Clone Name	baet06b12
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|Z34917.1|HVUNKNOWN Hordeum vulgare mRNA for bas1 protein	432	e-118
2	dbj|AB000405.1| Triticum aestivum mRNA for Thiol-specific antiox...	424	e-115
3	gb|AF076920.1|AF076920 Secale cereale thioredoxin peroxidase (TP...	410	e-111
4	gb|AY104683.1| Zea mays PCO147011 mRNA sequence	184	2e-43
5	emb|AM039889.1| Oryza sativa (japonica cultivar-group) mRNA for ...	168	9e-39
6	dbj|AK104703.1| Oryza sativa (japonica cultivar-group) cDNA clon...	168	9e-39
7	dbj|AK068919.1| Oryza sativa (japonica cultivar-group) cDNA clon...	168	9e-39
8	ref|NM_111995.2| Arabidopsis thaliana antioxidant AT3G11630 mRNA...	129	8e-27
9	emb|X94219.1|SOTDPRHOM S.oleracea mRNA for bas1 protein	129	8e-27
10	gb|AY079107.1| Arabidopsis thaliana AT3g11630/T19F11_3 mRNA, com...	129	8e-27
11	gb|AF419578.1|AF419578 Arabidopsis thaliana AT3g11630/T19F11_3 m...	129	8e-27
12	gb|AF324996.2|AF324996 Arabidopsis thaliana AT3g11630 (AT3g11630...	129	8e-27
13	emb|BX825367.1|CNS0A58M Arabidopsis thaliana Full-length cDNA Co...	129	8e-27
14	gb|AY086974.1| Arabidopsis thaliana clone 30062 mRNA, complete s...	129	8e-27
15	emb|Y10478.1|AT2CPBAS1 A.thaliana mRNA for 2-Cys peroxiredoxin	127	3e-26
16	emb|X94218.1|ATTDPRHOM A.thaliana mRNA for 2-Cys peroxiredoxin bas1	127	3e-26
17	emb|BX822171.1|CNS0A5WH Arabidopsis thaliana Full-length cDNA Co...	113	5e-22
18	gb|AF052202.1|AF052202 Brassica rapa subsp. pekinensis 2Cys-pero...	107	3e-20
19	ref|NM_120712.2| Arabidopsis thaliana antioxidant AT5G06290 mRNA...	100	7e-18
20	gb|AF339693.1| Arabidopsis thaliana putative 2-cys peroxiredoxin...	100	7e-18
21	gb|AF326871.1| Arabidopsis thaliana putative 2-cys peroxiredoxin...	100	7e-18
22	emb|AJ005006.1|RFAJ5506 Riccia fluitans mRNA for 2-Cys-peroxired...	100	7e-18
23	gb|AY081503.1| Arabidopsis thaliana 2-cys peroxiredoxin-like pro...	100	7e-18
24	gb|AY054621.1| Arabidopsis thaliana 2-cys peroxiredoxin-like pro...	100	7e-18
25	gb|AF324689.2|AF324689 Arabidopsis thaliana AT5g06290 (AT5g06290...	100	7e-18
26	emb|BX832003.1|CNS09ZNZ Arabidopsis thaliana Full-length cDNA Co...	100	7e-18
27	emb|BX830261.1|CNS09ZZT Arabidopsis thaliana Full-length cDNA Co...	100	7e-18
28	gb|AF311863.1|AF311863 Brassica napus 2-Cys peroxiredoxin mRNA, ...	100	7e-18
29	gb|AY085536.1| Arabidopsis thaliana clone 15640 mRNA, complete s...	100	7e-18
30	gb|AC009918.5|ATAC009918 Arabidopsis thaliana chromosome III BAC...	90	7e-15
31	emb|X97910.2|ATBAS1GEN Arabidopsis thaliana bas1 gene for 2-Cys ...	90	7e-15
32	emb|AJ315851.1|PSA315851 Pisum sativum mRNA for 2-Cys peroxiredoxin	90	7e-15
33	gb|AC008153.5|AC008153 Arabidopsis thaliana chromosome 3 BAC F24...	90	7e-15
34	emb|AJ309009.2|NTA309009 Nicotiana tabacum mRNA for thioredoxin ...	88	3e-14
35	ref|XM_472428.1| Oryza sativa (japonica cultivar-group), predic...	86	1e-13
36	emb|AL606598.3|OSJN00036 Oryza sativa genomic DNA, chromosome 4,...	86	1e-13
37	emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromosome 4,...	86	1e-13
38	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	86	1e-13
39	gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome	84	4e-13
40	emb|AJ293493.1|SHY293493 Saccharum hybrid cultivar R570 microsat...	84	4e-13
41	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	82	2e-12
42	dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic D...	82	2e-12
43	dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic D...	82	2e-12
44	dbj|AB006700.2| Arabidopsis thaliana genomic DNA, chromosome 5, ...	78	3e-11
45	emb|AJ288895.1|PVU288895 Phaseolus vulgaris mRNA for peroxiredox...	76	1e-10
46	gb|AY389677.1| Hyacinthus orientalis 2-cys peroxiredoxin-like pr...	74	4e-10
47	gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome	74	4e-10
48	gb|AY728092.1| Taenia solium 2-Cys peroxiredoxin mRNA, complete cds	72	2e-09
49	gb|CP000110.1| Synechococcus sp. CC9605, complete genome	62	2e-06
50	gb|DQ215102.1| Taeniopygia guttata clone 0058P0007G11 peroxiredo...	62	2e-06
51	gb|DQ215100.1| Taeniopygia guttata clone 0058P0021E05 peroxiredo...	62	2e-06
52	gb|DQ215089.1| Taeniopygia guttata clone 0058P0016B02 peroxiredo...	62	2e-06
53	gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complet...	62	2e-06
54	gb|AF321616.1| Drosophila melanogaster cytosolic thioredoxin per...	62	2e-06
55	gb|AF321615.1| Drosophila melanogaster cytosolic thioredoxin per...	62	2e-06
56	ref|NM_167359.1| Drosophila melanogaster thioredoxin peroxidase ...	62	2e-06
57	ref|NM_058162.2| Drosophila melanogaster thioredoxin peroxidase ...	62	2e-06
58	gb|AY070534.1| Drosophila melanogaster GM14788 full insert cDNA	62	2e-06
59	gb|AF167098.1|AF167098 Drosophila melanogaster thioredoxin perox...	62	2e-06
60	emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...	62	2e-06
61	gb|AE003492.3| Drosophila melanogaster chromosome X, section 44 ...	62	2e-06
62	gb|AE015451.1| Pseudomonas putida KT2440 complete genome	62	2e-06
63	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	62	2e-06
64	gb|BT014630.1| Drosophila melanogaster SD27832 full insert cDNA	62	2e-06
65	ref|XM_422437.1| PREDICTED: Gallus gallus similar to peroxiredox...	60	6e-06
66	emb|CR406137.1| Gallus gallus finished cDNA, clone ChEST858m1	60	6e-06
67	emb|CR353582.1| Gallus gallus finished cDNA, clone ChEST5e12	60	6e-06
68	gb|DQ217318.1| Taeniopygia guttata clone 0065P0012D05 mRNA sequence	58	2e-05
69	gb|DQ215101.1| Taeniopygia guttata clone 0058P0004G09 peroxiredo...	58	2e-05
70	gb|DQ215098.1| Taeniopygia guttata clone 0058P0060A12 peroxiredo...	58	2e-05
71	gb|DQ215097.1| Taeniopygia guttata clone 0058P0007D02 peroxiredo...	58	2e-05
72	gb|DQ215096.1| Taeniopygia guttata clone 0065P0024F03 peroxiredo...	58	2e-05
73	gb|DQ215095.1| Taeniopygia guttata clone 0058P0014B02 peroxiredo...	58	2e-05
74	gb|DQ215094.1| Taeniopygia guttata clone 0058P0004H09 peroxiredo...	58	2e-05
75	gb|DQ215093.1| Taeniopygia guttata clone 0058P0018E07 peroxiredo...	58	2e-05
76	gb|DQ215092.1| Taeniopygia guttata clone 0058P0057F09 peroxiredo...	58	2e-05
77	gb|DQ215091.1| Taeniopygia guttata clone 0061P0030A04 peroxiredo...	58	2e-05
78	gb|DQ215090.1| Taeniopygia guttata clone 0058P0047B05 peroxiredo...	58	2e-05
79	gb|DQ215087.1| Taeniopygia guttata clone 0058P0041C11 peroxiredo...	58	2e-05
80	gb|BC084157.1| Xenopus laevis cDNA clone IMAGE:6952555	58	2e-05
81	gb|AY731376.1| Ictalurus punctatus natural killer cell enhancing...	58	2e-05
82	gb|BC074236.1| Xenopus laevis MGC83969 protein, mRNA (cDNA clone...	58	2e-05
83	ref|XM_862333.1| PREDICTED: Canis familiaris similar to Peroxire...	58	2e-05
84	ref|XM_542042.2| PREDICTED: Canis familiaris similar to Peroxire...	58	2e-05
85	ref|NM_001030437.1| Xenopus tropicalis prdx3 protein (prdx3), mRNA	58	2e-05
86	gb|BC091062.1| Xenopus tropicalis prdx3 protein, mRNA (cDNA clon...	58	2e-05
87	gb|BC099274.1| Xenopus laevis cDNA clone MGC:116466 IMAGE:693302...	58	2e-05
88	gb|AF478688.1| Echinococcus granulosus thioredoxin peroxidase (T...	56	1e-04
89	ref|XM_797300.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
90	ref|XM_797710.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
91	ref|XM_799478.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
92	ref|XM_801125.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
93	ref|XM_803659.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
94	ref|XM_803661.1| Trypanosoma cruzi strain CL Brener tryparedoxin...	56	1e-04
95	emb|AJ012101.1|TCR012101 Trypanosoma cruzi gene encoding trypare...	56	1e-04
96	emb|AJ304857.1|CRE304857 Chlamydomonas reinhardtii partial mRNA ...	56	1e-04
97	emb|AJ304856.1|CRE304856 Chlamydomonas reinhardtii thioredoxin p...	56	1e-04
98	gb|DQ122920.1| Chlamydomonas incerta chloroplast thioredoxin per...	56	1e-04
99	gb|AF320771.1|AF320771 Trypanosoma cruzi Dm28c tryparedoxin pero...	56	1e-04
100	gb|AF250196.1|AF250196 Oncorhynchus mykiss clone Hot Creek natur...	56	1e-04
101	gb|AF250195.1|AF250195 Oncorhynchus mykiss clone Arlee natural k...	56	1e-04
102	gb|AF250194.1|AF250194 Oncorhynchus mykiss clone OSU natural kil...	56	1e-04
103	gb|AF250193.1|AF250193 Oncorhynchus mykiss clone OSU natural kil...	56	1e-04
104	gb|AF312025.1|AF312025 Chlamydomonas reinhardtii thioredoxin per...	56	1e-04
105	gb|AF106856.1|AF106856 Trypanosoma cruzi tryparedoxin peroxidase...	56	1e-04
106	gb|AF034959.1|AF034959 Echinococcus granulosus thioredoxin perox...	56	1e-04
107	gb|U27125.1|OMU27125 Oncorhynchus mykiss natural killer enhancem...	56	1e-04
108	gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome	54	4e-04
109	gb|DQ472128.1| Scophthalmus maximus natural killer enhancing fac...	54	4e-04
110	emb|CR718347.2|CNS0GH81 Tetraodon nigroviridis full-length cDNA	54	4e-04
111	emb|CR717209.2|CNS0GGCI Tetraodon nigroviridis full-length cDNA	54	4e-04
112	emb|CR717117.2|CNS0GG9Y Tetraodon nigroviridis full-length cDNA	54	4e-04
113	ref|XM_774575.1| Giardia lamblia ATCC 50803 hypothetical protein...	54	4e-04
114	ref|XM_774576.1| Giardia lamblia ATCC 50803 thioredoxin peroxida...	54	4e-04
115	emb|CR709661.2|CNS0GAIX Tetraodon nigroviridis full-length cDNA	54	4e-04
116	emb|CR707934.2|CNS0G96Y Tetraodon nigroviridis full-length cDNA	54	4e-04
117	emb|CR701828.2|CNS0G4HC Tetraodon nigroviridis full-length cDNA	54	4e-04
118	emb|CR662089.2|CNS0F9U7 Tetraodon nigroviridis full-length cDNA	54	4e-04
119	emb|CR650629.2|CNS0F0ZV Tetraodon nigroviridis full-length cDNA	54	4e-04
120	emb|CR647881.2|CNS0EYVJ Tetraodon nigroviridis full-length cDNA	54	4e-04
121	emb|CR637477.2|CNS0EQUJ Tetraodon nigroviridis full-length cDNA	54	4e-04
122	emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segmen...	54	4e-04
123	emb|AJ288896.1|PVU288896 Phaseolus vulgaris 2-Cys PRx gene for p...	54	4e-04
124	emb|CR937859.1| Single read from an extremity of a cDNA clone ma...	54	4e-04
125	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	54	4e-04
126	gb|AF321614.1| Drosophila melanogaster secretable thioredoxin pe...	54	4e-04
127	ref|NM_167971.1| Drosophila melanogaster thioredoxin peroxidase ...	54	4e-04
128	ref|NM_080263.2| Drosophila melanogaster thioredoxin peroxidase ...	54	4e-04
129	gb|AF323181.1|AF323181 Aedes aegypti 2-Cys thioredoxin peroxidas...	54	4e-04
130	gb|AY060785.1| Drosophila melanogaster GH25379 full length cDNA	54	4e-04
131	ref|XM_571871.1| Cryptococcus neoformans var. neoformans JEC21 c...	54	4e-04
132	gb|DQ003333.1| Tetraodon nigroviridis natural killer cell enhanc...	54	4e-04
133	gb|AE004773.1| Pseudomonas aeruginosa PAO1, section 334 of 529 o...	54	4e-04
134	gb|AF167099.1|AF167099 Drosophila melanogaster thioredoxin perox...	54	4e-04
135	gb|AF128226.1|AF128226 Giardia intestinalis thioredoxin peroxida...	54	4e-04
136	dbj|D37808.1|NEWABP25 Cynops pyrrhogaster ABP-25 mRNA for animal...	54	4e-04
137	gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome	54	4e-04
138	gb|AY231665.1| Drosophila yakuba clone yak-em_Jafrac1 mRNA sequence	52	0.002
139	emb|BX571661.1| Wolinella succinogenes, complete genome; segment...	52	0.002
140	emb|BX248358.1| Corynebacterium diphtheriae gravis NCTC13129, co...	52	0.002
141	gb|U37429.1| Caenorhabditis elegans cosmid F09E5, complete sequence	52	0.002
142	ref|NM_182252.2| Caenorhabditis elegans PeRoxireDoXin family mem...	52	0.002
143	gb|U18620.1|CDU18620 Corynebacterium diphtheriae iron-repressibl...	52	0.002
144	dbj|AB022045.1| Ascaris suum mRNA for thioredoxin peroxidase, co...	52	0.002
145	gb|AY787751.1| Phanerochaete chrysosporium peroxiredoxins (Prxs)...	50	0.006
146	gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence	50	0.006
147	gb|DQ118780.1| Haliotis discus hannai thioredoxin peroxidase mRN...	50	0.006
148	gb|DQ000546.1| Synthetic construct clone PSF:108501 thioredoxin ...	50	0.006
149	gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	50	0.006
150	emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II...	50	0.006
151	gb|CP000148.1| Geobacter metallireducens GS-15, complete genome	48	0.024
152	gb|AY617208.1| Sterkiella histriomuscorum clone UGC1O0001_E02_R ...	48	0.024
153	emb|CR728668.2|CNS0GP6Q Tetraodon nigroviridis full-length cDNA	48	0.024
154	emb|CR703948.1|CNS0G648 Tetraodon nigroviridis full-length cDNA	48	0.024
155	emb|CR687503.2|CNS0FTFF Tetraodon nigroviridis full-length cDNA	48	0.024
156	emb|CR687104.2|CNS0FT4C Tetraodon nigroviridis full-length cDNA	48	0.024
157	emb|CR684249.1|CNS0FQX1 Tetraodon nigroviridis full-length cDNA	48	0.024
158	emb|BX053384.1|CNS09DCS Single read from an extremity of a full-...	48	0.024
159	emb|BX053383.1|CNS09DCR Single read from an extremity of a full-...	48	0.024
160	emb|BX070810.1|CNS09QSU Single read from an extremity of a full-...	48	0.024
161	emb|BX069290.1|CNS09PMM Single read from an extremity of a full-...	48	0.024
162	emb|BX069289.1|CNS09PML Single read from an extremity of a full-...	48	0.024
