cDNA Co... 40 5.6
389gb|AF311884.1|AF311884 Homo sapiens hairy-related transcription ... 40 5.6
390dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.6
391dbj|AB110611.1| Pseudomonas sp. MT-1 nar gene cluster (orf1, orf... 40 5.6
392gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 40 5.6
393dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
394dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
395dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
396gb|AF237949.1|AF237949 Homo sapiens GRIDLOCK mRNA, complete cds 40 5.6
397gb|AY888479.1| Synthetic construct Homo sapiens clone FLH007547.... 40 5.6
398gb|AY888478.1| Synthetic construct Homo sapiens clone FLH007546.... 40 5.6
399dbj|AB122116.1| Chlamydomonas reinhardtii LhcI-3 gene for light-... 40 5.6
400gb|AY891122.1| Synthetic construct Homo sapiens clone FLH007543.... 40 5.6
401dbj|AB096259.1| Oryza sativa (japonica cultivar-group) PLA1 mRNA... 40 5.6
402emb|Z22782.1|MSCHLABA M.squamata chlorophyll a/b binding protein... 40 5.6
403emb|X69524.1|MSCABC1 M.squamata cabc1 mRNA for chlorophyll a/b/c... 40 5.6
404emb|X73540.1|MSLHC13 M.squamata Lhc1*3 mRNA for chlorophyll a/b/... 40 5.6
405emb|X73539.1|MSLHC14 M.squamata Lhc1*4 mRNA for chlorophyll a/b/... 40 5.6
406gb|AF173901.1|AF173901 Homo sapiens basic helix-loop-helix facto... 40 5.6
407emb|AJ249545.1|HSA249545 Homo sapiens mRNA for basic-helix-loop-... 40 5.6
408dbj|AK067458.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.6
409dbj|AB044755.1| Homo sapiens Hey2 mRNA for basic-helix-loop-heli... 40 5.6
410gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 5.6
411gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
412gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
413gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
414emb|AL713939.6|CNS07YPL Oryza sativa chromosome 12, . BAC OJ1722... 40 5.6
415gb|AC144455.5| Oryza sativa (japonica cultivar-group) chromosome... 40 5.6
416gb|U23190.1|ZMU23190 Zea mays chlorophyll a/b-binding apoprotein... 40 5.6
417gb|L15738.1|MNTCPCABBP Mantoniella squamata chloroplast photosyn... 40 5.6
418dbj|D78207.1|PHNCABBP Japanese morning glory mRNA for chlorophyl... 40 5.6
419dbj|AB070947.1| Streptomyces avermitilis polyketide-9 biosynthet... 40 5.6

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score =  747 bits (377), Expect = 0.0
 Identities = 377/377 (100%)
 Strand = Plus / Plus

                                                                       
Query: 40  ggccaccgtacggaccccggagcagcagacatggcatccacgatcatggccgccgcctcc 99
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ggccaccgtacggaccccggagcagcagacatggcatccacgatcatggccgccgcctcc 60

                                                                       
Query: 100 cgcgccgttgtcgccaagacgccgttcctcagcggccagggccgcgccgccagcgccagc 159
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  cgcgccgttgtcgccaagacgccgttcctcagcggccagggccgcgccgccagcgccagc 120

                                                                       
Query: 160 cccctgcgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtgg 219
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 cccctgcgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtgg 180

                                                                       
Query: 220 tacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtacctt 279
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtacctt 240

                                                                       
Query: 280 aacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 aacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 300

                                                                       
Query: 340 gcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgct 399
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 gcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgct 360

                            
Query: 400 cttgggtgcgtcttccc 416
           |||||||||||||||||
Sbjct: 361 cttgggtgcgtcttccc 377



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 125 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 184

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 185 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 244

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 245 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 304

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 305 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 357



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 35  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 94



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 149 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 208

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 209 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 268

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 381



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 59  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 118



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 149 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 208

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 209 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 268

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 381



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 59  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 118



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 151 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 210

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 211 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 270

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 271 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 330

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 331 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 383



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 61  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 120



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 156 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 215

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 216 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 275

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 276 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 335

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 336 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 388



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 66  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 125



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 189 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 248

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 249 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 308

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 309 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 368

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 369 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 421



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 99  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 158



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 125 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 184

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 185 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 244

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 245 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 304

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 305 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 357



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 35  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 94



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 149 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 208

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 209 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 268

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 381



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 59  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 118



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 149 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 208

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 209 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 268

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 381



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 59  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 118



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 150 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 209

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 210 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 269

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 270 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 329

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 330 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 382



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 60  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 119



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score =  232 bits (117), Expect = 7e-58
 Identities = 204/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 156 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 215

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 216 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 275

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 276 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 335

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 336 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 388



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 66  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 125



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score =  224 bits (113), Expect = 2e-55
 Identities = 203/233 (87%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 154 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 213

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || ||||||||||| || ||||| |||||||||||||||||||| |  |||
Sbjct: 214 ccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgtacctgaggggc 273

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| |||||||| || |||||||| || ||||| || || |||||||||||||||
Sbjct: 274 gagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 386



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 64  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 123



to top

>gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1105

 Score =  216 bits (109), Expect = 4e-53
 Identities = 202/233 (86%)
 Strand = Plus / Plus

                                                                       
Query: 166 cgcgacatcgccgccgcgaccaacggcagaatcaccatgggcaacgacttgtggtacggc 225
           |||||||||||||||||  ||| |||| | ||||||||| |||| ||  |||||||||| 
Sbjct: 130 cgcgacatcgccgccgccgccaccggccgcatcaccatgagcaaggagctgtggtacggg 189

                                                                       
Query: 226 ccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggc 285
           |||||  | || || |||||||| || ||||| ||||| |||||||||||||| |  |||
Sbjct: 190 ccggatagggtgaattacctggggccattctcggcgcaaacgccgtcgtacctgaggggc 249

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| ||||||||||| |||||||| || ||||| || || |||||||||||||||
Sbjct: 250 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 309

                                                                
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           || |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 310 gcaaggaacagggcgctggaggtgatccacggccggtgggcgatgctcggcgc 362



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
           ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 40  atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 99



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  206 bits (104), Expect = 4e-50
 Identities = 164/184 (89%)
 Strand = Plus / Plus

                                                                            
Query: 215      tgtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgt 274
                |||||||||| |||||  | || ||||||||||| || ||||| ||||||||||||||||
Sbjct: 22434211 tgtggtacgggccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgt 22434270

                                                                            
Query: 275      accttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacc 334
                |||| |  ||||||||||| ||||||||||| |||||||| || ||||| || || ||||
Sbjct: 22434271 acctgaggggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacc 22434330

                                                                            
Query: 335      cggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcg 394
                ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 22434331 cggaggcgttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 22434390

                    
Query: 395      gcgc 398
                ||||
Sbjct: 22434391 gcgc 22434394



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                        
Query: 166      cgcgacatcgccgccgcgaccaacggcagaatcaccatgg 205
                |||||||||||||||||  ||| |||| | ||||||||||
Sbjct: 22434010 cgcgacatcgccgccgccgccaccggccgcatcaccatgg 22434049



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                            
Query: 70       atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
                ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 22433920 atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 22433979



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 88       gccgccgcctcccgcgccgt 107
                ||||||||||||||||||||
Sbjct: 13671732 gccgccgcctcccgcgccgt 13671713



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score =  206 bits (104), Expect = 4e-50
 Identities = 164/184 (89%)
 Strand = Plus / Plus

                                                                         
Query: 215   tgtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgt 274
             |||||||||| |||||  | || ||||||||||| || ||||| ||||||||||||||||
Sbjct: 95278 tgtggtacgggccggatagggtgaagtacctggggccattctcggcgcagacgccgtcgt 95337

                                                                         
Query: 275   accttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacc 334
             |||| |  ||||||||||| ||||||||||| |||||||| || ||||| || || ||||
Sbjct: 95338 acctgaggggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacc 95397

                                                                         
Query: 335   cggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcg 394
             ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 95398 cggaggcgttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 95457

                 
Query: 395   gcgc 398
             ||||
Sbjct: 95458 gcgc 95461



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                     
Query: 166   cgcgacatcgccgccgcgaccaacggcagaatcaccatgg 205
             |||||||||||||||||  ||| |||| | ||||||||||
Sbjct: 95077 cgcgacatcgccgccgccgccaccggccgcatcaccatgg 95116



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                         
Query: 70    atggcatccacgatcatggccgccgcctcccgcgccgttgtcgccaagacgccgttcctc 129
             ||||| ||||||||||||||| |  ||||||||| | | | ||||||||| || ||||||
Sbjct: 94987 atggcgtccacgatcatggccccaacctcccgcgtcctcgccgccaagacccccttcctc 95046



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  167 bits (84), Expect = 4e-38
 Identities = 171/200 (85%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           |||||||| || ||||||||||||||||| ||||| |||||||   || ||||||| |||
Sbjct: 542 tggtacgggcccgaccgcgtcaagtacctaggcccgttctccggcgaggcgccgtcctac 601

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | |||||||||| ||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 602 ctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcggccgacccc 661

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | ||||| | |||| ||| ||| |||||||||||||  |||||||| |||||||||
Sbjct: 662 gagaccttcgccaagaaccgggagctggaggtgatccacgcgcggtgggccatgctcggc 721

                               
Query: 397 gctcttgggtgcgtcttccc 416
           || || || ||||| |||||
Sbjct: 722 gcgctgggctgcgtgttccc 741



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 194 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 253

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 254 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 313

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 314 ccatgctgggcgcgctcggctgcgtcttccc 344



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Minus

                                                                         
Query: 266   cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
             ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 14480 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 14421

                                                                         
Query: 326   ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
             | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 14420 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 14361

                                            
Query: 386   cgatgctcggcgctcttgggtgcgtcttccc 416
             | ||||| ||||| || || |||||||||||
Sbjct: 14360 ccatgctgggcgcgctcggctgcgtcttccc 14330



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                            
Query: 266      cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
                ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 30024531 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 30024590

