>gb|AC123049.4| Mus musculus BAC clone RP24-360B3 from chromosome 5, complete sequence
          Length = 166292

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    cagccacaacacttcccaaa 182
              ||||||||||||||||||||
Sbjct: 102651 cagccacaacacttcccaaa 102632

>emb|BX470150.13| Zebrafish DNA sequence from clone DKEY-164K14 in linkage group 23,
              complete sequence
          Length = 209342

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    atcagtgagccttttgtatc 152
              ||||||||||||||||||||
Sbjct: 183089 atcagtgagccttttgtatc 183070

>gb|AC087865.8| Homo sapiens 12 BAC RP11-66D24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 169045

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    aaccctgtctcttgttgctg 91
             ||||||||||||||||||||
Sbjct: 93284 aaccctgtctcttgttgctg 93265

>gb|BC036224.1| Homo sapiens cDNA clone IMAGE:5272313
          Length = 1922

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 131  agatcagtgagccttttgta 150
            ||||||||||||||||||||
Sbjct: 1004 agatcagtgagccttttgta 1023

>gb|AC091516.8| Homo sapiens 12q BAC RP11-474L23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 158998

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    aaccctgtctcttgttgctg 91
             ||||||||||||||||||||
Sbjct: 48681 aaccctgtctcttgttgctg 48700

>gb|AC099778.2| Homo sapiens chromosome 3 clone RP11-708J19, complete sequence
          Length = 212775

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   agatcagtgagccttttgta 150
             ||||||||||||||||||||
Sbjct: 24514 agatcagtgagccttttgta 24495


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,442,354
Number of Sequences: 3902068
Number of extensions: 2442354
Number of successful extensions: 34860
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34851
Number of HSP's gapped (non-prelim): 9
length of query: 265
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 243
effective length of database: 17,147,199,772
effective search space: 4166769544596
effective search space used: 4166769544596
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)