163	emb|BX068000.1|CNS09OMS Single read from an extremity of a full-...	48	0.024
164	emb|BX067999.1|CNS09OMR Single read from an extremity of a full-...	48	0.024
165	emb|BX067924.1|CNS09OKO Single read from an extremity of a full-...	48	0.024
166	emb|BX067923.1|CNS09OKN Single read from an extremity of a full-...	48	0.024
167	emb|BX067642.1|CNS09OCU Single read from an extremity of a full-...	48	0.024
168	emb|BX067641.1|CNS09OCT Single read from an extremity of a full-...	48	0.024
169	emb|BX067553.1|CNS09OAD Single read from an extremity of a full-...	48	0.024
170	emb|BX067552.1|CNS09OAC Single read from an extremity of a full-...	48	0.024
171	emb|BX066871.1|CNS09NRF Single read from an extremity of a full-...	48	0.024
172	emb|BX066870.1|CNS09NRE Single read from an extremity of a full-...	48	0.024
173	emb|BX066087.1|CNS09N5N Single read from an extremity of a full-...	48	0.024
174	emb|BX066067.1|CNS09N53 Single read from an extremity of a full-...	48	0.024
175	emb|BX066066.1|CNS09N52 Single read from an extremity of a full-...	48	0.024
176	emb|BX064916.1|CNS09M94 Single read from an extremity of a full-...	48	0.024
177	emb|BX064915.1|CNS09M93 Single read from an extremity of a full-...	48	0.024
178	emb|BX064537.1|CNS09LYL Single read from an extremity of a full-...	48	0.024
179	emb|BX064536.1|CNS09LYK Single read from an extremity of a full-...	48	0.024
180	emb|BX064227.1|CNS09LPZ Single read from an extremity of a full-...	48	0.024
181	emb|BX064226.1|CNS09LPY Single read from an extremity of a full-...	48	0.024
182	emb|BX063235.1|CNS09KYF Single read from an extremity of a full-...	48	0.024
183	emb|BX062999.1|CNS09KRV Single read from an extremity of a full-...	48	0.024
184	emb|BX062083.1|CNS09K2F Single read from an extremity of a full-...	48	0.024
185	emb|BX062082.1|CNS09K2E Single read from an extremity of a full-...	48	0.024
186	emb|BX061501.1|CNS09JM9 Single read from an extremity of a full-...	48	0.024
187	emb|BX060363.1|CNS09IQN Single read from an extremity of a full-...	48	0.024
188	emb|BX059169.1|CNS09HTH Single read from an extremity of a full-...	48	0.024
189	emb|BX059168.1|CNS09HTG Single read from an extremity of a full-...	48	0.024
190	emb|BX057376.1|CNS09GFO Single read from an extremity of a full-...	48	0.024
191	emb|BX057375.1|CNS09GFN Single read from an extremity of a full-...	48	0.024
192	emb|BX056370.1|CNS09FNQ Single read from an extremity of a full-...	48	0.024
193	emb|BX056369.1|CNS09FNP Single read from an extremity of a full-...	48	0.024
194	emb|BX055201.1|CNS09ER9 Single read from an extremity of a full-...	48	0.024
195	emb|BX051412.1|CNS09BU0 Single read from an extremity of a full-...	48	0.024
196	emb|BX048982.1|CNS099YI Single read from an extremity of a full-...	48	0.024
197	emb|BX048359.1|CNS099H7 Single read from an extremity of a full-...	48	0.024
198	emb|BX044318.1|CNS096CY Single read from an extremity of a full-...	48	0.024
199	emb|BX044317.1|CNS096CX Single read from an extremity of a full-...	48	0.024
200	emb|BX042869.1|CNS0958P Single read from an extremity of a full-...	48	0.024
201	emb|BX042868.1|CNS0958O Single read from an extremity of a full-...	48	0.024
202	emb|BX041611.1|CNS0949R Single read from an extremity of a full-...	48	0.024
203	emb|BX041334.1|CNS09422 Single read from an extremity of a full-...	48	0.024
204	emb|BX041333.1|CNS09421 Single read from an extremity of a full-...	48	0.024
205	emb|BX041214.1|CNS093YQ Single read from an extremity of a full-...	48	0.024
206	emb|BX041213.1|CNS093YP Single read from an extremity of a full-...	48	0.024
207	emb|BX041187.1|CNS093XZ Single read from an extremity of a full-...	48	0.024
208	emb|BX041126.1|CNS093WA Single read from an extremity of a full-...	48	0.024
209	emb|BX039275.1|CNS092GV Single read from an extremity of a full-...	48	0.024
210	emb|BX039274.1|CNS092GU Single read from an extremity of a full-...	48	0.024
211	emb|BX037468.1|CNS0912O Single read from an extremity of a full-...	48	0.024
212	emb|BX037467.1|CNS0912N Single read from an extremity of a full-...	48	0.024
213	emb|BX036510.1|CNS090C2 Single read from an extremity of a full-...	48	0.024
214	emb|BX035990.1|CNS08ZXM Single read from an extremity of a full-...	48	0.024
215	emb|BX034262.1|CNS08YLM Single read from an extremity of a full-...	48	0.024
216	emb|BX032670.1|CNS08XDE Single read from an extremity of a full-...	48	0.024
217	emb|BX032237.1|CNS08X1D Single read from an extremity of a full-...	48	0.024
218	emb|BX031811.1|CNS08WPJ Single read from an extremity of a full-...	48	0.024
219	emb|BX031810.1|CNS08WPI Single read from an extremity of a full-...	48	0.024
220	emb|BX031700.1|CNS08WMG Single read from an extremity of a full-...	48	0.024
221	emb|BX031320.1|CNS08WBW Single read from an extremity of a full-...	48	0.024
222	emb|BX031319.1|CNS08WBV Single read from an extremity of a full-...	48	0.024
223	emb|BX031133.1|CNS08W6P Single read from an extremity of a full-...	48	0.024
224	emb|BX031132.1|CNS08W6O Single read from an extremity of a full-...	48	0.024
225	emb|BX029479.1|CNS08UWR Single read from an extremity of a full-...	48	0.024
226	emb|BX029478.1|CNS08UWQ Single read from an extremity of a full-...	48	0.024
227	emb|BX028834.1|CNS08UEU Single read from an extremity of a full-...	48	0.024
228	emb|BX028833.1|CNS08UET Single read from an extremity of a full-...	48	0.024
229	emb|BX027737.1|CNS08TKD Single read from an extremity of a full-...	48	0.024
230	emb|BX025425.1|CNS08RS5 Single read from an extremity of a full-...	48	0.024
231	emb|BX025424.1|CNS08RS4 Single read from an extremity of a full-...	48	0.024
232	emb|BX025170.1|CNS08RL2 Single read from an extremity of a full-...	48	0.024
233	emb|BX023596.1|CNS08QDC Single read from an extremity of a full-...	48	0.024
234	emb|BX023566.1|CNS08QCI Single read from an extremity of a full-...	48	0.024
235	emb|BX021889.1|CNS08P1X Single read from an extremity of a full-...	48	0.024
236	emb|BX021888.1|CNS08P1W Single read from an extremity of a full-...	48	0.024
237	emb|BX020060.1|CNS08NN4 Single read from an extremity of a full-...	48	0.024
238	emb|BX020059.1|CNS08NN3 Single read from an extremity of a full-...	48	0.024
239	emb|BX019879.1|CNS08NI3 Single read from an extremity of a full-...	48	0.024
240	emb|BX019878.1|CNS08NI2 Single read from an extremity of a full-...	48	0.024
241	emb|BX018246.1|CNS08M8Q Single read from an extremity of a full-...	48	0.024
242	emb|BX016634.1|CNS08KZY Single read from an extremity of a full-...	48	0.024
243	emb|BX015942.1|CNS08KGQ Single read from an extremity of a full-...	48	0.024
244	emb|BX014547.1|CNS08JDZ Single read from an extremity of a full-...	48	0.024
245	emb|BX013680.1|CNS08IPW Single read from an extremity of a full-...	48	0.024
246	emb|BX013679.1|CNS08IPV Single read from an extremity of a full-...	48	0.024
247	emb|BX012101.1|CNS08HI1 Single read from an extremity of a full-...	48	0.024
248	emb|BX012100.1|CNS08HI0 Single read from an extremity of a full-...	48	0.024
249	emb|BX012009.1|CNS08HFH Single read from an extremity of a full-...	48	0.024
250	emb|BX011355.1|CNS08GXB Single read from an extremity of a full-...	48	0.024
251	emb|BX011354.1|CNS08GXA Single read from an extremity of a full-...	48	0.024
252	emb|BX009674.1|CNS08FMM Single read from an extremity of a full-...	48	0.024
253	emb|BX009416.1|CNS08FFG Single read from an extremity of a full-...	48	0.024
254	emb|BX005616.1|CNS08CHW Single read from an extremity of a full-...	48	0.024
255	emb|BX005615.1|CNS08CHV Single read from an extremity of a full-...	48	0.024
256	gb|AY035384.1| Leishmania infantum thiol-specific antioxidant pr...	48	0.024
257	ref|XM_693960.1| PREDICTED: Danio rerio similar to Peroxiredoxin...	48	0.024
258	gb|AF312398.1|AF312398 Leishmania chagasi peroxidoxin 3 (Pxn3) g...	48	0.024
259	gb|AF312397.1|AF312397 Leishmania chagasi peroxidoxin 2 (Pxn2) g...	48	0.024
260	gb|DQ065966.1| Ixodes scapularis isolate IS-6-12-J-IS612-476 thi...	48	0.024
261	gb|AY058210.1| Leishmania infantum cytosolic peroxiredoxin gene,...	48	0.024
262	gb|AF225212.1|AF225212 Leishmania donovani tryparedoxin peroxida...	48	0.024
263	ref|XM_308081.2| Anopheles gambiae str. PEST ENSANGP00000019782 ...	48	0.024
264	gb|AY753537.1| Leishmania guyanensis tryparedoxin peroxidase 2 g...	48	0.024
265	dbj|AB071135.1| Echinococcus multilocularis EmTRX mRNA for thior...	48	0.024
266	gb|AF055914.1|AF055914 Crithidia fasciculata tryparedoxin peroxi...	48	0.024
267	gb|AF020947.1|AF020947 Crithidia fasciculata tryparedoxin peroxi...	48	0.024
268	gb|AY603336.1| Haemonchus contortus peroxiredoxin mRNA, complete...	46	0.093
269	gb|BC059122.1| Rattus norvegicus peroxiredoxin 4, mRNA (cDNA clo...	46	0.093
270	gb|AC091701.3| Trypanosoma brucei chromosome 8 clone RPCI93-26N1...	46	0.093
271	gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence	46	0.093
272	ref|XM_426543.1| PREDICTED: Gallus gallus similar to Thioredoxin...	46	0.093
273	gb|BC019578.1| Mus musculus peroxiredoxin 4, mRNA (cDNA clone MG...	46	0.093
274	ref|NM_016764.1| Mus musculus peroxiredoxin 4 (Prdx4), mRNA	46	0.093
275	ref|XM_820485.1| Trypanosoma brucei TREU927 clone RPCI93-26N11 t...	46	0.093
276	ref|XM_448495.1| Candida glabrata CBS138, CAGL0K06259g partial mRNA	46	0.093
277	emb|CR728146.2|CNS0GOS8 Tetraodon nigroviridis full-length cDNA	46	0.093
278	ref|XM_762647.1| Giardia lamblia ATCC 50803 thioredoxin peroxida...	46	0.093
279	gb|AE004159.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	46	0.093
280	gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq...	46	0.093
281	emb|BX067098.1|CNS09NXQ Single read from an extremity of a full-...	46	0.093
282	emb|BX062726.1|CNS09KKA Single read from an extremity of a full-...	46	0.093
283	emb|BX056328.1|CNS09FMK Single read from an extremity of a full-...	46	0.093
284	emb|BX056327.1|CNS09FMJ Single read from an extremity of a full-...	46	0.093
285	emb|BX014548.1|CNS08JE0 Single read from an extremity of a full-...	46	0.093
286	emb|CR380957.1| Candida glabrata strain CBS138 chromosome K comp...	46	0.093
287	dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl...	46	0.093
288	dbj|AK146402.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	46	0.093
289	dbj|AK152255.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	46	0.093
290	gb|AF196570.1|AF196570 Trypanosoma brucei 427 tryparedoxin perox...	46	0.093
291	dbj|AK015920.1| Mus musculus adult male testis cDNA, RIKEN full-...	46	0.093
292	dbj|AK005031.1| Mus musculus adult male liver cDNA, RIKEN full-l...	46	0.093
293	gb|DQ009987.1| Paralichthys olivaceus natural killer enhancing f...	46	0.093
294	ref|NM_053512.1| Rattus norvegicus peroxiredoxin 4 (Prdx4), mRNA	46	0.093
295	gb|AF106945.1|AF106945 Rattus norvegicus PRx IV (PRx IV) mRNA, c...	46	0.093
296	gb|BC003349.1| Mus musculus peroxiredoxin 4, mRNA (cDNA clone MG...	46	0.093
297	gb|AF069386.1|AF069386 Leishmania major peroxidoxin mRNA, comple...	46	0.093
298	gb|U96746.1|MMU96746 Mus musculus antioxidant enzyme AOE372 mRNA...	46	0.093
299	dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...	46	0.093
300	gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence	44	0.37
301	ref|XM_513123.1| PREDICTED: Pan troglodytes similar to prolifera...	44	0.37
302	gb|BT019740.1| Homo sapiens peroxiredoxin 1 mRNA, complete cds	44	0.37
303	gb|AY617470.1| Sterkiella histriomuscorum clone UGC1O0002_K12_R ...	44	0.37
304	ref|XM_416599.1| PREDICTED: Gallus gallus similar to hypothetica...	44	0.37
305	gb|BC007063.1| Homo sapiens peroxiredoxin 1, transcript variant ...	44	0.37
306	gb|BC021683.1| Homo sapiens peroxiredoxin 1, transcript variant ...	44	0.37
307	ref|XM_800021.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.37
308	ref|XM_808751.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.37
309	emb|AL451136.11| Human DNA sequence from clone RP11-291L19 on ch...	44	0.37
310	ref|NM_181696.1| Homo sapiens peroxiredoxin 1 (PRDX1), transcrip...	44	0.37
311	ref|NM_181697.1| Homo sapiens peroxiredoxin 1 (PRDX1), transcrip...	44	0.37
312	ref|NM_002574.2| Homo sapiens peroxiredoxin 1 (PRDX1), transcrip...	44	0.37
313	emb|AL133280.12| Human DNA sequence from clone RP3-514P16 on chr...	44	0.37
314	emb|X67951.1|HSPAG H.sapiens mRNA for proliferation-associated g...	44	0.37
315	emb|CR407652.1| Homo sapiens full open reading frame cDNA clone ...	44	0.37
316	emb|CR933662.1| Homo sapiens mRNA; cDNA DKFZp781M0415 (from clon...	44	0.37
317	emb|CR620467.1| full-length cDNA clone CS0DH005YP04 of T cells (...	44	0.37
318	emb|CR612185.1| full-length cDNA clone CS0DC013YL24 of Neuroblas...	44	0.37
319	emb|CR595111.1| full-length cDNA clone CS0DG003YF19 of B cells (...	44	0.37
320	emb|CR593924.1| full-length cDNA clone CS0DC014YE06 of Neuroblas...	44	0.37