                                                                            
Query: 326      ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
                | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 30024591 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 30024650

                                               
Query: 386      cgatgctcggcgctcttgggtgcgtcttccc 416
                | ||||| ||||| || || |||||||||||
Sbjct: 30024651 ccatgctgggcgcgctcggctgcgtcttccc 30024681



 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                            
Query: 282      cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
                |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 23603741 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 23603800

                                                                            
Query: 342      gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
                |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||| ||
Sbjct: 23603801 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcgcgct 23603860

                               
Query: 402      tgggtgcgtcttccc 416
                 || ||||| |||||
Sbjct: 23603861 gggctgcgtgttccc 23603875



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                           
Query: 286      gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgtt 344
                |||||||||||| |||||||||| || ||||||| ||| |  |||||||||||||||||
Sbjct: 37443367 gagttccccggctactacggctgagataccgccgagctctgcgccgacccggaggcgtt 37443309



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                         
Query: 266   cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
             ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 20521 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 20580

                                                                         
Query: 326   ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
             | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 20581 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 20640

                                            
Query: 386   cgatgctcggcgctcttgggtgcgtcttccc 416
             | ||||| ||||| || || |||||||||||
Sbjct: 20641 ccatgctgggcgcgctcggctgcgtcttccc 20671



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 275 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 334

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 335 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 394

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 395 ccatgctgggcgcgctcggctgcgtcttccc 425



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 275 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 334

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 335 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 394

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 395 ccatgctgggcgcgctcggctgcgtcttccc 425



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 277 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 336

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 337 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 396

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 397 ccatgctgggcgcgctcggctgcgtcttccc 427



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  165 bits (83), Expect = 1e-37
 Identities = 134/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 277 cgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 336

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 337 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 396

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 397 ccatgctgggcgcgctcggctgcgtcttccc 427



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  159 bits (80), Expect = 9e-36
 Identities = 170/200 (85%)
 Strand = Plus / Plus

                                                                        
Query: 217  tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
            ||||||||||| ||||||||||||||||| |||||||||||||   || | |||   |||
Sbjct: 1027 tggtacggccccgaccgcgtcaagtacctcggccccttctccggcgagcccccgagctac 1086

                                                                        
Query: 277  cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
            || | |||||||||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 1087 ctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtccgccgacccc 1146

                                                                        
Query: 337  gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
            ||| | ||||| | |||| | | ||| ||||||||||||  ||| ||||| |||||||||
Sbjct: 1147 gagacattcgccaagaaccgcgagctggaggtgatccactcccgctgggccatgctcggc 1206

                                
Query: 397  gctcttgggtgcgtcttccc 416
            || || || |||||||||||
Sbjct: 1207 gcgctcggctgcgtcttccc 1226



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  157 bits (79), Expect = 3e-35
 Identities = 133/151 (88%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | |||||||||| ||||||||||||||||||||||||||||||| |
Sbjct: 236 cgccgtcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgt 295

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | |||||||||||| ||||||| | |||| ||| ||| |||||||||||| |||||||||
Sbjct: 296 cggccgacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtggg 355

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           | ||||| ||||| || || |||||||||||
Sbjct: 356 ccatgctgggcgcgctcggctgcgtcttccc 386



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  153 bits (77), Expect = 5e-34
 Identities = 170/201 (84%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||||||||| ||||||||||| ||||| |||||||   || | || || ||
Sbjct: 201 gtggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcata 260

                                                                       
Query: 276 ccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||| | |||||| ||||||||||||||||| ||||||||||||||||| || ||||||||
Sbjct: 261 cctcaccggcgaattccccggcgactacgggtgggacaccgccgggctctccgccgaccc 320

                                                                       
Query: 336 ggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcgg 395
            ||| | ||| | | |||| ||| ||| |||||||||||| |||||||||| ||||| ||
Sbjct: 321 cgagaccttctccaagaaccgggagctcgaggtgatccactgccggtgggccatgctggg 380

                                
Query: 396 cgctcttgggtgcgtcttccc 416
            ||||| || |||||||||||
Sbjct: 381 tgctctcggctgcgtcttccc 401



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  151 bits (76), Expect = 2e-33
 Identities = 169/200 (84%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||||||||| ||||||||||| ||||| |||||||   || | || || |||
Sbjct: 106 tggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgaggcaccatcatac 165

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | ||| |||||||||||||||||||||||||||||||||||||| || || ||||| 
Sbjct: 166 ctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggacccc 225

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | || || | |||| ||| ||| |||||||||||| |||||||||| ||||| || 
Sbjct: 226 gagacatttgccaagaaccgggagctcgaggtgatccactgccggtgggcaatgctgggt 285

                               
Query: 397 gctcttgggtgcgtcttccc 416
           ||||| || |||||||||||
Sbjct: 286 gctctcggctgcgtcttccc 305



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score =  151 bits (76), Expect = 2e-33
 Identities = 154/180 (85%)
 Strand = Plus / Minus

                                                                         
Query: 237   caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
             ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 79605 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 79546

                                                                         
Query: 297   cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
              |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 79545 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 79486

                                                                         
Query: 357   ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
             || ||| ||||||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 79485 ggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 79426



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  151 bits (76), Expect = 2e-33
 Identities = 154/180 (85%)
 Strand = Plus / Plus

                                                                            
Query: 237      caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
                ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 21808211 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 21808270

                                                                            
Query: 297      cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
                 |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 21808271 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 21808330

                                                                            
Query: 357      ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
                || ||| ||||||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 21808331 ggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 21808390



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 286      gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgtt 344
                |||||||||||| |||||||||| || ||||||| ||| || |||||||||||||||||
Sbjct: 18189139 gagttccccggctactacggctgagataccgccgagctctccgccgacccggaggcgtt 18189081



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  151 bits (76), Expect = 2e-33
 Identities = 154/180 (85%)
 Strand = Plus / Plus

                                                                            
Query: 237      caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
                ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 21801240 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 21801299

                                                                            
Query: 297      cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
                 |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 21801300 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 21801359

                                                                            
Query: 357      ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
                || ||| ||||||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 21801360 ggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 21801419



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 286      gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgtt 344
                |||||||||||| |||||||||| || ||||||| ||| || |||||||||||||||||
Sbjct: 18182680 gagttccccggctactacggctgagataccgccgagctctccgccgacccggaggcgtt 18182622



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score =  151 bits (76), Expect = 2e-33
 Identities = 169/200 (84%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| || |||  |||||| || ||||| ||||||| ||||||||||||||||
Sbjct: 175 tggtacggccctgatcgccccaagtatcttggcccgttctccgagcagacgccgtcgtac 234

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | |||||||||||||||||||||||| ||||| ||||||||  | || |||||||||
Sbjct: 235 ctgaccggcgagttccccggcgactacgggtgggagaccgccggcgtctcggccgacccg 294

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | |||||  | ||| ||| ||| ||||||||||||  ||||||||||||||| |||
Sbjct: 295 gagacattcgcgcgcaaccgggagctggaggtgatccactcccggtgggcgatgctgggc 354

                               
Query: 397 gctcttgggtgcgtcttccc 416
           || || || ||||| |||||
Sbjct: 355 gcgctgggctgcgtgttccc 374



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score =  151 bits (76), Expect = 2e-33
 Identities = 154/180 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 199 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 258

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 259 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 318

                                                                       
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           || ||| ||||||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 319 ggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 378



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  145 bits (73), Expect = 1e-31
 Identities = 169/201 (84%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||| || || ||||||||||| ||||| |||||||   || | || || ||
Sbjct: 185 gtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcata 244

                                                                       
Query: 276 ccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||| | ||| |||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 245 cctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggaccc 304

                                                                       
Query: 336 ggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcgg 395
            ||| | ||||| | |||| ||| ||| |||||||||||| || ||||||| ||||| ||
Sbjct: 305 cgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctggg 364

                                
Query: 396 cgctcttgggtgcgtcttccc 416
           |||||| || |||||||||||
Sbjct: 365 cgctctcggctgcgtcttccc 385



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  145 bits (73), Expect = 1e-31
 Identities = 169/201 (84%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||| || || ||||||||||| ||||| |||||||   || | || || ||
Sbjct: 20  gtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcaccatcata 79

                                                                       
Query: 276 ccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||| | ||| |||||||||||||||||||||||||||||||||||||| || || |||||
Sbjct: 80  cctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggaccc 139

                                                                       
Query: 336 ggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcgg 395
            ||| | ||||| | |||| ||| ||| |||||||||||| || ||||||| ||||| ||
Sbjct: 140 cgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctggg 199

                                
Query: 396 cgctcttgggtgcgtcttccc 416
           |||||| || |||||||||||
Sbjct: 200 cgctctcggctgcgtcttccc 220



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  143 bits (72), Expect = 5e-31
 Identities = 168/200 (84%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||| | ||||||||||| |||||||||||||   || | || || |||
Sbjct: 56  tggtacggccccgacagagtcaagtacctcggccccttctccggcgaggccccctcatac 115

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | |||||||||| ||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 116 ctcaccggcgagttcgccggcgactacggctgggacaccgccgggctctccgccgacccc 175

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | ||||| | |||| | | ||| |||||||||||||   ||||||| |||||||||
Sbjct: 176 gagaccttcgccaagaaccgcgagctggaggtgatccacgcgaggtgggccatgctcggc 235

                               
Query: 397 gctcttgggtgcgtcttccc 416
           || || || |||||||||||
Sbjct: 236 gcgctcggctgcgtcttccc 255



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score =  143 bits (72), Expect = 5e-31
 Identities = 153/180 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 210 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 269

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||| | |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 270 agactacaggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 329

                                                                       
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           || ||| ||||||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 330 ggagctggaggtgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 389



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  143 bits (72), Expect = 5e-31
 Identities = 153/180 (85%)
 Strand = Plus / Plus

                                                                        
Query: 237  caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
            ||||| |||||| |||||||| | |||||||||||||||||| |  ||||||||||||||
Sbjct: 901  caagttcctggggcccttctcggagcagacgccgtcgtacctgacgggcgagttccccgg 960

