| Clone Name | baet01f02 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | ref|XM_687558.1| PREDICTED: Danio rerio similar to forkhead box ... | 42 | 0.17 | 2 | ref|XM_690973.1| PREDICTED: Danio rerio similar to forkhead box ... | 42 | 0.17 | 3 | emb|BX005000.10| Zebrafish DNA sequence from clone DKEY-25O16 in... | 42 | 0.17 | 4 | emb|AL844600.3| Mouse DNA sequence from clone RP24-92D2 on chrom... | 40 | 0.68 |
|---|
>ref|XM_687558.1| PREDICTED: Danio rerio similar to forkhead box E1 (LOC564209), mRNA Length = 1065 Score = 42.1 bits (21), Expect = 0.17 Identities = 27/29 (93%) Strand = Plus / Minus Query: 23 gcggctcttctctctgattgtcattcact 51 |||||||| |||||||| ||||||||||| Sbjct: 79 gcggctctgctctctgactgtcattcact 51
>ref|XM_690973.1| PREDICTED: Danio rerio similar to forkhead box E1 (LOC567676), mRNA Length = 1065 Score = 42.1 bits (21), Expect = 0.17 Identities = 27/29 (93%) Strand = Plus / Minus Query: 23 gcggctcttctctctgattgtcattcact 51 |||||||| |||||||| ||||||||||| Sbjct: 79 gcggctctgctctctgactgtcattcact 51
>emb|BX005000.10| Zebrafish DNA sequence from clone DKEY-25O16 in linkage group 1, complete sequence Length = 234373 Score = 42.1 bits (21), Expect = 0.17 Identities = 27/29 (93%) Strand = Plus / Minus Query: 23 gcggctcttctctctgattgtcattcact 51 |||||||| |||||||| ||||||||||| Sbjct: 138144 gcggctctgctctctgactgtcattcact 138116
>emb|AL844600.3| Mouse DNA sequence from clone RP24-92D2 on chromosome 4, complete sequence Length = 149318 Score = 40.1 bits (20), Expect = 0.68 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 tcttctctctgattgtcatt 47 |||||||||||||||||||| Sbjct: 123386 tcttctctctgattgtcatt 123405 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 422,326 Number of Sequences: 3902068 Number of extensions: 422326 Number of successful extensions: 23938 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 23934 Number of HSP's gapped (non-prelim): 4 length of query: 69 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 48 effective length of database: 17,151,101,840 effective search space: 823252888320 effective search space used: 823252888320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)