321	emb|CR592546.1| full-length cDNA clone CS0DM012YB22 of Fetal liv...	44	0.37
322	gb|M74232.1|MSGAVI3X Mycobacterium avium antigen (Avi-3) gene, c...	44	0.37
323	emb|CR390778.1| Gallus gallus finished cDNA, clone ChEST604d10	44	0.37
324	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	44	0.37
325	gb|AF334163.1|AF334163 Mycobacterium avium subsp. paratuberculos...	44	0.37
326	ref|NM_001011135.1| Xenopus tropicalis hypothetical LOC496551 (L...	44	0.37
327	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	44	0.37
328	gb|AY892934.1| Synthetic construct Homo sapiens clone FLH141378....	44	0.37
329	gb|AY888454.1| Synthetic construct Homo sapiens clone FLH007269....	44	0.37
330	dbj|AK131049.1| Homo sapiens cDNA FLJ29015 fis, clone MPE08581, ...	44	0.37
331	gb|AE014299.1| Shewanella oneidensis MR-1, complete genome	44	0.37
332	emb|CR848139.2| Xenopus tropicalis finished cDNA, clone TGas084c12	44	0.37
333	gb|BC084184.1| Xenopus tropicalis hypothetical LOC496551, mRNA (...	44	0.37
334	gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com...	44	0.37
335	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	44	0.37
336	gb|DQ297142.1| Homo sapiens peroxiredoxin 1 (PRDX1) gene, comple...	44	0.37
337	gb|U18263.1|MAU18263 Mycobacterium avium alkyl hydroperoxidase C...	44	0.37
338	gb|L19184.1|HUMNKEFA Human natural killer cell enhancing factor ...	44	0.37
339	gb|AC145545.2| Homo sapiens chromosome UNKNOWN clone RP11-1365M9...	42	1.5
340	ref|XM_524127.1| PREDICTED: Pan troglodytes similar to Peroxired...	42	1.5
341	gb|DQ231563.1| Homo sapiens peroxiredoxin 2 (PRDX2) gene, comple...	42	1.5
342	ref|XM_470790.1| Oryza sativa (japonica cultivar-group), mRNA	42	1.5
343	ref|XM_361286.1| Magnaporthe grisea 70-15 predicted protein (MG0...	42	1.5
344	gb|BC064138.1| Homo sapiens peroxiredoxin 2, transcript variant ...	42	1.5
345	gb|BC000452.2| Homo sapiens peroxiredoxin 2, transcript variant ...	42	1.5
346	gb|BC007220.1| Homo sapiens hypothetical protein FLJ12118, mRNA ...	42	1.5
347	gb|BC003022.1| Homo sapiens peroxiredoxin 2, transcript variant ...	42	1.5
348	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	42	1.5
349	ref|XM_383356.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	42	1.5
350	gb|AC129778.5| Homo sapiens BAC clone RP11-1221G12 from UL, comp...	42	1.5
351	emb|AL031628.2|CEY102A5D Caenorhabditis elegans YAC Y102A5D, com...	42	1.5
352	gb|AC092075.7| Oryza sativa chromosome 3 BAC OSJNBa0017N12 genom...	42	1.5
353	ref|XM_849398.1| PREDICTED: Canis familiaris similar to hyaluron...	42	1.5
354	emb|BX284632.11| Human DNA sequence from clone RP11-460E7 on chr...	42	1.5
355	emb|AL845321.4| Human DNA sequence from clone RP11-236F9 on chro...	42	1.5
356	emb|AL591379.18| Human DNA sequence from clone RP11-381O7 on chr...	42	1.5
357	emb|AL512605.13| Human DNA sequence from clone RP11-15J10 on chr...	42	1.5
358	emb|AL445665.20| Human DNA sequence from clone RP11-574E24 on ch...	42	1.5
359	emb|AL359955.25| Human DNA sequence from clone RP11-460N11 on ch...	42	1.5
360	emb|AL356750.16| Human DNA sequence from clone RP11-374F3 on chr...	42	1.5
361	emb|AL157820.27| Human DNA sequence from clone RP11-8D7 on chrom...	42	1.5
362	gb|AF492495.1| Synechococcus sp. PCC 7942 thioredoxin-peroxidase...	42	1.5
363	emb|CR858417.1| Pongo pygmaeus mRNA; cDNA DKFZp468O2412 (from cl...	42	1.5
364	emb|CR450356.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
365	gb|BC039428.1| Homo sapiens peroxiredoxin 2, transcript variant ...	42	1.5
366	emb|CR860893.1| Pongo pygmaeus mRNA; cDNA DKFZp469H1520 (from cl...	42	1.5
367	emb|CR615939.1| full-length cDNA clone CS0DI001YB18 of Placenta ...	42	1.5
368	gb|AC020934.9| Homo sapiens chromosome 19 clone CTD-2265O21, com...	42	1.5
369	emb|CR626682.1| full-length cDNA clone CS0DB004YG07 of Neuroblas...	42	1.5
370	emb|CR625757.1| full-length cDNA clone CS0DB005YC16 of Neuroblas...	42	1.5
371	gb|AE006027.1| Caulobacter crescentus CB15 section 353 of 359 of...	42	1.5
372	emb|CR624097.1| full-length cDNA clone CS0DB004YL20 of Neuroblas...	42	1.5
373	emb|CR623841.1| full-length cDNA clone CS0DC021YJ14 of Neuroblas...	42	1.5
374	emb|CR622535.1| full-length cDNA clone CS0DA007YL04 of Neuroblas...	42	1.5
375	emb|CR622487.1| full-length cDNA clone CS0DC021YP16 of Neuroblas...	42	1.5
376	emb|CR620967.1| full-length cDNA clone CS0DM013YJ04 of Fetal liv...	42	1.5
377	emb|CR616344.1| full-length cDNA clone CS0DA003YB10 of Neuroblas...	42	1.5
378	emb|CR615046.1| full-length cDNA clone CS0DC007YC06 of Neuroblas...	42	1.5
379	emb|CR614128.1| full-length cDNA clone CS0DL006YL23 of B cells (...	42	1.5
380	emb|CR613047.1| full-length cDNA clone CS0DL012YC14 of B cells (...	42	1.5
381	emb|CR606963.1| full-length cDNA clone CS0DB009YF06 of Neuroblas...	42	1.5
382	emb|CR606350.1| full-length cDNA clone CS0DD005YM15 of Neuroblas...	42	1.5
383	emb|CR605244.1| full-length cDNA clone CS0DI042YI08 of Placenta ...	42	1.5
384	emb|CR602550.1| full-length cDNA clone CS0DA001YG13 of Neuroblas...	42	1.5
385	emb|CR602223.1| full-length cDNA clone CS0DC025YB04 of Neuroblas...	42	1.5
386	emb|CR601986.1| full-length cDNA clone CS0DC016YL03 of Neuroblas...	42	1.5
387	emb|CR600317.1| full-length cDNA clone CS0DI008YM19 of Placenta ...	42	1.5
388	emb|CR600194.1| full-length cDNA clone CS0DB009YN14 of Neuroblas...	42	1.5
389	emb|CR599094.1| full-length cDNA clone CS0DB009YE01 of Neuroblas...	42	1.5
390	emb|CR598714.1| full-length cDNA clone CS0DC003YG04 of Neuroblas...	42	1.5
391	emb|CR594988.1| full-length cDNA clone CS0DN001YE19 of Adult bra...	42	1.5
392	emb|CR593997.1| full-length cDNA clone CS0DJ009YB18 of T cells (...	42	1.5
393	dbj|AK022395.1| Homo sapiens cDNA FLJ12333 fis, clone MAMMA10021...	42	1.5
394	dbj|AK022180.1| Homo sapiens cDNA FLJ12118 fis, clone MAMMA10000...	42	1.5
395	dbj|AB220444.1| Macaca fascicularis mRNA, clone QccE-19689: simi...	42	1.5
396	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	42	1.5
397	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	42	1.5
398	gb|AF434665.1|AF434665 Petromyzon marinus Hox1w (hox1w) mRNA, pa...	42	1.5
399	emb|CR541789.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
400	gb|AC018761.6| Homo sapiens chromosome 19 clone CTD-2659N19, com...	42	1.5
401	ref|NM_065491.2| Caenorhabditis elegans PeRoxireDoXin family mem...	42	1.5
402	ref|NG_002915.1| Homo sapiens peroxiredoxin 2 pseudogene 1 (PRDX...	42	1.5
403	tpg|BK004874.1| TPA: TPA_exp: Caulobacter crescentus CB15 cresce...	42	1.5
404	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
405	gb|BT006003.1| Drosophila melanogaster SD08737 full insert cDNA	42	1.5
406	gb|AE009694.1| Brucella melitensis 16M chromosome II, section 56...	42	1.5
407	ref|NM_024537.1| Homo sapiens hypothetical protein FLJ12118 (FLJ...	42	1.5
408	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	42	1.5
409	gb|AY890375.1| Synthetic construct Homo sapiens clone FLH018658....	42	1.5
410	ref|XM_310050.2| Anopheles gambiae str. PEST ENSANGP00000014554 ...	42	1.5
411	gb|AY894116.1| Synthetic construct Homo sapiens clone FLH130941....	42	1.5
412	gb|AY893882.1| Synthetic construct Homo sapiens clone FLH127890....	42	1.5
413	gb|AY893434.1| Synthetic construct Homo sapiens clone FLH127810....	42	1.5
414	gb|AY892847.1| Synthetic construct Homo sapiens clone FLH018654....	42	1.5
415	ref|NM_181738.1| Homo sapiens peroxiredoxin 2 (PRDX2), nuclear g...	42	1.5
416	ref|NM_005809.4| Homo sapiens peroxiredoxin 2 (PRDX2), nuclear g...	42	1.5
417	gb|AY610343.1| Sus scrofa clone rebs27c_c15.y1.abd, mRNA sequence	42	1.5
418	emb|Z22548.1|HSTHSPAIA H.sapiens thiol-specific antioxidant prot...	42	1.5
419	emb|Z32683.1|CER07E5 Caenorhabditis elegans Cosmid R07E5, comple...	42	1.5
420	gb|AC002402.1|AC002402 Human Chromosome 11 pac pDJ205d23, comple...	42	1.5
421	gb|L19185.1|HUMNKEFB Human natural killer cell enhancing factor ...	42	1.5
422	emb|X82321.1|HSTSA0X H.sapiens mRNA for thiol-specific antioxidant	42	1.5
423	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	42	1.5
424	dbj|AB062436.1| Homo sapiens mRNA for OK/SW-CL.10, complete cds	42	1.5
425	gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence	40	5.8
426	ref|XM_471017.1| Oryza sativa (japonica cultivar-group), predic...	40	5.8
427	gb|DQ217292.1| Taeniopygia guttata clone 0065P0012A11 mRNA sequence	40	5.8
428	ref|XM_518150.1| PREDICTED: Pan troglodytes LOC462328 (LOC462328...	40	5.8
429	gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence	40	5.8
430	ref|XM_472039.1| Oryza sativa (japonica cultivar-group), predic...	40	5.8
431	gb|BC082483.1| Xenopus laevis MGC80194 protein, mRNA (cDNA clone...	40	5.8
432	gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl...	40	5.8
433	gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	40	5.8
434	gb|AC128644.4| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
435	gb|BC072833.1| Xenopus laevis MGC80194 protein, mRNA (cDNA clone...	40	5.8
436	gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome	40	5.8
437	gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome	40	5.8
438	gb|CP000358.1| Deinococcus geothermalis DSM 11300 plasmid 1, com...	40	5.8
439	gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
440	gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
441	gb|AY302493.1| Cryptococcus neoformans var. grubii thiol-specifi...	40	5.8
442	gb|AY288506.1| Spironucleus barkhanus thioredoxin peroxidase mRN...	40	5.8
443	emb|CR931997.1| Corynebacterium jeikeium K411 complete genome	40	5.8
444	gb|AC136604.2| Homo sapiens chromosome 5 clone RP11-1379J22, com...	40	5.8
445	gb|AF424662.1| Phytophthora infestans clone MY-10-H-01 thioredox...	40	5.8
446	emb|BX066088.1|CNS09N5O Single read from an extremity of a full-...	40	5.8
447	emb|BX031701.1|CNS08WMH Single read from an extremity of a full-...	40	5.8
448	gb|CP000089.1| Dechloromonas aromatica RCB, complete genome	40	5.8
449	emb|CR555308.1| Azoarcus sp. EbN1 plasmid 2	40	5.8
450	gb|AC125795.2| Homo sapiens chromosome 5 clone RP11-1285A22, com...	40	5.8
451	emb|AL939115.1|SCO939115 Streptomyces coelicolor A3(2) complete ...	40	5.8
452	gb|AF533768.1| Cercopithecine herpesvirus 1 strain E2490, comple...	40	5.8
453	gb|AF532110.1| Cricetulus griseus peroxiredoxin 2 (Prdx2) mRNA, ...	40	5.8
454	gb|AC116603.1| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
455	gb|DQ397608.1| Cenarchaeum symbiosum clone C12B02, complete sequ...	40	5.8
456	gb|DQ397607.1| Cenarchaeum symbiosum clone C12A09, complete sequ...	40	5.8
457	gb|AE005956.1| Caulobacter crescentus CB15 section 282 of 359 of...	40	5.8
458	tpg|BK000869.1| TPA: TPA_inf: Oryza sativa transposon Rim2-M266,...	40	5.8
459	gb|U65510.1|RRU65510 Rhodospirillum rubrum alkyl hydroperoxide r...	40	5.8
460	gb|AC107315.1| Genomic sequence for Oryza sativa, Nipponbare str...	40	5.8
461	gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple...	40	5.8
462	gb|AC157954.2| Pan troglodytes BAC clone CH251-514O14 from chrom...	40	5.8
463	gb|DQ066149.1| Ixodes scapularis isolate ISNU-L-ISN-123 mitochon...	40	5.8
464	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
465	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
466	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
467	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
468	gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome	40	5.8
469	dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo...	40	5.8
470	gb|AC137807.2| Homo sapiens chromosome 5 clone RP11-909A9, compl...	40	5.8
471	gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str...	40	5.8
472	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	40	5.8
473	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	5.8
474	dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome	40	5.8
475	dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D...	40	5.8
476	gb|AY921646.1| Leishmania guyanensis tryparedoxin peroxidase 1 m...	40	5.8
477	dbj|AK073646.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.8
478	emb|BX276097.12| Zebrafish DNA sequence from clone DKEY-97C6 in ...	40	5.8
479	dbj|AK059961.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	5.8
480	emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chr...	40	5.8
481	emb|AJ890364.1| Emiliania huxleyi virus 86 isolate EhV86	40	5.8
482	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
483	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	5.8
484	emb|AL021707.2|HS508I15 Human DNA sequence from clone RP3-508I15...	40	5.8
485	emb|AL606990.3|OSJN00122 Oryza sativa genomic DNA, chromosome 4,...	40	5.8
486	emb|AL606616.3|OSJN00070 Oryza sativa genomic DNA, chromosome 4,...	40	5.8
487	gb|AE017221.1| Thermus thermophilus HB27, complete genome	40	5.8
488	dbj|AP000553.1| Homo sapiens genomic DNA, chromosome 22q11.2, BC...	40	5.8