                                                                        
Query: 297  cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            ||||||||| |||||||| ||||| || || |||||||||||| | ||||| | |||| |
Sbjct: 961  cgactacgggtgggacacggccggcctctccgccgacccggagaccttcgccaagaaccg 1020

                                                                        
Query: 357  ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
             | ||| ||||| |||||| |||||||||| ||||||||||| || || ||| |||||||
Sbjct: 1021 cgagctggaggtcatccacagccggtgggccatgctcggcgcgctcggctgcatcttccc 1080



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score =  143 bits (72), Expect = 5e-31
 Identities = 153/180 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||||||||| ||||| | ||||||||| |||||||| | ||| |||||||| ||
Sbjct: 191 caagtacctgggcccgttctcggagcagacgccatcgtacctgaccggagagttcccggg 250

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 251 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 310

                                                                       
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           || ||| ||| ||||||||   |||||||||||||| || || || || |||||||||||
Sbjct: 311 ggagctggagttgatccactcgcggtgggcgatgctgggggcgctgggctgcgtcttccc 370



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  141 bits (71), Expect = 2e-30
 Identities = 119/135 (88%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 659 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 718

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 719 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 778

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 779 cggctgcgtcttccc 793



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score =  135 bits (68), Expect = 1e-28
 Identities = 167/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||||||||| ||||||||||||||||||||   || | || | ||||| |||
Sbjct: 322 tggtacggcccggaccgggtcaagtacctgggcccctttagcggggagtccccgtcctac 381

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | ||||||||||||||| |||||||| |||||||| ||||||||    |||||||| 
Sbjct: 382 ctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccgacccc 441

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | ||||| | |||| | | ||| |||||||||||||| || ||||||||||| || 
Sbjct: 442 gagaccttcgccaagaaccgcgagctggaggtgatccacgggcgctgggcgatgctgggg 501

                               
Query: 397 gctcttgggtgcgtcttccc 416
           || || ||||||||||||||
Sbjct: 502 gcgctcgggtgcgtcttccc 521



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 198 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 257

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||| ||
Sbjct: 258 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcgcgct 317

                          
Query: 402 tgggtgcgtcttccc 416
            || ||||| |||||
Sbjct: 318 gggctgcgtgttccc 332



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                            
Query: 282      cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
                |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 10793194 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 10793253

                                                                            
Query: 342      gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
                |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 10793254 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 10793313

                               
Query: 402      tgggtgcgtcttccc 416
                 || |||||||||||
Sbjct: 10793314 cggctgcgtcttccc 10793328



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                         
Query: 282   cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
             |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 16917 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 16976

                                                                         
Query: 342   gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
             |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 16977 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 17036

                            
Query: 402   tgggtgcgtcttccc 416
              || |||||||||||
Sbjct: 17037 cggctgcgtcttccc 17051



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                         
Query: 282   cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
             |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 66440 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 66499

                                                                         
Query: 342   gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
             |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||| ||
Sbjct: 66500 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcgcgct 66559

                            
Query: 402   tgggtgcgtcttccc 416
              || ||||| |||||
Sbjct: 66560 gggctgcgtgttccc 66574



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                          
Query: 282    cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
              |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 129812 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 129871

                                                                          
Query: 342    gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
              |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 129872 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 129931

                             
Query: 402    tgggtgcgtcttccc 416
               || |||||||||||
Sbjct: 129932 cggctgcgtcttccc 129946



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 269 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 328

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||| ||
Sbjct: 329 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcgcgct 388

                          
Query: 402 tgggtgcgtcttccc 416
            || ||||| |||||
Sbjct: 389 gggctgcgtgttccc 403



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 268 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 327

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||| ||
Sbjct: 328 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcgcgct 387

                          
Query: 402 tgggtgcgtcttccc 416
            || ||||| |||||
Sbjct: 388 gggctgcgtgttccc 402



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 262 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 321

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 322 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 381

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 382 cggctgcgtcttccc 396



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 267 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 326

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 327 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 386

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 387 cggctgcgtcttccc 401



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 269 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 328

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 329 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 388

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 389 cggctgcgtcttccc 403



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 267 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 326

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 327 gttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 386

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 387 cggctgcgtcttccc 401



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  127 bits (64), Expect = 3e-26
 Identities = 103/116 (88%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 698 cggcgagttccccggcgactacgggtgggacaccgcggggctctccgccgacccggagac 757

                                                                   
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcg 397
           |||||| | |||| ||| ||| ||||||||||||  | ||||||||||||||||||
Sbjct: 758 gttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatgctcggcg 813



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  125 bits (63), Expect = 1e-25
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||||||||||||||| ||||||||||| ||||| || |||||||| ||| |
Sbjct: 276 cggcgagttccccggcgactacgggtgggacaccgcggggctgtcggccgaccccgagac 335

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
            ||||| | |||| ||| ||| |||||||||||| |||||||||| ||||| ||||| ||
Sbjct: 336 cttcgccaagaaccgggagctggaggtgatccactgccggtgggccatgctgggcgcgct 395

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 396 cggctgcgtcttccc 410



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||||||||||||||| |  |||||||||||||| || | |||||| || |||||
Sbjct: 242 caagtacctgggccccttctcggaacagacgccgtcgtatctcaccggcgaatttcccgg 301

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
           ||||||||| ||||||||||||||||| ||||||||||| ||| | ||||| |  |||||
Sbjct: 302 cgactacgggtgggacaccgccgggctctctgccgaccctgagaccttcgccaaaaacag 361

                              
Query: 357 ggcgctagaggtgatccac 375
            | ||| ||||||||||||
Sbjct: 362 agagctggaggtgatccac 380



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  125 bits (63), Expect = 1e-25
 Identities = 117/135 (86%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 267 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 326

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           | |||| | |||| ||| ||| ||||||||||||  ||||||||||||||| ||||| ||
Sbjct: 327 gctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatgctgggcgcgct 386

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 387 cggctgcgtcttccc 401



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  123 bits (62), Expect = 5e-25
 Identities = 116/134 (86%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
           ||||||||||| ||||||||||||||||||||||| ||||| || || ||||||||| ||
Sbjct: 275 ggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacg 334

                                                                       
Query: 343 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
           ||||| | |||| ||| ||| |||||||||||| |||| ||||| ||||| ||||| || 
Sbjct: 335 ttcgccaagaaccgggagctggaggtgatccactgccgctgggccatgctgggcgcgctc 394

                         
Query: 403 gggtgcgtcttccc 416
           || |||||||||||
Sbjct: 395 ggttgcgtcttccc 408



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score =  119 bits (60), Expect = 8e-24
 Identities = 144/172 (83%)
 Strand = Plus / Plus

                                                                       
Query: 245 tgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccggcgactacg 304
           ||||||| ||||||| |||||| || |||||||| | ||| |||||||||||||||||||
Sbjct: 224 tgggcccattctccgagcagaccccatcgtacctgaccggagagttccccggcgactacg 283

                                                                       
Query: 305 gctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagggcgctag 364
           | |||||||| || ||||| || || ||||| ||| | ||||| |||||| | | ||| |
Sbjct: 284 gatgggacactgctgggctgtcggcggacccagagactttcgccaggaaccgtgagctgg 343

                                                               
Query: 365 aggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           |||||||||||    ||||||| |||||||||||||| || |||||||||||
Sbjct: 344 aggtgatccactcgaggtgggccatgctcggcgctctcggttgcgtcttccc 395



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score =  119 bits (60), Expect = 8e-24
 Identities = 132/156 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||||||||| ||||| |  || ||||| |||||||| | |||  ||||||| ||
Sbjct: 206 caagtacctgggcccgttctcggaacaaacgccatcgtacctgaccggaaagttcccggg 265

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||||| |||||||| || ||||| || |||||||||||| ||||||| ||||||||
Sbjct: 266 agactacgggtgggacacggcggggctatcggccgacccggagacgttcgcgaggaacag 325

                                               
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgct 392
           || ||| ||||||||||||  ||||||||| |||||
Sbjct: 326 ggagctggaggtgatccactcccggtgggcaatgct 361



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  117 bits (59), Expect = 3e-23
 Identities = 116/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
           |||||||||||| ||||||||||| ||||||||||| ||||| || |||||||||||| |
Sbjct: 248 cggcgagttcccgggcgactacgggtgggacaccgcggggctctccgccgacccggagac 307

                                                                       
Query: 342 gttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctct 401
           |||||| | |||| ||| ||| ||| ||||||||  ||| ||||||||||| ||||| ||
Sbjct: 308 gttcgccaagaaccgggagctggagctgatccactcccgatgggcgatgctgggcgcgct 367

                          
Query: 402 tgggtgcgtcttccc 416
            || |||||||||||
Sbjct: 368 cggctgcgtcttccc 382



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                        
Query: 283  ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
            ||||||||||| ||||||||||||||||||||||| ||||| || || ||||||||| ||
Sbjct: 1223 ggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacg 1282

                                                                        
Query: 343  ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
            ||||| | |||| ||| ||| ||||||||||||  ||| ||||| ||||| ||||| || 
Sbjct: 1283 ttcgccaagaaccgggagctggaggtgatccactcccgctgggccatgctgggcgcgctc 1342

                          
Query: 403  gggtgcgtcttccc 416
            || |||||||||||
Sbjct: 1343 ggttgcgtcttccc 1356



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  115 bits (58), Expect = 1e-22
 Identities = 115/134 (85%)
 Strand = Plus / Plus

                                                                        
Query: 283  ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
            ||||||||||| ||||||||||||||||||||||| ||||| || || ||||||||| ||
Sbjct: 1223 ggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacg 1282

                                                                        
Query: 343  ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
            ||||| | |||| ||| ||| ||||||||||||  ||| ||||| ||||| ||||| || 
Sbjct: 1283 ttcgccaagaaccgggagctggaggtgatccactcccgctgggccatgctgggcgcgctc 1342

                          
Query: 403  gggtgcgtcttccc 416
            || |||||||||||
Sbjct: 1343 ggctgcgtcttccc 1356



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score =  111 bits (56), Expect = 2e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           |||||||| |||||||| || | |||  |||| || |||||||   || ||||||| |||
Sbjct: 246 tggtacggaccggaccgtgtgatgtatttgggtccattctccggcgagccgccgtcatac 305

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | ||| || |||||||| |||||||| |||||||| || |||||||| || || |||
Sbjct: 306 ctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcggcggatccg 365

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| ||||||| | |||||| | ||| || |||||||||  ||||||||||||||| |||
Sbjct: 366 gagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgctgggc 425

                               
Query: 397 gctcttgggtgcgtcttccc 416
           ||||| |||||||| |||||
Sbjct: 426 gctctcgggtgcgtattccc 445



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score =  101 bits (51), Expect = 2e-18
 Identities = 126/151 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 cgccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggcttt 325
           ||||||| ||||| | ||| || |||||||| |||||||| |||||||| || ||||| |
Sbjct: 288 cgccgtcatacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgt 347

                                                                       
Query: 326 ctgccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtggg 385
           | || || |||||| ||||||| | |||||| | ||| || |||||||||  ||||||||
Sbjct: 348 cggcggatccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtggg 407

                                          
Query: 386 cgatgctcggcgctcttgggtgcgtcttccc 416
           ||||||| |||||||| |||||||| |||||
Sbjct: 408 cgatgctgggcgctctcgggtgcgtattccc 438



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  101 bits (51), Expect = 2e-18
 Identities = 132/159 (83%)
 Strand = Plus / Minus

                                                                         
Query: 217   tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
             ||||||||||| ||||||||||| ||| ||||||| |||||||   || | ||||| |||
Sbjct: 66212 tggtacggcccagaccgcgtcaaatacttgggcccattctccggtgagcccccgtcctac 66153

                                                                         
Query: 277   cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
              | | ||| ||||||||||| ||||||||||||||||| || ||||||||||| ||||| 
Sbjct: 66152 ttgaccggtgagttccccggtgactacggctgggacactgctgggctttctgctgacccc 66093

                                                    
Query: 337   gaggcgttcgctaggaacagggcgctagaggtgatccac 375
             ||| | ||||| | |||| | | ||| ||||||||||||
Sbjct: 66092 gagacattcgccaagaaccgtgagcttgaggtgatccac 66054



to top

>dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M26
          Length = 476

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||| ||||||  |||||  || |||||||||| |  | | |||||||||||
Sbjct: 195 gtggtacggccccgaccgccccaagtggctcggccccttcttccagaacacgccgtcgta 254

                                                        
Query: 276 ccttaacggcgagttccccggcgactacggctgggacaccgccgg 320
           ||| | ||||||||||||||||||||||||||||||||| |||||
Sbjct: 255 cctgaccggcgagttccccggcgactacggctgggacactgccgg 299



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 99/116 (85%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
           ||||||||||| ||||||||||||||||||||||| ||||| || || ||||||||| ||
Sbjct: 223 ggcgagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacg 282

                                                                   
Query: 343 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgc 398
           ||||| | |||| ||| ||| ||||| ||||||  ||| ||||| ||||| |||||
Sbjct: 283 ttcgccaagaaccgggagctggaggtcatccactcccgctgggccatgctgggcgc 338



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 264

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 324

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 325 ggagccctaggctgcgtcttccc 347



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 271 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 330

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 331 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 390

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 391 ggagccctaggctgcgtcttccc 413



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 240 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 299

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 300 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 359

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 360 ggagccctaggctgcgtcttccc 382



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 255 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 314

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 315 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 374

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 375 ggagccctaggctgcgtcttccc 397



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 151 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 210

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 211 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 270

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 271 ggagccctaggctgcgtcttccc 293



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Minus

                                                                         
Query: 274   taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
             ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 16710 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 16651

                                                                         
Query: 334   ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
             || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 16650 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggccatgctc 16591

                                    
Query: 394   ggcgctcttgggtgcgtcttccc 416
             || || || || |||||||||||
Sbjct: 16590 ggagccctaggctgcgtcttccc 16568



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                         
Query: 274   taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
             ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 21943 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 22002

                                                                         
Query: 334   ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
             || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 22003 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 22062

                                    
Query: 394   ggcgctcttgggtgcgtcttccc 416
             || || || || |||||||||||
Sbjct: 22063 ggagccctaggctgcgtcttccc 22085



 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                         
Query: 274   taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
             ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 19297 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 19356

                                                                         
Query: 334   ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
             || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 19357 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 19416

                                    
Query: 394   ggcgctcttgggtgcgtcttccc 416
             || || || || |||||||||||
Sbjct: 19417 ggagccctaggctgcgtcttccc 19439



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||||| ||||| || |||
Sbjct: 422 taccttaccggagagttccccggagactacggatgggacaccgccggactttcagctgac 481

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | |  ||||| || |||||| || ||||||| ||||||
Sbjct: 482 cccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggctatgctc 541

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 542 ggagccctaggctgcgtcttccc 564



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||||||||||||| ||||||| ||||| |   || | ||||| |||
Sbjct: 170 tggtacggcccagaccgcgtcaagtacttgggcccattctctggcgagcccccgtcctac 229

                                                                      
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           || |  ||||||||||| || ||||||||||||||||| || |||||||| ||||||||
Sbjct: 230 ctcactggcgagttcccaggtgactacggctgggacactgctgggctttcggccgaccc 288



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 115/138 (83%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||| ||||||| |||||||   || | ||||| |||
Sbjct: 197 tggtacggcccagaccgtgtcaagtacttgggcccattctccggcgagcccccgtcctac 256

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | |||||||||||| || |||||||| |||||||| || |||||||| || ||||| 
Sbjct: 257 ctcaccggcgagttcccaggtgactacggttgggacactgctgggctttccgctgaccca 316

                             
Query: 337 gaggcgttcgctaggaac 354
           ||| | ||||| ||||||
Sbjct: 317 gagaccttcgccaggaac 334



to top

>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                        
Query: 245  tgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccggcgactacg 304
            ||||||| |||||||   |||| ||||| || || || ||||||||| ||||||||||||
Sbjct: 1818 tgggcccattctccggcgagaccccgtcatatctgaatggcgagttcgccggcgactacg 1877

                                                                        
Query: 305  gctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagggcgctag 364
            | ||||||||||| || || ||  | ||||||||| |||||||  ||||||||| ||| |
Sbjct: 1878 gatgggacaccgctggactgtcgtcagacccggagacgttcgcccggaacagggagctgg 1937

                                      
Query: 365  aggtgatccacggccggtgggcgatg 390
            |||| ||||||| ||| |||||||||
Sbjct: 1938 aggtcatccacgcccgttgggcgatg 1963



to top

>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein
          Length = 1067

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 272 cgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccg 331
           ||||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||
Sbjct: 177 cgtacctgaacggcgagttccccggtgactacggctgggacaccgccggcctgtccgccg 236

               
Query: 332 accc 335
           ||||
Sbjct: 237 accc 240



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 293 ccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctagga 352
           ||||||||||||| |||||||| || ||||| || || ||||||||| |||||||  |||
Sbjct: 1   ccggcgactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgcgga 60

                                                                       
Query: 353 acagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtct 412
           || | | ||| ||||||||||||   |||||||||||||| ||||| || |||||||| |
Sbjct: 61  accgcgagctggaggtgatccactcgcggtgggcgatgctgggcgcgctggggtgcgtgt 120

               
Query: 413 tccc 416
           ||||
Sbjct: 121 tccc 124



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| ||||| || ||||||||||||||||| || || ||||| ||| | |||
Sbjct: 212 gagttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttc 271

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||| ||| ||| |||||||||||| |||| ||||| |||||||| || ||||| 
Sbjct: 272 gccaagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggt 331

                   
Query: 406 tgcgtctt 413
           || |||||
Sbjct: 332 tgtgtctt 339



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| ||||| || ||||||||||||||||| || || ||||| ||| | |||
Sbjct: 417 gagttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttc 476

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||| ||| ||| |||||||||||| |||| ||||| |||||||| || ||||| 
Sbjct: 477 gccaagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggt 536

                   
Query: 406 tgcgtctt 413
           || |||||
Sbjct: 537 tgtgtctt 544



to top

>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M27
          Length = 687

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 101/120 (84%)
 Strand = Plus / Plus

                                                                       
Query: 220 tacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtacctt 279
           |||||||| ||||||| |||||  |||||||||||||| |   | || ||||||||||| 
Sbjct: 119 tacggccccgaccgcgccaagtggctgggccccttctcggatgacaccccgtcgtacctg 178

                                                                       
Query: 280 aacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           | ||||||||| || |||||||||||||||||||| || || || || ||||||||||||
Sbjct: 179 accggcgagtttccgggcgactacggctgggacactgctggcctgtcggccgacccggag 238



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 161/200 (80%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||||| ||||| |||||||   || | || || |||
Sbjct: 192 tggtacggccctgaccgtgtcaagtacctaggcccattctccggcgaggctccatcatac 251

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || | ||| || ||||| || ||||||||||||||||||||||| |||||||| || || 
Sbjct: 252 ctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgatcca 311

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||| | ||  | | |||| | | ||| ||||| |||||| || | ||||| ||||| || 
Sbjct: 312 gagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgcttgga 371

                               
Query: 397 gctcttgggtgcgtcttccc 416
           |||||||| |||||||||||
Sbjct: 372 gctcttggctgcgtcttccc 391



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 317

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 377

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 378 ggagccctaggctgcgtcttccc 400



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 163 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 222

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 223 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 282

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 283 ggagccctaggctgcgtcttccc 305



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 205 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 264

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 324

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 325 ggagccctaggctgcgtcttccc 347



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 258 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 317

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 377

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 378 ggagccctaggctgcgtcttccc 400



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || ||||| || || 
Sbjct: 411 taccttaccggagagttccccggagactacggatgggacaccgctggactttcagctgat 470