---

>emb|Z34917.1|HVUNKNOWN Hordeum vulgare mRNA for bas1 protein
          Length = 860

 Score =  432 bits (218), Expect = e-118
 Identities = 224/226 (99%)
 Strand = Plus / Plus

                                                                       
Query: 200 gccagggcccgtagcttcgtcgcccgcgccgcagccgagtacgacctgccgctggtgggg 259
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   gccagggcccgtagcttcgtcgcccgcgccgcagccgagtacgacctgccgctggtgggg 63

                                                                       
Query: 260 aacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatcaacgtcaag 319
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 64  aacaaagcgccggacttcgcggcggaggccgtgttcgaccaggagttcatcaacgtcaag 123

                                                                       
Query: 320 ctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttcacc 379
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttcacc 183

                                                         
Query: 380 ttcgtctgcccaactgagattacggctttcagcgatagacatgagg 425
           ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 184 ttcgtctgcccaactgagattacggctttcagcgacagacatgagg 229

---

>dbj|AB000405.1| Triticum aestivum mRNA for Thiol-specific antioxidant protein,
           partial cds
          Length = 652

 Score =  424 bits (214), Expect = e-115
 Identities = 223/226 (98%)
 Strand = Plus / Plus

                                                                       
Query: 200 gccagggcccgtagcttcgtcgcccgcgccgcagccgagtacgacctgccgctggtgggg 259
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   gccagggcccgtagcttcgtcgcccgcgccgcagccgagtacgacctgccgctggtgggg 63

                                                                       
Query: 260 aacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatcaacgtcaag 319
           ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 64  aacaaggcgccggacttcgcggcggaggccgtgttcgaccaggagttcatcaacgtcaag 123

                                                                       
Query: 320 ctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttcacc 379
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttcacc 183

                                                         
Query: 380 ttcgtctgcccaactgagattacggctttcagcgatagacatgagg 425
           ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 184 ttcgtctgcccaactgagattacggctttcagcgacagacatgagg 229

---

>gb|AF076920.1|AF076920 Secale cereale thioredoxin peroxidase (TPx1) mRNA, complete cds
          Length = 1067

 Score =  410 bits (207), Expect = e-111
 Identities = 232/239 (97%), Gaps = 1/239 (0%)
 Strand = Plus / Plus

                                                                       
Query: 187 cggctcgaggacggccagggcccgtagcttcgtcgcccgcgccgcagccgagtacgacct 246
           ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 211 cggctcgaggacg-ccagggcccgcagcttcgtcgcccgcgccgcagccgagtacgacct 269

                                                                       
Query: 247 gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
           ||| ||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||
Sbjct: 270 gccactggtggggaacaaagcaccggacttcgctgcggaggccgtgttcgaccaggagtt 329

                                                                       
Query: 307 catcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccc 366
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 catcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccc 389

                                                                      
Query: 367 tctggacttcaccttcgtctgcccaactgagattacggctttcagcgatagacatgagg 425
           |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 390 tctggacttcaccttcgtctgcccaactgagattacggctttcagcgacagacatgagg 448



 Score =  210 bits (106), Expect = 3e-51
 Identities = 125/130 (96%), Gaps = 1/130 (0%)
 Strand = Plus / Plus

                                                                       
Query: 17  ggcactccccgcctgacaaccacggccatggcgtgcgccatctccgcctccaccgtgtcc 76
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 52  ggcactccccgcctgacaaccacggccatggcgtgcgccttctccgcctccaccgtgtcc 111

                                                                       
Query: 77  acggccgccgcgctcgtcgcgtccccgaagacatccggggcgccgcagtgcctgtcgttt 136
           ||||| |||||||||||||||||||||||| || ||||||||||| ||||||||||||||
Sbjct: 112 acggcggccgcgctcgtcgcgtccccgaagccagccggggcgccg-agtgcctgtcgttt 170

                     
Query: 137 ccccgcgctt 146
           ||||||||||
Sbjct: 171 ccccgcgctt 180

---

>gb|AY104683.1| Zea mays PCO147011 mRNA sequence
          Length = 1332

 Score =  184 bits (93), Expect = 2e-43
 Identities = 141/157 (89%)
 Strand = Plus / Plus

                                                                       
Query: 246 tgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagt 305
           |||||||||| |||||||| ||||| |||||||  || ||||||||||||||||||||||
Sbjct: 282 tgccgctggtcgggaacaaggcgccagacttcgaagccgaggctgtgttcgaccaggagt 341

                                                                       
Query: 306 tcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctacc 365
           |||||||||| ||||| ||||||||||||||||||||||| || ||||| ||||||||||
Sbjct: 342 tcatcaacgtgaagctctctgattacattgggaagaagtacgtcattctgttcttctacc 401

                                                
Query: 366 ctctggacttcaccttcgtctgcccaactgagattac 402
           |  |||| ||||||||||||||||| || ||||||||
Sbjct: 402 ccttggatttcaccttcgtctgcccgaccgagattac 438

---

>emb|AM039889.1| Oryza sativa (japonica cultivar-group) mRNA for 2-Cys peroxiredoxin
           (bas1 gene)
          Length = 786

 Score =  168 bits (85), Expect = 9e-39
 Identities = 145/165 (87%)
 Strand = Plus / Plus

                                                                       
Query: 247 gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
           ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 201 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 260

                                                                       
Query: 307 catcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccc 366
           ||||||||| ||||| || || ||||| ||||||||||| || ||||| |||||||||||
Sbjct: 261 catcaacgtgaagctgtccgactacatcgggaagaagtacgtcattctcttcttctaccc 320

                                                        
Query: 367 tctggacttcaccttcgtctgcccaactgagattacggctttcag 411
             |||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 321 gttggacttcaccttcgtctgcccgaccgagattaccgctttcag 365

---

>dbj|AK104703.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-D02, full
           insert sequence
          Length = 1061

 Score =  168 bits (85), Expect = 9e-39
 Identities = 145/165 (87%)
 Strand = Plus / Plus

                                                                       
Query: 247 gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
           ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 272 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 331

                                                                       
Query: 307 catcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccc 366
           ||||||||| ||||| || || ||||| ||||||||||| || ||||| |||||||||||
Sbjct: 332 catcaacgtgaagctgtccgactacatcgggaagaagtacgtcattctcttcttctaccc 391

                                                        
Query: 367 tctggacttcaccttcgtctgcccaactgagattacggctttcag 411
             |||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 392 gttggacttcaccttcgtctgcccgaccgagattaccgctttcag 436

---

>dbj|AK068919.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170F14, full
           insert sequence
          Length = 1079

 Score =  168 bits (85), Expect = 9e-39
 Identities = 145/165 (87%)
 Strand = Plus / Plus

                                                                       
Query: 247 gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
           ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 273 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 332

                                                                       
Query: 307 catcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccc 366
           ||||||||| ||||| || || ||||| ||||||||||| || ||||| |||||||||||
Sbjct: 333 catcaacgtgaagctgtccgactacatcgggaagaagtacgtcattctcttcttctaccc 392

                                                        
Query: 367 tctggacttcaccttcgtctgcccaactgagattacggctttcag 411
             |||||||||||||||||||||| || |||||||| ||||||||
Sbjct: 393 gttggacttcaccttcgtctgcccgaccgagattaccgctttcag 437

---

>ref|NM_111995.2| Arabidopsis thaliana antioxidant AT3G11630 mRNA, complete cds
          Length = 1008

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 289 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 348

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 349 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 408

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 409 gactttactttcgtctgcccaacagagattactgccttcag 449

---

>emb|X94219.1|SOTDPRHOM S.oleracea mRNA for bas1 protein
          Length = 867

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 233 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 292

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 293 aaggttaagctctctgattacattggaaagaagtatgtgattctgtttttctacccattg 352

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 353 gactttactttcgtctgcccaacagagattactgccttcag 393

---

>gb|AY079107.1| Arabidopsis thaliana AT3g11630/T19F11_3 mRNA, complete cds
          Length = 801

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 220 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 279

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 280 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 339

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 340 gactttactttcgtctgcccaacagagattactgccttcag 380

---

>gb|AF419578.1|AF419578 Arabidopsis thaliana AT3g11630/T19F11_3 mRNA, complete cds
          Length = 957

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 244 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 303

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 304 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 363

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 364 gactttactttcgtctgcccaacagagattactgccttcag 404

---

>gb|AF324996.2|AF324996 Arabidopsis thaliana AT3g11630 (AT3g11630/T19F11_3) mRNA, complete
           cds
          Length = 1004

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 287 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 346

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 347 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 406

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 407 gactttactttcgtctgcccaacagagattactgccttcag 447

---

>emb|BX825367.1|CNS0A58M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL32ZE08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 867

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 150 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 209

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 210 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 269

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 270 gactttactttcgtctgcccaacagagattactgccttcag 310

---

>gb|AY086974.1| Arabidopsis thaliana clone 30062 mRNA, complete sequence
          Length = 1002

 Score =  129 bits (65), Expect = 8e-27
 Identities = 137/161 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 ctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatc 310
           ||||| || ||||| ||||| || || | ||| ||||||||||| || || |||||||||
Sbjct: 289 ctggttggaaacaaggcgcctgattttgaggcagaggctgtgtttgatcaagagttcatc 348

                                                                       
Query: 311 aacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctg 370
           || || ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||
Sbjct: 349 aaggttaagctctctgattacattggaaagaagtatgtgattctctttttctacccattg 408

                                                    
Query: 371 gacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||||||||| |||||||| || |||||
Sbjct: 409 gactttactttcgtctgcccaacagagattactgccttcag 449

---

>emb|Y10478.1|AT2CPBAS1 A.thaliana mRNA for 2-Cys peroxiredoxin
          Length = 981