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 471 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggctatgctc 530

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 531 ggagccctaggctgcgtcttccc 553



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||| ||||||| ||||| |   || | ||||| |||
Sbjct: 389 tggtacggcccagaccgagtcaagtacttgggcccattctctggcgagcccccgtcctac 448

                                                                      
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           || | ||| |||||||| |||||||||||||||||||| || |||||||| || |||||
Sbjct: 449 ctaaccggtgagttcccaggcgactacggctgggacactgctgggctttccgcagaccc 507



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 214 ggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgacccggag 270



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 187 ggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 243



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctc 257
           |||||||||||| ||||||   |||| |||||||||||||||
Sbjct: 117 gtggtacggccccgaccgcccgaagttcctgggccccttctc 158



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                        
Query: 282  cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggc 341
            |||||||||||||||||||||||| ||||||||||  ||||| || || ||||||||| |
Sbjct: 2133 cggcgagttccccggcgactacgggtgggacaccgaggggctgtcggcggacccggagac 2192

                                                         
Query: 342  gttcgctaggaacagggcgctagaggtgatccacggccggtgggc 386
             ||||| | |||| | | ||| |||||||||||| |||| |||||
Sbjct: 2193 cttcgccaagaaccgcgagctggaggtgatccactgccgctgggc 2237



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                        
Query: 220  tacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtacctt 279
            |||||||| ||||||| |||||  ||||| ||||||||||   | || || || ||||| 
Sbjct: 1093 tacggccccgaccgcgccaagtggctgggacccttctccgatgacaccccctcctacctc 1152

                                                                        
Query: 280  aacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
            |  |||||||||||||| ||||||||||||||||||||||| || || |||||||| |||
Sbjct: 1153 actggcgagttccccggtgactacggctgggacaccgccggcctgtccgccgaccccgag 1212

                     
Query: 340  gcgttcgct 348
             | ||||||
Sbjct: 1213 accttcgct 1221



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                     
Query: 283  ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
            |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 989  ggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgacccggag 1045



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 203 ggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 259



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctc 257
           |||||||||||| ||||||   |||| |||||||||||||||
Sbjct: 133 gtggtacggccccgaccgcccgaagttcctgggccccttctc 174



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 233 ggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 289



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1508

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 651 ggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 707



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 861 ggcgagttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 917



to top

>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting
            chlorophyll a/b-binding protein 1, complete cds
          Length = 1975

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 133/164 (81%)
 Strand = Plus / Plus

                                                                        
Query: 245  tgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccggcgactacg 304
            ||||||| |||||||   |||| || |||||||| ||||| |||||| | || |||||||
Sbjct: 1227 tgggccctttctccggtgagaccccctcgtacctgaacggtgagttcgctggagactacg 1286

                                                                        
Query: 305  gctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagggcgctag 364
            |||||||||||||||| || ||  | ||||| ||| | |||||  | ||||||| | | |
Sbjct: 1287 gctgggacaccgccggactctcgtcggaccccgagaccttcgcccgcaacagggagttgg 1346

                                                        
Query: 365  aggtgatccacggccggtgggcgatgctcggcgctcttgggtgc 408
            |||| ||||||| ||| ||||| |||||||| ||||| ||||||
Sbjct: 1347 aggtcatccacgcccgctgggccatgctcggagctctggggtgc 1390



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
            ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 3045 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 2986

                                                                        
Query: 334  ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
            || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 2985 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 2926

                                   
Query: 394  ggcgctcttgggtgcgtcttccc 416
            || || || || ||||| |||||
Sbjct: 2925 ggagccctaggctgcgttttccc 2903



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 274  taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
            ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 3084 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 3025

                                                                        
Query: 334  ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
            || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 3024 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 2965

                                   
Query: 394  ggcgctcttgggtgcgtcttccc 416
            || || || || ||||| |||||
Sbjct: 2964 ggagccctaggctgcgttttccc 2942



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 254 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 313

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 314 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 373

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 374 ggagccctaggctgcgttttccc 396



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 304 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 363

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 364 gcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgctctgggt 423

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 424 tgcgttttccc 434



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 234 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 293

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 294 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 353

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 354 tgcgttttccc 364



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                         
Query: 274   taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
             ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 93802 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 93743

                                                                         
Query: 334   ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
             || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 93742 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 93683

                                    
Query: 394   ggcgctcttgggtgcgtcttccc 416
             || || || || ||||| |||||
Sbjct: 93682 ggagccctaggctgcgttttccc 93660



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                         
Query: 286   gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
             ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 95518 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 95577

                                                                         
Query: 346   gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
             ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 95578 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 95637

                        
Query: 406   tgcgtcttccc 416
             ||||| |||||
Sbjct: 95638 tgcgttttccc 95648



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                         
Query: 274   taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
             ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 80400 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 80459

                                                                         
Query: 334   ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
             || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 80460 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 80519

                                    
Query: 394   ggcgctcttgggtgcgtcttccc 416
             || || || || ||||| |||||
Sbjct: 80520 ggagccctaggctgcgttttccc 80542



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                         
Query: 286   gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
             ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 78684 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 78625

                                                                         
Query: 346   gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
             ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 78624 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 78565

                        
Query: 406   tgcgtcttccc 416
             ||||| |||||
Sbjct: 78564 tgcgttttccc 78554



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 199 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 258

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 259 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 318

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 319 ggagccctaggctgcgttttccc 341



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 280 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 339

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 340 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 399

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 400 tgcgttttccc 410



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 250 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 309

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 310 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 369

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 370 ggagccctaggctgcgttttccc 392



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 219 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 160

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 159 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 100

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 99  ggagccctaggctgcgttttccc 77



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 231 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 290

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 291 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 350

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 351 ggagccctaggctgcgttttccc 373



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 234 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 293

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 294 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 353

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 354 ggagccctaggctgcgttttccc 376



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 499 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 558

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 559 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 618

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 619 ggagccctaggctgcgttttccc 641



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                        
Query: 286  gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
            ||||||||||| |||||||| |||||||| || |||||||| || || || ||| | || 
Sbjct: 1382 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagactttt 1441

                                                                        
Query: 346  gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
            || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 1442 gcgaagaacagagagctggaagtgatccacagccggtgggcaatgctgggcgctctgggt 1501

                       
Query: 406  tgcgtcttccc 416
            ||||| |||||
Sbjct: 1502 tgcgttttccc 1512



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
           |||||||||||||| ||||||||||||||||||||||| || || || ||||||||| | 
Sbjct: 207 ggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgacccggagacc 266

                                                                       
Query: 343 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
           |||    |  || | | ||| ||| ||||||||| ||| ||||| |||||||||||||| 
Sbjct: 267 ttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctcggcgctctg 326

                         
Query: 403 gggtgcgtcttccc 416
           || ||| |||||||
Sbjct: 327 ggctgcatcttccc 340



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
           |||||||||||||| ||||||||||||||||||||||| || || || ||||||||| | 
Sbjct: 215 ggcgagttccccggtgactacggctgggacaccgccggcctgtccgctgacccggagacc 156

                                                                       
Query: 343 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
           |||    |  || | | ||| ||| ||||||||| ||| ||||| |||||||||||||| 
Sbjct: 155 ttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctcggcgctctg 96

                         
Query: 403 gggtgcgtcttccc 416
           || ||| |||||||
Sbjct: 95  ggctgcatcttccc 82



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           ||||||||||||||| ||||||||||||||||||||||| || || || |||||||||
Sbjct: 198 cggcgagttccccggtgactacggctgggacaccgccggcctgtcggctgacccggag 255



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 125/154 (81%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           |||||||||||||||||| || |  |||||||||||||| || | ||| || || |||||
Sbjct: 74  caagtacctgggccccttttcggaacagacgccgtcgtatctcaccggagaatttcccgg 133

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            || ||||| |||||||||||||| || || |||||||| ||| | ||||| |  || ||
Sbjct: 134 ggattacgggtgggacaccgccggactctcggccgacccagagaccttcgccaaaaatag 193

                                             
Query: 357 ggcgctagaggtgatccacggccggtgggcgatg 390
            | ||| |||||||||||| || | |||||||||
Sbjct: 194 agagctggaggtgatccacagcagatgggcgatg 227



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 342
           |||||||||||||| ||||||||||||||||||||||| || || || ||||||||| | 
Sbjct: 191 ggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgacccggagacc 250

                                                                       
Query: 343 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 402
           |||    |  || | | ||| ||| ||||||||| ||| ||||| |||||||||||||| 
Sbjct: 251 ttcaagcgctaccgcgagctggagctgatccacgcccgctgggccatgctcggcgctctg 310

                         
Query: 403 gggtgcgtcttccc 416
           || ||| |||||||
Sbjct: 311 ggctgcatcttccc 324



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 287 agttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||||| || || || |||||||||
Sbjct: 205 agttccccggcgactacggctgggacaccgccggtctgtcggctgacccggag 257



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||| ||||| || || || |||||||||
Sbjct: 206 ggcgagttccccggcgactacggctgggacactgccggtctgtcggctgacccggag 262



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||| ||||||||||||||||||||||| || || || |||||||||
Sbjct: 205 ggcgagttccccggtgactacggctgggacaccgccggtctgtccgctgacccggag 261



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 ccgtcgtaccttaacggcgagttccccggcgactacggctgggacaccgccgggctttct 327
           ||||||||||| | ||| || ||||| || |||||||| |||||||| || ||||| || 
Sbjct: 236 ccgtcgtacctaaccggtgaattcccgggtgactacgggtgggacacggcggggctgtcg 295

                                                                       
Query: 328 gccgacccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcg 387
           || || |||||| ||||||| | |||||| | ||| || |||||||||||||| ||||| 
Sbjct: 296 gcagatccggagacgttcgcgaagaacagagagctggaagtgatccacggccgatgggcc 355

                                        
Query: 388 atgctcggcgctcttgggtgcgtcttccc 416
           ||| | || ||||| || ||||| |||||
Sbjct: 356 atgttgggtgctctgggctgcgtattccc 384



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 106/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 288 gttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgc 347
           ||||||||| |||||||| |||||||| || ||||| ||||| || || ||  | |||||
Sbjct: 47  gttccccggtgactacggttgggacactgctgggctctctgctgatcctgaaacattcgc 106

                                                                       
Query: 348 taggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtg 407
            | |||| | | ||| ||||| |||||| || | ||||| |||||||| |||||||||||
Sbjct: 107 caagaaccgtgagcttgaggtcatccacagcagatgggccatgctcggagctcttgggtg 166

                    
Query: 408 cgtcttccc 416
           |||||||||
Sbjct: 167 cgtcttccc 175



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||||||||||||||||||||||| ||||| || || || |||||||||
Sbjct: 211 ggcgagttccccggcgactacggctgggacactgccggtctgtcggctgacccggag 267



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 272 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 331

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 332 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 391

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 392 ggagccctaggctgcgtcttccc 414



to top

>gb|AC147802.2| Oryza sativa chromosome 3 BAC OSJNBb0013C14 genomic sequence, complete
             sequence
          Length = 132981

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 286   gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgtt 344
             |||||||||||| |||||||||| || ||||||| ||| || |||||||||||||||||
Sbjct: 94124 gagttccccggctactacggctgagataccgccgagctctccgccgacccggaggcgtt 94066



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 258 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 317

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 377

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 378 ggagccctaggctgcgtcttccc 400



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| |||  |||||||||| |||||||| ||||||||||| || || || ||||  
Sbjct: 277 taccttaccggacagttccccggagactacggatgggacaccgcaggtctctcagccgta 336

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| ||||||  |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 337 cccgagacgttcgtgaggaaccgtgagctagaagttatccactgcaggtgggccatgctc 396

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 397 ggtgccctaggctgcgtcttccc 419



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 258 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 317

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 318 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 377

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 378 ggagccctaggctgcgtcttccc 400



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 205 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 264

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 324

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 325 ggagccctaggctgcgtcttccc 347



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||||||||| ||||| || ||||| ||| | |||
Sbjct: 256 gagttccccggtgactacggatgggacaccgccggtctttccgctgaccccgagaccttc 315

                                                          
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgct 392
           || |||||| | | |||||| || |||||| || | ||||| |||||
Sbjct: 316 gccaggaaccgtgagctagaagttatccactgcagatgggccatgct 362



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 257 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 316

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 317 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 376

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 377 ggagccctaggctgcgtcttccc 399



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 205 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 264

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 265 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 324

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 325 ggagccctaggctgcgtcttccc 347



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 251 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 310

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 311 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 370

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 371 ggagccctaggctgcgtcttccc 393



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 257 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 316

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 317 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 376

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 377 ggagccctaggctgcgtcttccc 399



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 107/131 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||||||||| || || || ||||| ||| | |||
Sbjct: 31  gagttccccggagactacggatgggacaccgccggtctctccgctgaccccgagaccttc 90

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || |||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 91  gccaggaaccgtgagctagaagttatccactgcagatgggccatgctcggagccctaggc 150

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 151 tgcgttttccc 161



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 243 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 302

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 303 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 362

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 363 ggagccctaggctgcgtcttccc 385



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 241 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 300

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||  | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 301 ccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 360

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 361 ggagccctaggctgcgttttccc 383



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 685 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 626

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| ||| || | | |||||| || |||||| || | ||||| ||||||
Sbjct: 625 ccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggccatgctc 566

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 565 ggagccctaggctgcgttttccc 543



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 272 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 331

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 332 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 391

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 392 ggagccctaggctgcgtcttccc 414



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||| ||||||| |||||  ||||| ||||||||| |  | || ||  | ||
Sbjct: 146 gtggtacggccccgaccgcgccaagtggctgggtcccttctccaccaacacccccgccta 205

                                                  
Query: 276 ccttaacggcgagttccccggcgactacggctgggacac 314
           ||| | ||||||||||||||| |||||||||||||||||
Sbjct: 206 cctgaccggcgagttccccggtgactacggctgggacac 244



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| |||||||| || |||||||| |||||||| || || || || || |||
Sbjct: 350 taccttaccggagagttccctggagactacggatgggacacagctggtctatccgctgac 409

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || ||||||| ||||||
Sbjct: 410 cccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctc 469

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || |||||||||||
Sbjct: 470 ggagccctaggctgcgtcttccc 492



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 107/131 (81%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || |||||||| || || || |||   || 
Sbjct: 289 gagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagaatttt 348

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || | |||||| | ||| || ||||||||| |||||||||| ||||| |||||||| || 
Sbjct: 349 gcgaagaacagagagctggaagtgatccactgccggtgggcaatgctgggcgctctgggt 408

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 409 tgcgttttccc 419



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 113/139 (81%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||||| ||||||||||| |  |||||||| ||||| || |  || || || |||||
Sbjct: 108 caagtacctcggccccttctcggaacagacgccctcgtatctcacgggagaatttcccgg 167

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||||| |||||||| |||||||| |||||||| || ||| | ||||| |  |||||
Sbjct: 168 agactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaacag 227

                              
Query: 357 ggcgctagaggtgatccac 375
            | ||| ||||||||||||
Sbjct: 228 agagctggaggtgatccac 246



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 298 gactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagg 357
           |||||||| |||||||| || ||||| || || ||||||||| ||||||| | |||||| 
Sbjct: 299 gactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgaagaacaga 358

                                                                      
Query: 358 gcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           | ||| ||||||||||||   |||||||||||| | || || || || |||||||||||
Sbjct: 359 gagctggaggtgatccactcgcggtgggcgatgttgggagccctgggctgcgtcttccc 417



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgg 320
           |||||||||||||||||||||||||||||| |||||||
Sbjct: 256 ggcgagttccccggcgactacggctgggactccgccgg 293



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 283 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           |||||||||||||| |||||||||||||| |||||||| || ||||| |||||
Sbjct: 211 ggcgagttccccggtgactacggctgggataccgccggtctgtctgctgaccc 263



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 220 tacggcccggaccgcgtcaagtacctgggccccttctccg 259
           |||||||| ||||||| ||||| |||||||||||||||||
Sbjct: 145 tacggccctgaccgcgccaagttcctgggccccttctccg 184



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 125/156 (80%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           |||||||||||| || ||||| | |||||  ||||| ||||| | ||| || ||||||||
Sbjct: 480 caagtacctgggtccattctcagagcagattccgtcatacctgaccggagaattccccgg 539

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            |||||||| |||||||| || || || || || ||||||||  | ||||| |||||| |
Sbjct: 540 tgactacggatgggacactgctggactatcagctgacccggaaaccttcgccaggaaccg 599

                                               
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgct 392
           || ||| |||||||| ||| || | ||||| |||||
Sbjct: 600 ggagctggaggtgattcacagcagatgggccatgct 635



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 276 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 335

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 336 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 395

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 396 tgcgttttccc 406



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| ||||| || |||||||||||||| || || || || 
Sbjct: 33  taccttaccggagagttccccggtgactatggatgggacaccgccggtctatccgctgat 92

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || | ||||| ||||||
Sbjct: 93  ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatgctc 152

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 153 ggagccctaggctgcgttttccc 175



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| |||||||| |||||||| || || || || || ||||| ||| | || 
Sbjct: 45  gagttccccggagactacggatgggacacagctggcctatccgctgaccccgagacattt 104

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           || |||||| | | |||||| || |||||| || ||||||| |||||||| || || || 
Sbjct: 105 gcaaggaaccgtgagctagaagttatccacagcaggtgggccatgctcggagccctaggc 164

                      
Query: 406 tgcgtcttccc 416
           |||||||||||
Sbjct: 165 tgcgtcttccc 175



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 214 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 273

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 274 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 333

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 334 tgcgttttccc 344



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 276 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 335

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 336 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 395

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 396 tgcgttttccc 406



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 276 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 335

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 336 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 395

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 396 tgcgttttccc 406



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 276 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 335

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 336 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 395

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 396 tgcgttttccc 406



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| |||||||||||  | || || ||||||
Sbjct: 229 taccttaccggtgagttccccggtgactacggatgggacaccgcttgtctatccgccgac 288

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||| | ||||| |||||| | | |||||| || |||||| || |  |||| ||||||
Sbjct: 289 ccagagaccttcgccaggaaccgtgagctagaagttatccacagcagaagggccatgctc 348

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 349 ggagccctaggctgcgttttccc 371



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                       
Query: 274 taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
           ||||||| ||| ||||||||||| |||||||| ||||||||||| || || || ||||||
Sbjct: 234 taccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgccgac 293

                                                                       
Query: 334 ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
           || ||  | ||||| |||||| | | || ||| || |||||| || | ||||| ||||||
Sbjct: 294 ccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggccatgctc 353

                                  
Query: 394 ggcgctcttgggtgcgtcttccc 416
           || || || || ||||| |||||
Sbjct: 354 ggagccctaggctgcgttttccc 376



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 276 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 335

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 336 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 395

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 396 tgcgttttccc 406



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0505D12
          Length = 146951

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 286   gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgtt 344
             |||||||||||| |||||||||| || ||||||| ||| |  |||||||||||||||||
Sbjct: 37904 gagttccccggctactacggctgagataccgccgagctctgcgccgacccggaggcgtt 37846



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 514 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 573

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 574 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 633

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 634 tgcgttttccc 644



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           ||||||||||| || ||||| |||||||| ||||| || || ||||| || ||| | |||
Sbjct: 214 gagttccccggtgattacgggtgggacactgccggtctatccgccgatcccgagaccttc 273

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
           ||||||||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 274 gctaggaaccgtgagctagaagttatccacagcagatgggccatgctcggagccctaggc 333

                      
Query: 406 tgcgtcttccc 416
           ||||| |||||
Sbjct: 334 tgcgttttccc 344



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| || |||||  ||||||| ||||| |   || |||| || |||
Sbjct: 163 tggtacggcccagaccgtgttaagtatttgggcccattctctggtgagtcgccatcctac 222