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                       
Query: 284 gaggctgtgttcgaccaggagttcatcaacgtcaagctatctgattacattgggaagaag 343
           ||||||||||| || || ||||||||||| || ||||| |||||||||| ||||||||||
Sbjct: 259 gaggctgtgtttgatcaagagttcatcaaggttaagctctctgattacaatgggaagaag 318

                                                                       
Query: 344 tatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacg 403
           ||||||||||| || ||||||||  ||||||| || |||||||||||||| |||||||| 
Sbjct: 319 tatgtgattctctttttctacccattggactttactttcgtctgcccaacagagattact 378

                   
Query: 404 gctttcag 411
           || |||||
Sbjct: 379 gccttcag 386

---

>emb|X94218.1|ATTDPRHOM A.thaliana mRNA for 2-Cys peroxiredoxin bas1
          Length = 843

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                       
Query: 284 gaggctgtgttcgaccaggagttcatcaacgtcaagctatctgattacattgggaagaag 343
           ||||||||||| || || ||||||||||| || ||||| |||||||||| ||||||||||
Sbjct: 272 gaggctgtgtttgatcaagagttcatcaaggttaagctctctgattacaatgggaagaag 331

                                                                       
Query: 344 tatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacg 403
           ||||||||||| || ||||||||  ||||||| || |||||||||||||| |||||||| 
Sbjct: 332 tatgtgattctctttttctacccattggactttactttcgtctgcccaacagagattact 391

                   
Query: 404 gctttcag 411
           || |||||
Sbjct: 392 gccttcag 399

---

>emb|BX822171.1|CNS0A5WH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 970

 Score =  113 bits (57), Expect = 5e-22
 Identities = 108/125 (86%)
 Strand = Plus / Plus

                                                                       
Query: 287 gctgtgttcgaccaggagttcatcaacgtcaagctatctgattacattgggaagaagtat 346
           |||||||| || || ||||||||||| || ||||| |||||||||||||| |||||||||
Sbjct: 289 gctgtgtttgatcaagagttcatcaaggttaagctctctgattacattggaaagaagtat 348

                                                                       
Query: 347 gtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacggct 406
           || ||||| || ||||||||  ||||||| || |||||||||||||| |||||||| || 
Sbjct: 349 gttattctctttttctacccattggactttactttcgtctgcccaacagagattactgcc 408

                
Query: 407 ttcag 411
           |||||
Sbjct: 409 ttcag 413

---

>gb|AF052202.1|AF052202 Brassica rapa subsp. pekinensis 2Cys-peroxiredoxin precursor
           (C2C-Prx) mRNA, complete cds
          Length = 841

 Score =  107 bits (54), Expect = 3e-20
 Identities = 98/110 (89%), Gaps = 2/110 (1%)
 Strand = Plus / Plus

                                                                       
Query: 303 agttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattct-tttcttc 361
           |||||||||| |||||||| ||||||||||||||||| |||||||||||||| ||| |||
Sbjct: 292 agttcatcaaggtcaagctctctgattacattgggaaaaagtatgtgattctcttttttc 351

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||| || |||||||| |||||||||||||| || ||||| || |||||
Sbjct: 352 taccc-cttgacttcactttcgtctgcccaacagaaattactgccttcag 400



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 284 gaggctgtgttcgaccaggagttcatcaa 312
           |||| ||||||||| ||||||||||||||
Sbjct: 264 gagggtgtgttcgatcaggagttcatcaa 292

---

>ref|NM_120712.2| Arabidopsis thaliana antioxidant AT5G06290 mRNA, complete cds
          Length = 1146

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 424 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 483

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 484 taccctttggacttcacttttgtctgccccactgagattactgccttcag 533

---

>gb|AF339693.1| Arabidopsis thaliana putative 2-cys peroxiredoxin protein
           (At5g06290) mRNA, complete cds
          Length = 872

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 292 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 351

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 352 taccctttggacttcacttttgtctgccccactgagattactgccttcag 401

---

>gb|AF326871.1| Arabidopsis thaliana putative 2-cys peroxiredoxin protein
           (At5g06290) mRNA, complete cds
          Length = 1034

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 299 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 358

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 359 taccctttggacttcacttttgtctgccccactgagattactgccttcag 408

---

>emb|AJ005006.1|RFAJ5506 Riccia fluitans mRNA for 2-Cys-peroxiredoxin, complete CDS
          Length = 876

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 113/134 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 ccggacttcgcggcggaggctgtgttcgaccaggagttcatcaacgtcaagctatctgat 328
           |||||||||| ||||||||| || || ||||| |||||| | ||  ||||||| || || 
Sbjct: 284 ccggacttcgaggcggaggccgtttttgaccaagagttcgtgaagatcaagctctcggag 343

                                                                       
Query: 329 tacattgggaagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgc 388
           |||||||||||||  || ||  ||||||||||||||||||| |||||||||||||| |||
Sbjct: 344 tacattgggaagagatacgttgttcttttcttctaccctcttgacttcaccttcgtttgc 403

                         
Query: 389 ccaactgagattac 402
           ||||| || |||||
Sbjct: 404 ccaacagaaattac 417

---

>gb|AY081503.1| Arabidopsis thaliana 2-cys peroxiredoxin-like protein (At5g06290)
           mRNA, complete cds
          Length = 894

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 292 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 351

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 352 taccctttggacttcacttttgtctgccccactgagattactgccttcag 401

---

>gb|AY054621.1| Arabidopsis thaliana 2-cys peroxiredoxin-like protein (At5g06290;
           MHF15.19) mRNA, complete cds
          Length = 1142

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 424 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 483

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 484 taccctttggacttcacttttgtctgccccactgagattactgccttcag 533

---

>gb|AF324689.2|AF324689 Arabidopsis thaliana AT5g06290 (AT5g06290/MHF15_19) mRNA, complete
           cds
          Length = 1019

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 299 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 358

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 359 taccctttggacttcacttttgtctgccccactgagattactgccttcag 408

---

>emb|BX832003.1|CNS09ZNZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 992

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 309 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 368

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 369 taccctttggacttcacttttgtctgccccactgagattactgccttcag 418

---

>emb|BX830261.1|CNS09ZZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB69ZG09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 277 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 336

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 337 taccctttggacttcacttttgtctgccccactgagattactgccttcag 386

---

>gb|AF311863.1|AF311863 Brassica napus 2-Cys peroxiredoxin mRNA, complete cds; nuclear gene
           for chloroplast product
          Length = 988

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 137/166 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagt 305
           |||| ||||| || ||||| ||||| || || | ||| |||||||| || ||||| ||||
Sbjct: 278 tgccactggttggtaacaaggcgcctgattttgaggcagaggctgtttttgaccaagagt 337

                                                                       
Query: 306 tcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttctacc 365
           ||||||| || ||||| || || |||||||| || |||||||||||||| ||  ||||||
Sbjct: 338 tcatcaaggtgaagctctcagagtacattggtaaaaagtatgtgattctgtttctctacc 397

                                                         
Query: 366 ctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           || |||||||||| || |||||||| || |||||||| || |||||
Sbjct: 398 ctttggacttcacttttgtctgccctacggagattactgccttcag 443

---

>gb|AY085536.1| Arabidopsis thaliana clone 15640 mRNA, complete sequence
          Length = 1129

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 302 gagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttcttc 361
           |||||||| || || ||||| ||||| |||||||| || |||||||| ||||| ||||||
Sbjct: 409 gagttcataaaggtgaagctctctgagtacattggcaaaaagtatgttattctattcttc 468

                                                             
Query: 362 taccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           |||||| |||||||||| || |||||||| ||||||||||| || |||||
Sbjct: 469 taccctttggacttcacttttgtctgccccactgagattactgccttcag 518

---

>gb|AC009918.5|ATAC009918 Arabidopsis thaliana chromosome III BAC T19F11 genomic sequence,
            complete sequence
          Length = 45173

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                        
Query: 317  aagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttc 376
            ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||||||| 
Sbjct: 9716 aagctctctgattacattggaaagaagtatgtgattctctttttctacccattggacttt 9775

                             
Query: 377  accttcgtctgcccaac 393
            || ||||||||||||||
Sbjct: 9776 actttcgtctgcccaac 9792

---

>emb|X97910.2|ATBAS1GEN Arabidopsis thaliana bas1 gene for 2-Cys peroxiredoxin
          Length = 4745

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                        
Query: 317  aagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttc 376
            ||||| |||||||||| ||||||||||||||||||||| || ||||||||  ||||||| 
Sbjct: 3010 aagctctctgattacaatgggaagaagtatgtgattctctttttctacccattggacttt 3069

                             
Query: 377  accttcgtctgcccaac 393
            || ||||||||||||||
Sbjct: 3070 actttcgtctgcccaac 3086

---

>emb|AJ315851.1|PSA315851 Pisum sativum mRNA for 2-Cys peroxiredoxin
          Length = 1044

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 287 gctgtgttcgaccaggagttcatcaacgtcaagctatctgattacattgggaagaagtat 346
           ||||| ||||| |||||||| ||||| ||||| |||||||| || ||||||||||| |||
Sbjct: 247 gctgttttcgatcaggagtttatcaaggtcaaactatctgaatatattgggaagaaatat 306

                                                                       
Query: 347 gtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacggct 406
           || || || || ||||||||  |||||||||| ||||| |||||||| || || || |||
Sbjct: 307 gttatcctctttttctacccattggacttcacgttcgtttgcccaacagaaatcactgct 366

                
Query: 407 ttcag 411
           |||||
Sbjct: 367 ttcag 371

---

>gb|AC008153.5|AC008153 Arabidopsis thaliana chromosome 3 BAC F24K9 genomic sequence, complete
              sequence
          Length = 117296

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 69/77 (89%)
 Strand = Plus / Plus

                                                                          
Query: 317    aagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttc 376
              ||||| |||||||||||||| ||||||||||||||||| || ||||||||  ||||||| 
Sbjct: 115553 aagctctctgattacattggaaagaagtatgtgattctctttttctacccattggacttt 115612

                               
Query: 377    accttcgtctgcccaac 393
              || ||||||||||||||
Sbjct: 115613 actttcgtctgcccaac 115629

---

>emb|AJ309009.2|NTA309009 Nicotiana tabacum mRNA for thioredoxin peroxidase
          Length = 990

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 122/148 (82%)
 Strand = Plus / Plus

                                                                       
Query: 264 aagcgccggacttcgcggcggaggctgtgttcgaccaggagttcatcaacgtcaagctat 323
           ||||||| ||||| | ||| || ||||| || || || || |||||||| || || ||||
Sbjct: 266 aagcgccagactttgaggctgaagctgtttttgatcaagaattcatcaaggttaaactat 325

                                                                       
Query: 324 ctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttcaccttcg 383
           |||| |||||||||||||||||||| ||||| || |||||||| || ||||| || || |
Sbjct: 326 ctgagtacattgggaagaagtatgtcattctctttttctacccactagactttacatttg 385

                                       
Query: 384 tctgcccaactgagattacggctttcag 411
           | |||||||| ||||| || ||||||||
Sbjct: 386 tttgcccaacagagatcactgctttcag 413

---

>ref|XM_472428.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 504

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 242 gacctgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccag 301
           ||||||||| |||| |||||||| ||||||||||||| |||||||||  |||||||||||
Sbjct: 58  gacctgccgttggtcgggaacaaggcgccggacttcgaggcggaggccatgttcgaccag 117

                      
Query: 302 gagttcatcaa 312
           | |||||||||
Sbjct: 118 gggttcatcaa 128

---

>emb|AL606598.3|OSJN00036 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0033G16,
            complete sequence
          Length = 114051

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                        
Query: 242  gacctgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccag 301
            ||||||||| |||| |||||||| ||||||||||||| |||||||||  |||||||||||
Sbjct: 3608 gacctgccgttggtcgggaacaaggcgccggacttcgaggcggaggccatgttcgaccag 3667

                       
Query: 302  gagttcatcaa 312
            | |||||||||
Sbjct: 3668 gggttcatcaa 3678



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 70/81 (86%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                        
Query: 314  gtcaagctatctgattacattggg-aagaagtatgtgattcttttcttctaccctctgga 372
            |||||||| ||||| || |||||| || || |||||| |||| ||||||||||| |||||
Sbjct: 4165 gtcaagctgtctgagtatattggggaaaaaatatgtggttctgttcttctaccccctgga 4224

                                 
Query: 373  cttcaccttcgtctgcccaac 393
            |||||| |||||||| |||||
Sbjct: 4225 cttcacgttcgtctgtccaac 4245



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 178  cgccgccgccggctcgaggacggccagggcccgtagcttcgtcgcccgcgccg 230
            ||||||||||| ||||||  |||| |||||||| |||||||||||||| ||||
Sbjct: 3450 cgccgccgccgcctcgagatcggctagggcccgcagcttcgtcgcccgggccg 3502



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 36   ccacggccatggcgtgcgccatctccgcctcc 67
            |||||||||||||||||||| |||||| ||||
Sbjct: 3310 ccacggccatggcgtgcgccttctccgtctcc 3341

---

>emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991214_12,
             complete sequence
          Length = 116952

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                         
Query: 242   gacctgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccag 301
             ||||||||| |||| |||||||| ||||||||||||| |||||||||  |||||||||||
Sbjct: 79902 gacctgccgttggtcgggaacaaggcgccggacttcgaggcggaggccatgttcgaccag 79961

                        
Query: 302   gagttcatcaa 312
             | |||||||||
Sbjct: 79962 gggttcatcaa 79972



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 70/81 (86%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                         
Query: 314   gtcaagctatctgattacattggg-aagaagtatgtgattcttttcttctaccctctgga 372
             |||||||| ||||| || |||||| || || |||||| |||| ||||||||||| |||||
Sbjct: 80459 gtcaagctgtctgagtatattggggaaaaaatatgtggttctgttcttctaccccctgga 80518

                                  
Query: 373   cttcaccttcgtctgcccaac 393
             |||||| |||||||| |||||
Sbjct: 80519 cttcacgttcgtctgtccaac 80539



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 178   cgccgccgccggctcgaggacggccagggcccgtagcttcgtcgcccgcgccg 230
             ||||||||||| ||||||  |||| |||||||| |||||||||||||| ||||
Sbjct: 79744 cgccgccgccgcctcgagatcggctagggcccgcagcttcgtcgcccgggccg 79796



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 36    ccacggccatggcgtgcgccatctccgcctcc 67
             |||||||||||||||||||| |||||| ||||
Sbjct: 79604 ccacggccatggcgtgcgccttctccgtctcc 79635

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                            
Query: 242      gacctgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccag 301
                ||||||||| |||| |||||||| ||||||||||||| |||||||||  |||||||||||
Sbjct: 20569274 gacctgccgttggtcgggaacaaggcgccggacttcgaggcggaggccatgttcgaccag 20569333

                           
Query: 302      gagttcatcaa 312
                | |||||||||
Sbjct: 20569334 gggttcatcaa 20569344



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 70/81 (86%), Gaps = 1/81 (1%)
 Strand = Plus / Plus

                                                                            
Query: 314      gtcaagctatctgattacattggg-aagaagtatgtgattcttttcttctaccctctgga 372
                |||||||| ||||| || |||||| || || |||||| |||| ||||||||||| |||||
Sbjct: 20569831 gtcaagctgtctgagtatattggggaaaaaatatgtggttctgttcttctaccccctgga 20569890

                                     
Query: 373      cttcaccttcgtctgcccaac 393
                |||||| |||||||| |||||
Sbjct: 20569891 cttcacgttcgtctgtccaac 20569911



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                     
Query: 178      cgccgccgccggctcgaggacggccagggcccgtagcttcgtcgcccgcgccg 230
                ||||||||||| ||||||  |||| |||||||| |||||||||||||| ||||
Sbjct: 20569116 cgccgccgccgcctcgagatcggctagggcccgcagcttcgtcgcccgggccg 20569168



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 36       ccacggccatggcgtgcgccatctccgcctcc 67
                |||||||||||||||||||| |||||| ||||
Sbjct: 20568976 ccacggccatggcgtgcgccttctccgtctcc 20569007



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 58       ctccgcctccaccgtgtcca 77
                ||||||||||||||||||||
Sbjct: 16985932 ctccgcctccaccgtgtcca 16985951



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 63     cctccaccgtgtccacggcc 82
              ||||||||||||||||||||
Sbjct: 685153 cctccaccgtgtccacggcc 685172

---

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                          
Query: 338    aagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgag 397
              |||||||| ||| | || |||||||||||  |||||||||||||||||||||| || |||
Sbjct: 553227 aagaagtacgtggtgctgttcttctaccccttggacttcaccttcgtctgcccgacggag 553168

                                
Query: 398    attacggctttcagcgat 415
              || |||||||||||||||
Sbjct: 553167 atcacggctttcagcgat 553150

---

>emb|AJ293493.1|SHY293493 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR21
          Length = 366

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                       
Query: 246 tgccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagt 305
           |||||||||| |||||||| || || ||||||| ||| ||||| ||||||||||||||||
Sbjct: 289 tgccgctggtcgggaacaaggctccagacttcgaggccgaggccgtgttcgaccaggagt 230

                     
Query: 306 tcatcaacgt 315
           ||||||||||
Sbjct: 229 tcatcaacgt 220



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 317 aagctatctgattacattgggaagaagt 344
           ||||| ||||||||||| ||||||||||
Sbjct: 29  aagctctctgattacatcgggaagaagt 2

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                            
Query: 247      gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
                ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 19901833 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 19901892

                         
Query: 307      catcaacgt 315
                |||||||||
Sbjct: 19901893 catcaacgt 19901901



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                            
Query: 329      tacattgggaagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgc 388
                ||||| ||||||||||| || ||||| |||||||||||  ||||||||||||||||||||
Sbjct: 19902049 tacatcgggaagaagtacgtcattctcttcttctacccgttggacttcaccttcgtctgc 19902108

                  
Query: 389      cc 390
                ||
Sbjct: 19902109 cc 19902110

---

>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0508B05
          Length = 166165

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                         
Query: 247   gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
             ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 79434 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 79493

                      
Query: 307   catcaacgt 315
             |||||||||
Sbjct: 79494 catcaacgt 79502



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                         
Query: 329   tacattgggaagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgc 388
             ||||| ||||||||||| || ||||| |||||||||||  ||||||||||||||||||||
Sbjct: 79650 tacatcgggaagaagtacgtcattctcttcttctacccgttggacttcaccttcgtctgc 79709

               
Query: 389   cc 390
             ||
Sbjct: 79710 cc 79711

---

>dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OSJNBa0014M17
          Length = 156778

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                        
Query: 247  gccgctggtggggaacaaagcgccggacttcgcggcggaggctgtgttcgaccaggagtt 306
            ||||||||| |||||||| ||||| |||||||  |||||||| || ||||||||||||||
Sbjct: 5954 gccgctggtcgggaacaaggcgcccgacttcgatgcggaggcagtcttcgaccaggagtt 6013

                     
Query: 307  catcaacgt 315
            |||||||||
Sbjct: 6014 catcaacgt 6022



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                        
Query: 329  tacattgggaagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgc 388
            ||||| ||||||||||| || ||||| |||||||||||  ||||||||||||||||||||
Sbjct: 6170 tacatcgggaagaagtacgtcattctcttcttctacccgttggacttcaccttcgtctgc 6229

              
Query: 389  cc 390
            ||
Sbjct: 6230 cc 6231

---

>dbj|AB006700.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHF15
          Length = 83865

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                         
Query: 317   aagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggacttc 376
             ||||| ||||| |||||||| || |||||||| ||||| |||||||||||| ||||||||
Sbjct: 28671 aagctctctgagtacattggcaaaaagtatgttattctattcttctaccctttggacttc 28730

                                
Query: 377   accttcgtctgcccaactg 395
             || || |||||||| ||||
Sbjct: 28731 acttttgtctgccccactg 28749

---

>emb|AJ288895.1|PVU288895 Phaseolus vulgaris mRNA for peroxiredoxin (2-Cys PRx gene)
          Length = 944

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                       
Query: 299 caggagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttc 358
           |||||||||||||| ||||| ||||||||||| |||||||| || ||||| || || || 
Sbjct: 292 caggagttcatcaaggtcaaactatctgattatattgggaaaaaatatgttatcctcttt 351

                                     
Query: 359 ttctaccctctggacttcaccttcgt 384
           ||||| || ||||||||||| |||||
Sbjct: 352 ttctatccactggacttcacattcgt 377

---

>gb|AY389677.1| Hyacinthus orientalis 2-cys peroxiredoxin-like protein mRNA,
           partial cds
          Length = 754

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 299 caggagttcatcaacgtcaagctatctgattacattgggaagaagtatgtgattcttttc 358
           |||||||||||||| |||||||| || || || ||||||||||||||||||||  | || 
Sbjct: 59  caggagttcatcaaggtcaagctttcagaatatattgggaagaagtatgtgatcttgttt 118

                                                                
Query: 359 ttctaccctctggacttcaccttcgtctgcccaactgagattacggctttcag 411
           ||||||||  |||| ||||| || || || || |||||||| || ||||||||
Sbjct: 119 ttctaccccttggatttcacatttgtttgtcccactgagataactgctttcag 171

---

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                           
Query: 338     aagaagtatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgag 397
               |||||||||||| | || |||||||||||  ||||||||||||| ||||||||||| |||
Sbjct: 2357737 aagaagtatgtggtgctgttcttctaccccttggacttcacctttgtctgcccaacggag 2357678

                                
Query: 398     attacggctttcagcga 414
               || ||||| || |||||
Sbjct: 2357677 atcacggcctttagcga 2357661

---

>gb|AY728092.1| Taenia solium 2-Cys peroxiredoxin mRNA, complete cds
          Length = 681

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 344 tatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||| || |||||||||||  |||||||||||||||||||||| ||||||||
Sbjct: 112 tatgtgatcctcttcttctacccaatggacttcaccttcgtctgccccactgagat 167

---

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                          
Query: 356     ttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttcagcga 414
               |||||||| || ||||| ||||||||||| ||||| ||||| || ||||||||||||||
Sbjct: 1240105 ttcttctatccactggatttcaccttcgtttgcccgactgaaatcacggctttcagcga 1240047

---

>gb|DQ215102.1| Taeniopygia guttata clone 0058P0007G11 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 1236

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 449 ttttcttctaccctctggacttcacttttgtctgtccaactga 491

---

>gb|DQ215100.1| Taeniopygia guttata clone 0058P0021E05 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 974

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 185 ttttcttctaccctctggacttcacttttgtctgtccaactga 227

---

>gb|DQ215089.1| Taeniopygia guttata clone 0058P0016B02 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 972

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 186 ttttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|AC010993.13| Drosophila melanogaster clone BACR27O05, complete sequence
          Length = 193526

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 353   cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
             |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 71075 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 71121

---

>gb|AF321616.1| Drosophila melanogaster cytosolic thioredoxin peroxidase variant 2
           mRNA, complete cds
          Length = 1027

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 240 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 286

---

>gb|AF321615.1| Drosophila melanogaster cytosolic thioredoxin peroxidase variant 1
           mRNA, complete cds
          Length = 1014

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 227 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 273

---

>ref|NM_167359.1| Drosophila melanogaster thioredoxin peroxidase 1 CG1633-RB,
           transcript variant B (Jafrac1), mRNA
          Length = 992

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 223 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 269

---

>ref|NM_058162.2| Drosophila melanogaster thioredoxin peroxidase 1 CG1633-RA,
           transcript variant A (Jafrac1), mRNA
          Length = 1013

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 243 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 289

---

>gb|AY070534.1| Drosophila melanogaster GM14788 full insert cDNA
          Length = 1006

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 223 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 269

---

>gb|AF167098.1|AF167098 Drosophila melanogaster thioredoxin peroxidase 1 (Jafrac1) mRNA,
           complete cds
          Length = 955

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 161 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 207

---

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                  
Query: 356     ttcttctaccctctggacttcaccttcgtctgccc 390
               ||||||||||| |||||||||||||||||||||||
Sbjct: 1272084 ttcttctacccgctggacttcaccttcgtctgccc 1272118



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 371     gacttcaccttcgtctgccc 390
               ||||||||||||||||||||
Sbjct: 2385058 gacttcaccttcgtctgccc 2385077

---

>gb|AE003492.3| Drosophila melanogaster chromosome X, section 44 of 74 of the complete
             sequence
          Length = 296756

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 353   cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
             |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 72697 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 72743

---

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                  
Query: 356     ttcttctaccctctggacttcaccttcgtctgccc 390
               ||||||||||| |||||||||||||||||||||||
Sbjct: 1243227 ttcttctacccgctggacttcaccttcgtctgccc 1243261



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 192     cgaggacggccagggcccgt 211
               ||||||||||||||||||||
Sbjct: 3405270 cgaggacggccagggcccgt 3405289

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                  
Query: 356     ttcttctaccctctggacttcaccttcgtctgccc 390
               ||||||||||| |||||||||||||||||||||||
Sbjct: 4038271 ttcttctacccgctggacttcaccttcgtctgccc 4038237

---

>gb|BT014630.1| Drosophila melanogaster SD27832 full insert cDNA
          Length = 1392

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 353 cttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 606 cttttcttctacccgctggacttcaccttcgtgtgccccaccgagat 652

---

>ref|XM_422437.1| PREDICTED: Gallus gallus similar to peroxiredoxin 1 (LOC424598),
           mRNA
          Length = 927

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
           ||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 158 ttcttctaccctctggacttcacttttgtttgcccaactgaaatta 203

---

>emb|CR406137.1| Gallus gallus finished cDNA, clone ChEST858m1
          Length = 965

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
           ||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 200 ttcttctaccctctggacttcacttttgtttgcccaactgaaatta 245

---

>emb|CR353582.1| Gallus gallus finished cDNA, clone ChEST5e12
          Length = 934

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
           ||||||||||||||||||||||| || || ||||||||||| ||||
Sbjct: 163 ttcttctaccctctggacttcacttttgtttgcccaactgaaatta 208

---

>gb|DQ217318.1| Taeniopygia guttata clone 0065P0012D05 mRNA sequence
          Length = 976

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215101.1| Taeniopygia guttata clone 0058P0004G09 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 990

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 172 ttcttctaccctctggacttcacttttgtctgtccaactga 212

---

>gb|DQ215098.1| Taeniopygia guttata clone 0058P0060A12 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 976

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215097.1| Taeniopygia guttata clone 0058P0007D02 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 1000

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 216 ttcttctaccctctggacttcacttttgtctgtccaactga 256

---

>gb|DQ215096.1| Taeniopygia guttata clone 0065P0024F03 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 902

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 114 ttcttctaccctctggacttcacttttgtctgtccaactga 154

---

>gb|DQ215095.1| Taeniopygia guttata clone 0058P0014B02 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 976

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215094.1| Taeniopygia guttata clone 0058P0004H09 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 993

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215093.1| Taeniopygia guttata clone 0058P0018E07 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 985

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 189 ttcttctaccctctggacttcacttttgtctgtccaactga 229

---

>gb|DQ215092.1| Taeniopygia guttata clone 0058P0057F09 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 978

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215091.1| Taeniopygia guttata clone 0061P0030A04 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 968

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|DQ215090.1| Taeniopygia guttata clone 0058P0047B05 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 985

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 189 ttcttctaccctctggacttcacttttgtctgtccaactga 229

---

>gb|DQ215087.1| Taeniopygia guttata clone 0058P0041C11 peroxiredoxin 1 variant
           2-like mRNA, complete sequence
          Length = 976

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||||||||||||| || ||||| ||||||||
Sbjct: 188 ttcttctaccctctggacttcacttttgtctgtccaactga 228

---

>gb|BC084157.1| Xenopus laevis cDNA clone IMAGE:6952555
          Length = 1368

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 351 ttcttttcttctaccctctggacttcaccttcgtctg 387
           |||| ||||||||||||||||||||||| ||||||||
Sbjct: 318 ttctcttcttctaccctctggacttcactttcgtctg 354

---

>gb|AY731376.1| Ictalurus punctatus natural killer cell enhancing factor (NKEF) gene,
            complete cds
          Length = 5242

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                         
Query: 356  ttcttctaccctctggacttcaccttcgt 384
            |||||||||||||||||||||||||||||
Sbjct: 1842 ttcttctaccctctggacttcaccttcgt 1870