                                                                      
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           |||| ||| || || ||||| ||||||||||||||||| || |||||||| || |||||
Sbjct: 223 cttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctgaccc 281



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
           |||||||| |||||||| || |||||||| || || ||||| || ||||||||| | |||
Sbjct: 226 gagttccctggcgactatgggtgggacactgctggactttcggctgacccggagaccttc 285

                                                                       
Query: 346 gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
            | | |||| ||| ||| |||||||||||| | || ||||| ||||| || || ||||| 
Sbjct: 286 tccaagaaccgggagctggaggtgatccactgtcgctgggccatgcttggggcacttggt 345

                      
Query: 406 tgcgtcttccc 416
           || ||||||||
Sbjct: 346 tgtgtcttccc 356



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| || |||||| ||||||| |||||||   |||  || || |||
Sbjct: 200 tggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcccatcatac 259

                                                                      
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           || | ||| |||||||| || |||||||| |||||||| || |||||||| || |||||
Sbjct: 260 ctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgaccc 318



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           |||||||| ||||||||||| |||||||| ||||||||||| || |||||
Sbjct: 211 gagttccctggcgactacggttgggacacagccgggctttcagctgaccc 260



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctc 257
           |||||||||||||||  | ||||||||| ||||||| |||||
Sbjct: 141 gtggtacggcccggatagagtcaagtacttgggcccattctc 182



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 110/137 (80%)
 Strand = Plus / Plus

                                                                        
Query: 274  taccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgac 333
            ||||||||||| |||||| | || |||||||| ||||||||||| || || ||  |||||
Sbjct: 2428 taccttaacggtgagttcgctggtgactacggatgggacaccgctggactctcctccgac 2487

                                                                        
Query: 334  ccggaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctc 393
            || ||| | || ||  | ||||||| ||| ||||| || |||| ||| ||||| ||||||
Sbjct: 2488 cccgagacctttgcccgcaacagggagcttgaggttattcacgcccgctgggccatgctc 2547

                             
Query: 394  ggcgctcttgggtgcgt 410
            || ||| | ||||||||
Sbjct: 2548 ggagctttggggtgcgt 2564



to top

>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070
           (LHCB2.2) mRNA, complete cds
          Length = 1060

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 279 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 338

               
Query: 351 gaac 354
           ||||
Sbjct: 339 gaac 342



to top

>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
            serine/threonine kinase/ protein-tyrosine kinase
            AT2G05060 transcript variant AT2G05060.2 mRNA, complete
            cds
          Length = 2130

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 291  ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
            |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 1861 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 1802

                
Query: 351  gaac 354
            ||||
Sbjct: 1801 gaac 1798



to top

>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100
           (LHCB2.1) mRNA, complete cds
          Length = 1068

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 280 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 339

               
Query: 351 gaac 354
           ||||
Sbjct: 340 gaac 343



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 157/200 (78%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||| ||||||| ||||| |   || | || || |||
Sbjct: 133 tggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagcccccatcttac 192

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           ||||  || || ||||| || ||||| ||||||||||| || |||||||| || ||||| 
Sbjct: 193 cttactggtgaattccctggtgactatggctgggacactgctgggctttcagctgaccca 252

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||  | || || | |||| | | ||| || |||||||||  | | ||||| ||||| || 
Sbjct: 253 gaaacctttgccaagaaccgtgagcttgaagtgatccactccagatgggccatgcttgga 312

                               
Query: 397 gctcttgggtgcgtcttccc 416
           ||||||||||| ||||||||
Sbjct: 313 gctcttgggtgtgtcttccc 332



to top

>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence
          Length = 1047

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 365 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 424

               
Query: 351 gaac 354
           ||||
Sbjct: 425 gaac 428



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 127/160 (79%)
 Strand = Plus / Plus

                                                                       
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgta 275
           |||||||||||| |||||||| |||||| |||| || |||||||   || | |||   ||
Sbjct: 36  gtggtacggccctgaccgcgttaagtacttggggccattctccggtgagtccccgagcta 95

                                                                       
Query: 276 ccttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           | | | ||| ||||||||||| ||||||||||||||||| || || || || || |||||
Sbjct: 96  cttgaccggtgagttccccggtgactacggctgggacactgctggactctcagctgaccc 155

                                                   
Query: 336 ggaggcgttcgctaggaacagggcgctagaggtgatccac 375
            ||| | ||||| | |||| | | ||| ||||||||||||
Sbjct: 156 agagaccttcgccaagaaccgtgagcttgaggtgatccac 195



to top

>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070) mRNA, complete cds
          Length = 881

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 219 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 278

               
Query: 351 gaac 354
           ||||
Sbjct: 279 gaac 282



to top

>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete
            sequence
          Length = 13145

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                        
Query: 291  ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
            |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 5582 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 5523

                
Query: 351  gaac 354
            ||||
Sbjct: 5522 gaac 5519



to top

>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete
             sequence
          Length = 103889

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                         
Query: 291   ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
             |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 81584 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 81525

                 
Query: 351   gaac 354
             ||||
Sbjct: 81524 gaac 81521



to top

>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 798

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 219 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 278

               
Query: 351 gaac 354
           ||||
Sbjct: 279 gaac 282



to top

>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein
           (At2g05070; F1O13.20) mRNA, complete cds
          Length = 958

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 279 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 338

               
Query: 351 gaac 354
           ||||
Sbjct: 339 gaac 342



to top

>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds
          Length = 929

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 277 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 336

               
Query: 351 gaac 354
           ||||
Sbjct: 337 gaac 340



to top

>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 1001

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 278 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 337

               
Query: 351 gaac 354
           ||||
Sbjct: 338 gaac 341



to top

>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds
          Length = 943

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 273 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 332

               
Query: 351 gaac 354
           ||||
Sbjct: 333 gaac 336



to top

>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS37ZB02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 980

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 258 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 317

               
Query: 351 gaac 354
           ||||
Sbjct: 318 gaac 321



to top

>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS18ZH11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 912

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 241 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 300

               
Query: 351 gaac 354
           ||||
Sbjct: 301 gaac 304



to top

>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 933

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 260 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 319

               
Query: 351 gaac 354
           ||||
Sbjct: 320 gaac 323



to top

>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZB12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 937

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 250 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 309

               
Query: 351 gaac 354
           ||||
Sbjct: 310 gaac 313



to top

>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 859

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 256 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 315

               
Query: 351 gaac 354
           ||||
Sbjct: 316 gaac 319



to top

>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 941

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 256 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 315

               
Query: 351 gaac 354
           ||||
Sbjct: 316 gaac 319



to top

>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZF11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 906

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 268 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 327

               
Query: 351 gaac 354
           ||||
Sbjct: 328 gaac 331



to top

>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 873

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 262 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 321

               
Query: 351 gaac 354
           ||||
Sbjct: 322 gaac 325



to top

>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS3ZD09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 964

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 270 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 329

               
Query: 351 gaac 354
           ||||
Sbjct: 330 gaac 333



to top

>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 914

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 239 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 298

               
Query: 351 gaac 354
           ||||
Sbjct: 299 gaac 302



to top

>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZE07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 917

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 241 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 300

               
Query: 351 gaac 354
           ||||
Sbjct: 301 gaac 304



to top

>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 267 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 326

               
Query: 351 gaac 354
           ||||
Sbjct: 327 gaac 330



to top

>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS17ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 922

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 241 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 300

               
Query: 351 gaac 354
           ||||
Sbjct: 301 gaac 304



to top

>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB85ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 926

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 255 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 314

               
Query: 351 gaac 354
           ||||
Sbjct: 315 gaac 318



to top

>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS22ZD11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 261 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 320

               
Query: 351 gaac 354
           ||||
Sbjct: 321 gaac 324



to top

>gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chlorophyll-binding protein
           mRNA, partial cds, nuclear gene for chloroplast product
          Length = 470

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 103/128 (80%)
 Strand = Plus / Plus

                                                                       
Query: 289 ttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgct 348
           ||||| || |||||||||||||| ||||| ||  | || || ||||| ||| | || |||
Sbjct: 7   ttccctggtgactacggctgggataccgctggtttatcagcagaccccgagacatttgct 66

                                                                       
Query: 349 aggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgc 408
           | |||| | | || ||||||||||||| || | ||||| ||||| || |||||||| |||
Sbjct: 67  aagaaccgtgagccagaggtgatccacagcagatgggcaatgcttggagctcttggctgc 126

                   
Query: 409 gtcttccc 416
           ||||||||
Sbjct: 127 gtcttccc 134



to top

>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds
          Length = 967

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 268 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 327

               
Query: 351 gaac 354
           ||||
Sbjct: 328 gaac 331



to top

>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds
          Length = 943

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 269 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 328

               
Query: 351 gaac 354
           ||||
Sbjct: 329 gaac 332



to top

>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds
          Length = 974

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 277 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 336

               
Query: 351 gaac 354
           ||||
Sbjct: 337 gaac 340



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 292 cccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||||| |||||||| ||||||||||||||||| || ||||||||
Sbjct: 12  cccggagactacgggtgggacaccgccgggctctcggccgaccc 55



to top

>gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlorophyll a/b binding
           protein (At2g05100) mRNA, complete cds
          Length = 829

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 291 ccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctag 350
           |||||| |||||||||||||||||||| || || || || ||||||||| | ||||||| 
Sbjct: 219 ccccggagactacggctgggacaccgctggactctcggctgacccggagacattcgctaa 278

               
Query: 351 gaac 354
           ||||
Sbjct: 279 gaac 282



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 142/180 (78%)
 Strand = Plus / Plus

                                                                       
Query: 237 caagtacctgggccccttctccgcgcagacgccgtcgtaccttaacggcgagttccccgg 296
           ||||||| | ||||||||||| | ||| || || || |||||||  || || ||||||||
Sbjct: 189 caagtacttaggccccttctcagagcaaaccccatcataccttacaggtgaattccccgg 248