---

>gb|BC074236.1| Xenopus laevis MGC83969 protein, mRNA (cDNA clone MGC:83969
           IMAGE:6945201), complete cds
          Length = 1097

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 351 ttcttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||| ||||| ||||||||||||||||| ||||||||||| || |||||
Sbjct: 327 ttctcttcttttaccctctggacttcacattcgtctgccccacggagat 375

---

>ref|XM_862333.1| PREDICTED: Canis familiaris similar to Peroxiredoxin 2 (Thioredoxin
           peroxidase 1) (Thioredoxin-dependent peroxide reductase
           1) (Thiol-specific antioxidant protein) (TSA) (PRP)
           (Natural killer cell enhancing factor B) (NKEF-B),
           transcript variant 2 (LOC484926), mRNA
          Length = 1080

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 359 ttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 376 ttctacccgctggacttcaccttcgtctgccccacggagat 416

---

>ref|XM_542042.2| PREDICTED: Canis familiaris similar to Peroxiredoxin 2 (Thioredoxin
           peroxidase 1) (Thioredoxin-dependent peroxide reductase
           1) (Thiol-specific antioxidant protein) (TSA) (PRP)
           (Natural killer cell enhancing factor B) (NKEF-B),
           transcript variant 1 (LOC484926), mRNA
          Length = 939

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 359 ttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||| ||||||||||||||||||||||| || |||||
Sbjct: 235 ttctacccgctggacttcaccttcgtctgccccacggagat 275

---

>ref|NM_001030437.1| Xenopus tropicalis prdx3 protein (prdx3), mRNA
          Length = 1076

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 351 ttcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttca 410
           ||||||||||||||||| |||||||||| || || || || |||||||||  ||||||||
Sbjct: 256 ttcttttcttctaccctttggacttcacttttgtgtgtcccactgagattgtggctttca 315

            
Query: 411 g 411
           |
Sbjct: 316 g 316

---

>gb|BC091062.1| Xenopus tropicalis prdx3 protein, mRNA (cDNA clone MGC:108328
           IMAGE:7022282), complete cds
          Length = 1076

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 351 ttcttttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttca 410
           ||||||||||||||||| |||||||||| || || || || |||||||||  ||||||||
Sbjct: 256 ttcttttcttctaccctttggacttcacttttgtgtgtcccactgagattgtggctttca 315

            
Query: 411 g 411
           |
Sbjct: 316 g 316

---

>gb|BC099274.1| Xenopus laevis cDNA clone MGC:116466 IMAGE:6933029, complete cds
          Length = 1364

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 351 ttcttttcttctaccctctggacttcaccttcgtctg 387
           |||| ||||||||||||||||||||||| ||||||||
Sbjct: 302 ttctcttcttctaccctctggacttcactttcgtctg 338

---

>gb|AF478688.1| Echinococcus granulosus thioredoxin peroxidase (TPx) mRNA, complete
           cds
          Length = 670

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 344 tatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||| ||  |||| |||||||||||||| || ||||||||
Sbjct: 102 tatgtgattctcttcttctatccgatggatttcaccttcgtctgtcccactgagat 157

---

>ref|XM_797300.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053487507.10) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>ref|XM_797710.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053507259.10) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>ref|XM_799478.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053509445.10) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>ref|XM_801125.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053505983.9) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>ref|XM_803659.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053504839.28) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>ref|XM_803661.1| Trypanosoma cruzi strain CL Brener tryparedoxin peroxidase
           (Tc00.1047053504839.44) partial mRNA
          Length = 600

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 124 ttcttctacccgatggacttcaccttcgtctgccccacagagat 167

---

>emb|AJ012101.1|TCR012101 Trypanosoma cruzi gene encoding tryparedoxin peroxidase homologue
          Length = 913

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 396 ttcttctacccgatggacttcaccttcgtctgccccacagagat 439

---

>emb|AJ304857.1|CRE304857 Chlamydomonas reinhardtii partial mRNA for peroxiredoxin
           (thioredoxin peroxidase gene)
          Length = 1221

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 127 ttcttctaccccctggacttcaccttcgtgtgccccaccgagat 170

---

>emb|AJ304856.1|CRE304856 Chlamydomonas reinhardtii thioredoxin peroxidase gene for
           peroxiredoxin, exons 1-3
          Length = 1946

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 517 ttcttctaccccctggacttcaccttcgtgtgccccaccgagat 560

---

>gb|DQ122920.1| Chlamydomonas incerta chloroplast thioredoxin peroxidase mRNA,
           complete cds; nuclear gene for chloroplast product
          Length = 1255

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 235 ttcttctaccccctggacttcaccttcgtgtgccccaccgagat 278

---

>gb|AF320771.1|AF320771 Trypanosoma cruzi Dm28c tryparedoxin peroxidase gene, complete cds
          Length = 661

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 185 ttcttctacccgatggacttcaccttcgtctgccccacagagat 228

---

>gb|AF250196.1|AF250196 Oncorhynchus mykiss clone Hot Creek natural killer cell enhancement
           factor (Nkef) mRNA, complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||||||||| || ||||| ||||||||
Sbjct: 155 ttcttctacccgctggacttcacctttgtgtgccccactgagat 198

---

>gb|AF250195.1|AF250195 Oncorhynchus mykiss clone Arlee natural killer cell enhancement
           factor (Nkef) mRNA, complete cds
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||||||||| || ||||| ||||||||
Sbjct: 155 ttcttctacccgctggacttcacctttgtgtgccccactgagat 198

---

>gb|AF250194.1|AF250194 Oncorhynchus mykiss clone OSU natural killer cell enhancement
           factor (Nkef) mRNA, complete cds
          Length = 1126

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||||||||| || ||||| ||||||||
Sbjct: 176 ttcttctacccgctggacttcacctttgtgtgccccactgagat 219

---

>gb|AF250193.1|AF250193 Oncorhynchus mykiss clone OSU natural killer cell enhancement factor
            (Nkef) gene, complete cds
          Length = 6524

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 356  ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
            ||||||||||| |||||||||||||| || ||||| ||||||||
Sbjct: 1737 ttcttctacccgctggacttcacctttgtgtgccccactgagat 1780

---

>gb|AF312025.1|AF312025 Chlamydomonas reinhardtii thioredoxin peroxidase gene, complete cds
          Length = 1911

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| ||||||||||||||||| ||||| || |||||
Sbjct: 307 ttcttctaccccctggacttcaccttcgtgtgccccaccgagat 350

---

>gb|AF106856.1|AF106856 Trypanosoma cruzi tryparedoxin peroxidase (Tryp) mRNA, complete cds
          Length = 1250

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||||  |||||||||||||||||||||| || |||||
Sbjct: 197 ttcttctacccgatggacttcaccttcgtctgccccacagagat 240

---

>gb|AF034959.1|AF034959 Echinococcus granulosus thioredoxin peroxidase mRNA, partial cds
          Length = 640

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 344 tatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||| ||  |||| |||||||||||||| || ||||||||
Sbjct: 78  tatgtgattctcttcttctatccgatggatttcaccttcgtctgtcccactgagat 133

---

>gb|U27125.1|OMU27125 Oncorhynchus mykiss natural killer enhancement factor-like protein
           (RBT-NKEF) mRNA, complete cds
          Length = 1105

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| |||||||||||||| || ||||| ||||||||
Sbjct: 168 ttcttctacccgctggacttcacctttgtgtgccccactgagat 211

---

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 356     ttcttctaccctctggacttcaccttcgtctgccc 390
               ||||||||||| |||||||||||||| ||||||||
Sbjct: 5096212 ttcttctacccgctggacttcacctttgtctgccc 5096178

---

>gb|DQ472128.1| Scophthalmus maximus natural killer enhancing factor mRNA, complete
           cds
          Length = 904

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttcagcga 414
           ||||||||||| ||||||||||| || || ||||| |||||||||  ||| ||||||||
Sbjct: 243 ttcttctaccccctggacttcacatttgtgtgccccactgagattgtggccttcagcga 301

---

>emb|CR718347.2|CNS0GH81 Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 56  ttttcttctacccactggacttcacctttgtgtgccccactga 98

---

>emb|CR717209.2|CNS0GGCI Tetraodon nigroviridis full-length cDNA
          Length = 955

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 175 ttttcttctacccactggacttcacctttgtgtgccccactga 217

---

>emb|CR717117.2|CNS0GG9Y Tetraodon nigroviridis full-length cDNA
          Length = 963

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 181 ttttcttctacccactggacttcacctttgtgtgccccactga 223

---

>ref|XM_774575.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_574_28970_29647) partial mRNA
          Length = 678

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 356 ttcttctaccctctggacttcaccttcgtctgccc 390
           ||||||||||| || ||||||||||||||||||||
Sbjct: 537 ttcttctacccgctcgacttcaccttcgtctgccc 503

---

>ref|XM_774576.1| Giardia lamblia ATCC 50803 thioredoxin peroxidase
           (GLP_574_29623_29018) partial mRNA
          Length = 606

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 356 ttcttctaccctctggacttcaccttcgtctgccc 390
           ||||||||||| || ||||||||||||||||||||
Sbjct: 118 ttcttctacccgctcgacttcaccttcgtctgccc 152

---

>emb|CR709661.2|CNS0GAIX Tetraodon nigroviridis full-length cDNA
          Length = 880

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 182 ttttcttctacccactggacttcacctttgtgtgccccactga 224

---

>emb|CR707934.2|CNS0G96Y Tetraodon nigroviridis full-length cDNA
          Length = 957

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 177 ttttcttctacccactggacttcacctttgtgtgccccactga 219

---

>emb|CR701828.2|CNS0G4HC Tetraodon nigroviridis full-length cDNA
          Length = 953

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 174 ttttcttctacccactggacttcacctttgtgtgccccactga 216

---

>emb|CR662089.2|CNS0F9U7 Tetraodon nigroviridis full-length cDNA
          Length = 982

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 154 ttttcttctacccactggacttcacctttgtgtgccccactga 196

---

>emb|CR650629.2|CNS0F0ZV Tetraodon nigroviridis full-length cDNA
          Length = 778

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 179 ttttcttctacccactggacttcacctttgtgtgccccactga 221

---

>emb|CR647881.2|CNS0EYVJ Tetraodon nigroviridis full-length cDNA
          Length = 828

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 166 ttttcttctacccactggacttcacctttgtgtgccccactga 208

---

>emb|CR637477.2|CNS0EQUJ Tetraodon nigroviridis full-length cDNA
          Length = 778

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 179 ttttcttctacccactggacttcacctttgtgtgccccactga 221

---

>emb|BX569692.1| Synechococcus sp. WH8102 complete genome; segment 4/7
          Length = 345997

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                         
Query: 356    ttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttcagcga 414
              |||||||| || ||||| ||||||||||||||||| || || || ||||| ||||||||
Sbjct: 158913 ttcttctatcccctggatttcaccttcgtctgccccacagaaatcacggccttcagcga 158855

---

>emb|AJ288896.1|PVU288896 Phaseolus vulgaris 2-Cys PRx gene for peroxiredoxin, exons 1-7
          Length = 3175

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 314  gtcaagctatctgattacattgggaagaagtatgtgattcttttcttctaccctctggac 373
            ||||| ||||||||||| |||||||| || ||||| || || || ||||| || ||||||
Sbjct: 1430 gtcaaactatctgattatattgggaaaaaatatgttatcctctttttctatccactggac 1489

                       
Query: 374  ttcaccttcgt 384
            ||||| |||||
Sbjct: 1490 ttcacattcgt 1500

---

>emb|CR937859.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YC11AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 819

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 356 ttcttctaccctctggacttcaccttcgtctgccc 390
           ||||||||||| || ||||||||||||||||||||
Sbjct: 309 ttcttctacccccttgacttcaccttcgtctgccc 343

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                  
Query: 356     ttcttctaccctctggacttcaccttcgtctgccc 390
               ||||||||||| ||||||||||||||||| |||||
Sbjct: 5601126 ttcttctacccactggacttcaccttcgtgtgccc 5601092

---

>gb|AF321614.1| Drosophila melanogaster secretable thioredoxin peroxidase mRNA,
           complete cds
          Length = 1061

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 329 tcttctacccactggacttcacctttgtatgcccaacggagat 371

---

>ref|NM_167971.1| Drosophila melanogaster thioredoxin peroxidase 2 CG1274-RB,
           transcript variant B (Jafrac2), mRNA
          Length = 1134

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 433 tcttctacccactggacttcacctttgtatgcccaacggagat 475

---

>ref|NM_080263.2| Drosophila melanogaster thioredoxin peroxidase 2 CG1274-RA,
           transcript variant A (Jafrac2), mRNA
          Length = 1038

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 337 tcttctacccactggacttcacctttgtatgcccaacggagat 379

---

>gb|AF323181.1|AF323181 Aedes aegypti 2-Cys thioredoxin peroxidase (TPx) mRNA, complete cds
          Length = 1049

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 356 ttcttctaccctctggacttcaccttcgtctgccc 390
           ||||||||||| || ||||||||||||||||||||
Sbjct: 305 ttcttctacccccttgacttcaccttcgtctgccc 339

---

>gb|AY060785.1| Drosophila melanogaster GH25379 full length cDNA
          Length = 1045

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 329 tcttctacccactggacttcacctttgtatgcccaacggagat 371

---

>ref|XM_571871.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7
          Length = 728

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||  |||||||||||||||| ||||| ||||||||
Sbjct: 133 tcttctaccccatggacttcaccttcgtttgccctactgagat 175

---

>gb|DQ003333.1| Tetraodon nigroviridis natural killer cell enhancement factor
           (NKEF) mRNA, complete cds
          Length = 940

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 354 ttttcttctaccctctggacttcaccttcgtctgcccaactga 396
           ||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 182 ttttcttctacccactggacttcacctttgtgtgccccactga 224

---

>gb|AE004773.1| Pseudomonas aeruginosa PAO1, section 334 of 529 of the complete
            genome
          Length = 10822

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 356  ttcttctaccctctggacttcaccttcgtctgccc 390
            |||||||| || |||||||||||||||||||||||
Sbjct: 5508 ttcttctatccgctggacttcaccttcgtctgccc 5474

---

>gb|AF167099.1|AF167099 Drosophila melanogaster thioredoxin peroxidase 2 (Jafrac2) mRNA,
           complete cds
          Length = 1046

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 357 tcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||||| |||||||||||||| || |||||||| |||||
Sbjct: 314 tcttctacccactggacttcacctttgtatgcccaacggagat 356

---

>gb|AF128226.1|AF128226 Giardia intestinalis thioredoxin peroxidase homolog (Txp) gene,
           complete cds
          Length = 924

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 356 ttcttctaccctctggacttcaccttcgtctgccc 390
           ||||||||||| || ||||||||||||||||||||
Sbjct: 409 ttcttctacccgctcgacttcaccttcgtctgccc 443

---

>dbj|D37808.1|NEWABP25 Cynops pyrrhogaster ABP-25 mRNA for animal blastomere protein,
           complete cds
          Length = 966

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 341 aagtatgtgattcttttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||| ||| || |||||||||||||| ||||||||||||| || ||||| || |||||
Sbjct: 166 aagtacgtggtttttttcttctaccctttggacttcacctttgtttgccccacggagat 224

---

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 354     ttttcttctaccctctggacttcaccttcgt 384
               |||||||||| ||||||||||||||||||||
Sbjct: 5137263 ttttcttctatcctctggacttcaccttcgt 5137233

---

>gb|AY231665.1| Drosophila yakuba clone yak-em_Jafrac1 mRNA sequence
          Length = 582

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
           |||||||| || ||||||||||||||||| ||||| || |||||||
Sbjct: 109 ttcttctatccgctggacttcaccttcgtgtgccccacggagatta 154

---

>emb|BX571661.1| Wolinella succinogenes, complete genome; segment 5/7
          Length = 346613

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 371    gacttcaccttcgtctgcccaactgagatt 400
              |||||||||||||||||||| |||||||||
Sbjct: 248809 gacttcaccttcgtctgccccactgagatt 248838

---

>emb|BX248358.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
             5/8
          Length = 348408

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                   
Query: 356   ttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttc 409
             |||||||||||   ||| ||||||||||| ||||||||||||||| | ||||||
Sbjct: 51895 ttcttctacccaaaggatttcaccttcgtgtgcccaactgagattgcagctttc 51842

---

>gb|U37429.1| Caenorhabditis elegans cosmid F09E5, complete sequence
          Length = 44726

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 356   ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
             ||||||||||| || |||||||| ||||| |||||||| |||||||
Sbjct: 39100 ttcttctacccacttgacttcactttcgtgtgcccaaccgagatta 39145

---

>ref|NM_182252.2| Caenorhabditis elegans PeRoxireDoXin family member (prdx-2)
           (prdx-2) mRNA, complete cds
          Length = 733

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatta 401
           ||||||||||| || |||||||| ||||| |||||||| |||||||
Sbjct: 121 ttcttctacccacttgacttcactttcgtgtgcccaaccgagatta 166

---

>gb|U18620.1|CDU18620 Corynebacterium diphtheriae iron-repressible polypeptide (dirA)
           gene, complete cds
          Length = 840

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagattacggctttc 409
           |||||||||||   ||| ||||||||||| ||||||||||||||| | ||||||
Sbjct: 391 ttcttctacccaaaggatttcaccttcgtgtgcccaactgagattgcagctttc 444

---

>dbj|AB022045.1| Ascaris suum mRNA for thioredoxin peroxidase, complete cds
          Length = 746

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaac 393
           |||||||||||| |||||||||| ||||| ||||||||
Sbjct: 147 ttcttctaccctatggacttcacattcgtatgcccaac 184

---

>gb|AY787751.1| Phanerochaete chrysosporium peroxiredoxins (Prxs) mRNA, complete
           cds
          Length = 932

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagatt 400
           |||||||||||  ||||||||||||| |||||||| || ||||||
Sbjct: 173 ttcttctaccccatggacttcacctttgtctgccccaccgagatt 217

---

>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence
          Length = 1207381

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 354    ttttcttctaccctctggacttcaccttcgtctgccc 390
              |||||||||||||   |||||||||||||||||||||
Sbjct: 688065 ttttcttctacccgaaggacttcaccttcgtctgccc 688029

---

>gb|DQ118780.1| Haliotis discus hannai thioredoxin peroxidase mRNA, partial cds
          Length = 657

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 359 ttctaccctctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| |||||||| || ||||||||||| || ||||  || |||||||||
Sbjct: 314 ttctaccctctagacttcacgtttgtctgcccaacagaaattattgcattcagcgat 370

---

>gb|DQ000546.1| Synthetic construct clone PSF:108501 thioredoxin peroxidase 1-like
           gene, complete cds
          Length = 669

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 359 ttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||||||||||||||| || ||||| || |||||
Sbjct: 196 ttctaccctctggacttcacctttgtgtgccccaccgagat 236

---

>gb|AE017224.1| Brucella abortus biovar 1 str. 9-941 chromosome II, complete sequence
          Length = 1162204

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 354    ttttcttctaccctctggacttcaccttcgtctgccc 390
              |||||||||||||   |||||||||||||||||||||
Sbjct: 529112 ttttcttctacccgaaggacttcaccttcgtctgccc 529148

---

>emb|AM040265.1| Brucella melitensis biovar Abortus chromosome II, complete sequence,
              strain 2308
          Length = 1156948

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 354    ttttcttctaccctctggacttcaccttcgtctgccc 390
              |||||||||||||   |||||||||||||||||||||
Sbjct: 529100 ttttcttctacccgaaggacttcaccttcgtctgccc 529136

---

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 347     gtgattcttttcttctaccctctggacttcaccttcgtctgccc 390
               ||||| || |||||||| || |||||||||||||| ||||||||
Sbjct: 3586961 gtgatcctcttcttctatcccctggacttcacctttgtctgccc 3587004

---

>gb|AY617208.1| Sterkiella histriomuscorum clone UGC1O0001_E02_R genomic sequence
          Length = 1027

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           |||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 372 ttcttctatccactcgatttcaccttcgtgtgcccaactgagat 415

---

>emb|CR728668.2|CNS0GP6Q Tetraodon nigroviridis full-length cDNA
          Length = 1076

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 368 ctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| ||||||||||| || ||||| |  ||||||||||||
Sbjct: 399 ctggacttcacgttcgtctgccccaccgagatcattgctttcagcgat 446

---

>emb|CR703948.1|CNS0G648 Tetraodon nigroviridis full-length cDNA
          Length = 1039

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 368 ctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| ||||||||||| || ||||| |  ||||||||||||
Sbjct: 380 ctggacttcacgttcgtctgccccaccgagatcattgctttcagcgat 427

---

>emb|CR687503.2|CNS0FTFF Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 368 ctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| ||||||||||| || ||||| |  ||||||||||||
Sbjct: 399 ctggacttcacgttcgtctgccccaccgagatcattgctttcagcgat 446

---

>emb|CR687104.2|CNS0FT4C Tetraodon nigroviridis full-length cDNA
          Length = 1024

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 368 ctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| ||||||||||| || ||||| |  ||||||||||||
Sbjct: 344 ctggacttcacgttcgtctgccccaccgagatcattgctttcagcgat 391

---

>emb|CR684249.1|CNS0FQX1 Tetraodon nigroviridis full-length cDNA
          Length = 1064

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 368 ctggacttcaccttcgtctgcccaactgagattacggctttcagcgat 415
           ||||||||||| ||||||||||| || ||||| |  ||||||||||||
Sbjct: 394 ctggacttcacgttcgtctgccccaccgagatcattgctttcagcgat 441

---

>emb|BX053384.1|CNS09DCS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 702 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 659

---

>emb|BX053383.1|CNS09DCR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 311 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 354

---

>emb|BX070810.1|CNS09QSU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 162 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 205

---

>emb|BX069290.1|CNS09PMM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 814 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 771

---

>emb|BX069289.1|CNS09PML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 320 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 363

---

>emb|BX068000.1|CNS09OMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 798 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 755

---

>emb|BX067999.1|CNS09OMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 306 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 349

---

>emb|BX067924.1|CNS09OKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 775 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 732

---

>emb|BX067923.1|CNS09OKN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 295 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 338

---

>emb|BX067642.1|CNS09OCU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 792 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 749

---

>emb|BX067641.1|CNS09OCT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 296 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 339

---

>emb|BX067553.1|CNS09OAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 723 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 680

---

>emb|BX067552.1|CNS09OAC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 293 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 336

---

>emb|BX066871.1|CNS09NRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 778 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 735

---

>emb|BX066870.1|CNS09NRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 306 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 349

---

>emb|BX066087.1|CNS09N5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 300 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 343

---

>emb|BX066067.1|CNS09N53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 779 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 736

---

>emb|BX066066.1|CNS09N52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 284 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 327

---

>emb|BX064916.1|CNS09M94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 768 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 725

---

>emb|BX064915.1|CNS09M93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 109 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 152

---

>emb|BX064537.1|CNS09LYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 803 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 760

---

>emb|BX064536.1|CNS09LYK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 313 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 356

---

>emb|BX064227.1|CNS09LPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 778 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 735

---

>emb|BX064226.1|CNS09LPY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 524 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 567

---

>emb|BX063235.1|CNS09KYF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 116 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 159

---

>emb|BX062999.1|CNS09KRV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 297 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 340

---

>emb|BX062083.1|CNS09K2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 783 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 740

---

>emb|BX062082.1|CNS09K2E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 291 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 334

---

>emb|BX061501.1|CNS09JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 776 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 733

---

>emb|BX060363.1|CNS09IQN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 313 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 356

---

>emb|BX059169.1|CNS09HTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 776 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 733

---

>emb|BX059168.1|CNS09HTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 305 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 348

---

>emb|BX057376.1|CNS09GFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 799 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 756

---

>emb|BX057375.1|CNS09GFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 295 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 338

---

>emb|BX056370.1|CNS09FNQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 806 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 763

---

>emb|BX056369.1|CNS09FNP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 321 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 364

---

>emb|BX055201.1|CNS09ER9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 112 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 155

---

>emb|BX051412.1|CNS09BU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 298 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 341

---

>emb|BX048982.1|CNS099YI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 726

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 280 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 323

---

>emb|BX048359.1|CNS099H7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 320 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 363

---

>emb|BX044318.1|CNS096CY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 775 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 732

---

>emb|BX044317.1|CNS096CX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 183 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 226

---

>emb|BX042869.1|CNS0958P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 819 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 776

---

>emb|BX042868.1|CNS0958O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 307 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 350

---

>emb|BX041611.1|CNS0949R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 291 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 334

---

>emb|BX041334.1|CNS09422 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 683 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 640

---

>emb|BX041333.1|CNS09421 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 203 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 246

---

>emb|BX041214.1|CNS093YQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 799 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 756

---

>emb|BX041213.1|CNS093YP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 295 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 338

---

>emb|BX041187.1|CNS093XZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 304 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 347

---

>emb|BX041126.1|CNS093WA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 300 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 343

---

>emb|BX039275.1|CNS092GV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 749 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 706

---

>emb|BX039274.1|CNS092GU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 333 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 376

---

>emb|BX037468.1|CNS0912O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 789 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 746

---

>emb|BX037467.1|CNS0912N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 306 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 349

---

>emb|BX036510.1|CNS090C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 305 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 348

---

>emb|BX035990.1|CNS08ZXM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 300 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 343

---

>emb|BX034262.1|CNS08YLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 290 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 333

---

>emb|BX032670.1|CNS08XDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 307 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 350

---

>emb|BX032237.1|CNS08X1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 262 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 305

---

>emb|BX031811.1|CNS08WPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 784 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 741

---

>emb|BX031810.1|CNS08WPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 293 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 336

---

>emb|BX031700.1|CNS08WMG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 297 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 340

---

>emb|BX031320.1|CNS08WBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 788 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 745

---

>emb|BX031319.1|CNS08WBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 306 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 349

---

>emb|BX031133.1|CNS08W6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 785 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 742

---

>emb|BX031132.1|CNS08W6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 298 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 341

---

>emb|BX029479.1|CNS08UWR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 779 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 736

---

>emb|BX029478.1|CNS08UWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 301 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 344

---

>emb|BX028834.1|CNS08UEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 784 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 741

---

>emb|BX028833.1|CNS08UET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 285 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 328

---

>emb|BX027737.1|CNS08TKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 629

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 30  ttcttctacccgctcgactttaccttcgtctgcccgacggagat 73

---

>emb|BX025425.1|CNS08RS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 785 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 742

---

>emb|BX025424.1|CNS08RS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 289 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 332

---

>emb|BX025170.1|CNS08RL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 295 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 338

---

>emb|BX023596.1|CNS08QDC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 315 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 358

---

>emb|BX023566.1|CNS08QCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 307 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 350

---

>emb|BX021889.1|CNS08P1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 767 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 724

---

>emb|BX021888.1|CNS08P1W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 294 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 337

---

>emb|BX020060.1|CNS08NN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 791 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 748

---

>emb|BX020059.1|CNS08NN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 293 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 336

---

>emb|BX019879.1|CNS08NI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 693 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 650

---

>emb|BX019878.1|CNS08NI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 321 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 364

---

>emb|BX018246.1|CNS08M8Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 257 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 300

---

>emb|BX016634.1|CNS08KZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 315 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 358

---

>emb|BX015942.1|CNS08KGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 717 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 674

---

>emb|BX014547.1|CNS08JDZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 311 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 354

---

>emb|BX013680.1|CNS08IPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 777 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 734

---

>emb|BX013679.1|CNS08IPV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 295 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 338

---

>emb|BX012101.1|CNS08HI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 778 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 735

---

>emb|BX012100.1|CNS08HI0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 293 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 336

---

>emb|BX012009.1|CNS08HFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 290 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 333

---

>emb|BX011355.1|CNS08GXB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 356 ttcttctaccctctggacttcaccttcgtctgcccaactgagat 399
           ||||||||||| || ||||| |||||||||||||| || |||||
Sbjct: 782 ttcttctacccgctcgactttaccttcgtctgcccgacggagat 739


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,563,432
Number of Sequences: 3902068
Number of extensions: 3563432
Number of successful extensions: 89063
Number of sequences better than 10.0: 488
Number of HSP's better than 10.0 without gapping: 492
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83686
Number of HSP's gapped (non-prelim): 5375
length of query: 429
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 407
effective length of database: 17,147,199,772
effective search space: 6978910307204
effective search space used: 6978910307204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---