                                                                       
Query: 297 cgactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacag 356
            || ||||| |||||||| || || || || || ||||| ||  | ||||||| |||| |
Sbjct: 249 tgattacggttgggacactgctggactctcagctgacccagaaacattcgctaagaaccg 308

                                                                       
Query: 357 ggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
            | |||||||||||||||| || | ||||| ||||| || || ||||| ||||| |||||
Sbjct: 309 tgagctagaggtgatccactgcagatgggcaatgcttggtgcccttggatgcgttttccc 368



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 361 ctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           ||||||||||||||| || ||||||| ||||| || |||||||| || ||||||||
Sbjct: 289 ctagaggtgatccactgcaggtgggctatgcttggtgctcttggatgtgtcttccc 344



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 282 cggcgagttccccggcgactacggctgggacaccgc 317
           ||||||||||||||| |||||||||||||| |||||
Sbjct: 401 cggcgagttccccggtgactacggctgggataccgc 436



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 157/200 (78%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||| ||||||| ||||| |   || | || || |||
Sbjct: 189 tggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagcccccatcttac 248

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           ||||  || || ||||| || ||||| ||||||||||| || ||||| || || ||||| 
Sbjct: 249 cttactggtgaattccctggtgactatggctgggacactgctgggctatcagctgaccca 308

                                                                       
Query: 337 gaggcgttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggc 396
           ||  | || |||| |||| | | ||| || |||||||||  | | ||||| ||||| || 
Sbjct: 309 gaaacctttgctaagaaccgtgagcttgaagtgatccactccagatgggccatgcttgga 368

                               
Query: 397 gctcttgggtgcgtcttccc 416
           ||||||||||| ||||||||
Sbjct: 369 gctcttgggtgtgtcttccc 388



to top

>gb|AY954742.1| Ostreococcus tauri chloroplast prasinophyte chlorophyll a/b-binding
           protein Lhcp2.3 gene, complete cds; nuclear gene for
           chloroplast product
          Length = 1066

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 367 gtgatccacggccggtgggcgatgctcggcg 397
           |||||||||||||| ||||||||||||||||
Sbjct: 548 gtgatccacggccgctgggcgatgctcggcg 578



to top

>gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence
          Length = 926

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 99/123 (80%)
 Strand = Plus / Plus

                                                                       
Query: 192 cagaatcaccatgggcaacgacttgtggtacggcccggaccgcgtcaagtacctgggccc 251
           |||| |||||||| | || || ||||||||||| || ||||| || |||||| |||| ||
Sbjct: 148 cagattcaccatgagtaatgatttgtggtacggacctgaccgtgttaagtacttgggacc 207

                                                                       
Query: 252 cttctccgcgcagacgccgtcgtaccttaacggcgagttccccggcgactacggctggga 311
           ||| || || || || || || ||| | ||||| |||||||| || |||||||| |||||
Sbjct: 208 cttttctgctcaaactccttcttacttgaacggagagttccctggtgactacggatggga 267

              
Query: 312 cac 314
           |||
Sbjct: 268 cac 270



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                        
Query: 286  gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
            ||||||||||| ||||| || ||||||||||| || || || || ||||| ||| | |||
Sbjct: 1789 gagttccccggagactatggatgggacaccgctggtctatcagctgaccccgagactttc 1848

                                                                        
Query: 346  gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
            ||||| ||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 1849 gctagaaaccgtgagctagaagttatccactgcagatgggccatgctcggagccctaggt 1908

                       
Query: 406  tgcgtcttccc 416
            ||||| |||||
Sbjct: 1909 tgcgttttccc 1919



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m1 gene, complete cds; nuclear gene for chloroplast
           product
          Length = 1934

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 298 gactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagg 357
           ||||||||||||||||||||||| || || || ||||||||| | |||    |  || | 
Sbjct: 782 gactacggctgggacaccgccggtctgtccgctgacccggagaccttcaagcgctaccgc 841

                                                                      
Query: 358 gcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           | ||| ||| ||||||||| ||| ||||| |||||||||||||| || ||| |||||||
Sbjct: 842 gagctggagctgatccacgcccgctgggccatgctcggcgctctgggctgcatcttccc 900



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| ||||||||  ||||||| |||||||   || | || || |||
Sbjct: 197 tggtacggcccagaccgtgtcaagtatttgggcccattctccggtgaggccccatcttac 256

                                                                      
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           || |  || || ||||| || ||||| || |||||||| |||||||||||||| |||||
Sbjct: 257 ctcactggtgaattcccaggtgactatggttgggacactgccgggctttctgctgaccc 315



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 99/123 (80%)
 Strand = Plus / Plus

                                                                       
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccgcgcagacgccgtcgtac 276
           ||||||||||| ||||| || |||||||||||||| ||||| |   || | || || |||
Sbjct: 198 tggtacggcccagaccgtgtgaagtacctgggcccattctcgggtgaggctccttcttac 257

                                                                       
Query: 277 cttaacggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccg 336
           || |  || || ||||| || ||||| || |||||||| ||||||||||| || ||||||
Sbjct: 258 ctgacgggggaattcccaggtgactatgggtgggacactgccgggctttcggctgacccg 317

              
Query: 337 gag 339
           |||
Sbjct: 318 gag 320



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                        
Query: 286  gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
            ||||||||||| ||||| || ||||||||||| || || || || ||||| ||| | |||
Sbjct: 1790 gagttccccggagactatggatgggacaccgctggtctatcagctgaccccgagactttc 1849

                                                                        
Query: 346  gctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctcttggg 405
            ||||| ||| | | |||||| || |||||| || | ||||| |||||||| || || || 
Sbjct: 1850 gctagaaaccgtgagctagaagttatccactgcagatgggccatgctcggagccctaggt 1909

                       
Query: 406  tgcgtcttccc 416
            ||||| |||||
Sbjct: 1910 tgcgttttccc 1920



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                        
Query: 286  gagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcgttc 345
            |||||||| || || ||||| |||||||| || || ||||| || ||||| ||| | |||
Sbjct: 948  gagttcccaggtgattacgggtgggacactgctggactttcagctgacccagagacattc 1007

                                                           
Query: 346  gctaggaacagggcgctagaggtgatccacggccggtgggcgatgct 392
            ||||||||| | | ||| |||||||||||  |||| ||||| |||||
Sbjct: 1008 gctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 217 tggtacggcccggaccgcgtcaagtacctgggccccttctccg 259
           ||||||||||| ||||| ||||||||||| ||||| |||||||
Sbjct: 207 tggtacggcccagaccgtgtcaagtacctaggcccattctccg 249



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 298 gactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagg 357
           |||||||| |||||||| || || ||||| || ||||| ||  | ||||||| |||| | 
Sbjct: 267 gactacggatgggacactgctggactttcagctgaccctgaaacattcgctaagaaccgt 326

                                                                      
Query: 358 gcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           | ||| |||||||||||| || | ||||| ||||| || |||||||| || ||||||||
Sbjct: 327 gagcttgaggtgatccactgcagatgggccatgcttggtgctcttggatgtgtcttccc 385



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 1781

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 96/119 (80%)
 Strand = Plus / Plus

                                                                       
Query: 298 gactacggctgggacaccgccgggctttctgccgacccggaggcgttcgctaggaacagg 357
           ||||||||||||||||||||||| || || || ||||||||| | |||    |  || | 
Sbjct: 695 gactacggctgggacaccgccggtctgtccgctgacccggagaccttcaagcgctaccgc 754

                                                                      
Query: 358 gcgctagaggtgatccacggccggtgggcgatgctcggcgctcttgggtgcgtcttccc 416
           | ||| ||| ||||||||| ||| ||||| |||||||||||||| || ||| |||||||
Sbjct: 755 gagctggagctgatccacgcccgctgggccatgctcggcgctctgggctgcatcttccc 813



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||||||||||| |||||||| |||||||| ||||| || ||||| |||||
Sbjct: 217 gagttccccggtgactacggttgggacactgccggactctctgctgaccc 266



to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 292  cccggcgactacggctgggacaccgc 317
            ||||||||||||||||||||||||||
Sbjct: 5744 cccggcgactacggctgggacaccgc 5769



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 292  cccggcgactacggctgggacaccgc 317
            ||||||||||||||||||||||||||
Sbjct: 4448 cccggcgactacggctgggacaccgc 4473



 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 292  cccggcgactacggctgggacac 314
            |||||||||||||||||||||||
Sbjct: 1005 cccggcgactacggctgggacac 1027



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 51/58 (87%), Gaps = 1/58 (1%)
 Strand = Plus / Plus

                                                                     
Query: 282 cggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggag 339
           |||||||||||  ||||| ||||||||||||||||| ||| | ||||| |||||||||
Sbjct: 251 cggcgagttccg-ggcgattacggctgggacaccgcaggggtctctgctgacccggag 307



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 286  gagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
            ||||||||||| |||||||| |||||||| ||||| || ||||| |||||
Sbjct: 1533 gagttccccggtgactacggttgggacactgccggactctctgctgaccc 1582



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 286 gagttccccggcgactacggctgggacaccgccgggctttctgccgaccc 335
           ||||||||||| |||||||| |||||||| ||||| || ||||| |||||
Sbjct: 935 gagttccccggtgactacggttgggacactgccggactctctgctgaccc 984



to top

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 216 gtggtacggcccggaccgcgtcaagtacctgggccccttctc 257
           |||||| ||||||||||| ||||| ||| |||||||||||||
Sbjct: 485 gtggtatggcccggaccgtgtcaaatacttgggccccttctc 526


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,569,393
Number of Sequences: 3902068
Number of extensions: 2569393
Number of successful extensions: 61023
Number of sequences better than 10.0: 419
Number of HSP's better than 10.0 without gapping: 429
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 58291
Number of HSP's gapped (non-prelim): 2710
length of query: 416
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 394
effective length of database: 17,147,199,772
effective search space: 6755996710168
effective search space used: 6755996710168
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top